Skip to main content
NCBI home page
Cellular and Molecular Immunology logoLink to Cellular and Molecular Immunology
. 2014 Apr 14;11(4):396–404. doi: 10.1038/cmi.2014.23

Prognoses of patients with acute-on-chronic hepatitis B liver failure are closely associated with altered SOCS1 mRNA expression and cytokine production following glucocorticoid treatment

Jian-Jun Zhang 1, Yu-Chen Fan 1,2, Ze-Hua Zhao 1, Yang Yang 1, Cheng-Yun Dou 1, Shuai Gao 1, Kai Wang 1,2
PMCID: PMC4085521  PMID: 24727541

Abstract

Suppressor of cytokine signaling (SOCS) 1 plays a crucial role in the immune response and might contribute to the prognoses of liver failure treated with glucocorticoid. We recruited 47 acute-on-chronic hepatitis B liver failure (ACHBLF) patients receiving glucocorticoid treatment and 30 healthy controls to determine the potential effects of glucocorticoid on the transcriptional level of SOCS1 in peripheral blood mononuclear cells. On the third and twenty-eighth days of glucocorticoid treatment, SOCS1 expression was negatively correlated with model for end-stage liver disease (MELD) score. Interleukin-6 (IL-6) and tumor-necrosis factor-α (TNF-α) levels were statistically lower, while the SOCS1 transcription level was higher in survivors than non-survivors both in pre- and post-treatment ACHBLF patients. The methylation rate of the SOCS1 promoter in ACHBLF patients was higher than in healthy control patients as determined by methylation-specific polymerase chain reaction. The mRNA level of SOCS1 in methylated promoters was significantly lower than from patients with unmethylated SOCS1 promoters. interferon (IFN)-γ-responsive and STAT1-dependent gene expression was higher in survivors and was dramatically decreased with rising expression of SOCS1 after glucocorticoid treatment. Mortality rates were significantly higher in methylated patients than for those without methylation at the end of a 90-day follow-up. Furthermore, we found that five in six surviving patients displayed demethylated SOCS1 on the twenty-eighth day after treatment, while that number was 3 in 10 in the non-survivors. These findings suggested that ACHBLF patients without SOCS1 methylation may have a favorable response to corticosteroid treatment.

Keywords: acute-on-chronic hepatitis B liver failure, cytokine, glucocorticoid treatment, methylation, SOCS

Introduction

Acute-on-chronic hepatitis B liver failure (ACHBLF) is usually related to an increased incidence of reactivation of hepatitis B virus (HBV) infection and an acute hepatic insult characterized by jaundice and coagulopathy.1 It progresses rapidly with an extremely high mortality rate of up to 60%–80%.2 In the primary pathological mechanism of hepatic failure, uncontrolled hepatic immune activation by HBV infection and cell-mediated lymphocytotoxicity reaction leads to an imbalance of pro-inflammatory cytokines that contributes to the development of ACHBLF.

Suppressor of cytokine signaling (SOCS) 1 has been identified as a key negative feedback regulator of cytokine stimulation that is extremely important for limiting the inflammatory responses.3,4,5,6 It is recognized as an important mechanism for the negative regulation of the Janus kinase and signal transducer and activator of transcription (JAK–STAT) pathway, which is one of the transduction of cytokine receptors signals.7 SOCS1 protein limits the extent of Toll-like receptor signaling by inhibiting type I interferon (IFN) signaling.8,9 Studies have indicated that interferon regulatory factors (IRFs)-1, chemokine (C–X–C motif) ligand (CXCL) 9, CXCL10 and CXCL11 played essential roles in the JAK/STAT signaling pathway.10,11,12 In addition, SOCS1 is induced by various cytokines including IFN-γ, interleukin-6 (IL-6) and tumor-necrosis factor-α (TNF-α), which downregulate SOCS1 in a feedback loop.13,14,15

The adrenal insufficiency in liver diseases makes it reasonable to introduce sufficient doses of corticosteroids in the early stage of liver failure.16,17 As an optional therapy for ACHBLF, corticosteroid treatment has received much attention.18,19,20,21 Glucocorticoids suppresses inflammation by controlling and preventing the immune-correlated damages. The upregulation of SOCS1 by corticosteroids has been established both in vivo and in vitro,22,23,24 which suggests that cortisol may be playing a key role in suppressing cytokine signaling and the associated inflammatory response through SOCS1. However, the effect of glucocorticoid on SOCS1 remains unclear in ACHBLF.

In the present study, we explored the inflammatory cytokine levels and SOCS1 gene mRNA expression in peripheral blood mononuclear cells (PBMCs) before and after glucocorticoid treatment in ACHBLF patients. We also investigated the correlation between SOCS1 expression, model for end-stage liver disease (MELD) scores and mortality rates. Furthermore, the SOCS1 promoter methylation status in different stages of glucocorticoid treatment was analyzed more intensively to verify the potential role of methylation and the effect of corticoids on the prognosis of patients with ACHBLF.

Materials and methods

Subjects

We recruited a cohort of patients with ACHBLF who were admitted to Qilu Hospital of Shandong University between December 2007 and May 2013. The diagnosis of HBV-related ACHBLF was made based on the APASL criteria,1 with more than a six-month history of chronic hepatitis B, serum total bilirubin >85 µmol/l and international normalized ratio (INR) ≥1. 5 or prothrombin time activity<40%. None of the patients were associated with alcohol abuse, intravenous drug abuse, pregnancy, antioxidant use, receiving interferon therapy, concomitant chronic hepatitis C, hepatocellular carcinoma or other metastatic liver tumors that can affect liver function. Autoimmune, metabolic disorders and human immune deficiency virus infection were considered as exclusion criteria. Thirty healthy individuals were age- and sex-matched and then enrolled as controls.

None of the patients had used corticosteroids for at least 6 months prior to this study. Necessary conservative treatment, such as hepatoprotective medicines and nutritional support, was given to the ACHBLF patients. Adefovir (ADV) and entecavir, nucleoside analogs with significant inhibition of HBV DNA polymerase, were administered to inhibit viral replication for the patients when serum HBV DNA levels were greater than 104 copy/ml.1 Patients further received 1 mg/kg/day (average: 80 mg/day) of methylprednisolone or 0.75 mg/kg/day (average: 60 mg/day) of prednisolone daily after the diagnosis of ACHBLF. This dose was maintained for the first 3 days. Then, 0.75 mg/kg/day (average: 60 mg/day) of methylprednisolone or 0.5 mg/kg/day (average: 40 mg/day) of prednisolone was given for the second 3 days followed by 0.5 mg/kg/day (average: 40 mg/day) of methylprednisolone or 0.25 mg/kg/day (average: 20 mg/day) of prednisolone until the end of the third 3-day period.21 The corticosteroid doses were gradually reduced by 5 or 10 mg at least every 4 days to 0.5 mg/kg/day (average: 30 mg/day) depending on the improvement of the liver function until the twenty-eighth day for a complete withdrawal. A follow-up visit every month was offered for the patients with ACHBLF at least 90 days. After the exclusion of patients who were lost in follow-up, complete data were recorded (Figure 1). This study was approved by the local Ethical Committee of Qilu Hospital of Shandong University, and informed consent was obtained from each participant prior to the collection of blood samples.

Figure 1.

Figure 1

Open in a new tab

Protocols for treatment.

Measurement and analysis of clinical data

Hepatitis B s antigen and hepatitis B e antigen were detected by an electrochemiluminescence assay (Roche Diagnostics Ltd, Mannheim, Germany) as previously reported.25,26 The level of HBV DNA in serum was assayed by a fluorescent quantitative detection kit (Da An Gene, Guangzhou, China) according to the manufacturer's protocols. A MELD score was employed to estimate the severity of disease in ACHBLF patients as follows: MELD score=3.8×ln [serum bilirubin (µmol/l)×0.058]+11.2×ln (PT−INR)+9.6×ln [serum Cr (µmol/l)×0.011]+6.4×(0 or 1) (cholestatic or alcoholic cirrhosis: 0; other liver diseases: 1).27

RNA extraction and quantitative real-time PCR

Whole blood (5 ml) was collected into a sodium heparin tube. Ficoll-Paque Plus density gradient medium (GE Healthcare, Uppsala, Sweden) was used for PBMC isolation from heparinized blood. Cells were harvested immediately in TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and stored in RNA lysis buffer at −80 °C. Total RNA from PBMCs was extracted by TRIzol (Invitrogen). Two micrograms of total RNA were reverse transcribed into cDNA using a first strand cDNA synthesis kit (Fermentas, Vilnius, Lithuania). Levels of SOCS1 mRNA were measured by quantitative real-time PCR, which was performed on a Lightcycler using SYBR Green (Toyobo, Osaka, Japan) as a double-strand DNA-specific binding dye. GAPDH was used as the endogenous control. Amplification was carried out in a total volume of 20 µl containing 0.5 mM of each primer, 10× SYBR Green and 0.5 mM of cDNA according to the following thermal profile: denaturation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 60 °C for 30 s and 72 °C for 30 s. The primer sequences are listed in Table 1 (Fermentas, Vilnius, Lithuania).

Table 1. Primer sequences.

Gene Primer sequence (5′–3′)
SOCS1 F: CACGCACTTCCGCACATTCC
  R: TCCAGCAGCTCGAAGAGGCA
STAT1 F: GCTTCTTGGTCCTAACGC
  R: TCTCGCTCCTTGCTGATG
IRF-1 F: TTGGCATCATGGTGGCTGT
  R: AAGGAGGATGGTCCCCTGTTT
CXCL9 F: GCATCATCTTGCTGGTTCTGATTGG
  R: GCGACCCTTTCTCACTACTGGGGT
CXCL10 F: GTGCAGTGGGTCTCTAGGTGTTGT
  R: GCCGATAGTAAGCAATGAAGTGAA
CXCL11 F: GCTATAGCCTTGGCTGTGATATTGTG
  R: CTGCCACTTTCACTGCTTTTACC
Open in a new tab

Abbreviations: CXCL, C–X–C motif ligand; IRF, interferon regulatory factor; SOCS, suppressor of cytokine signaling; STAT, signal transducer and activator of transcription.

Plasma collection and enzyme-linked immunosorbent assay for detection of plasma IL-6 and TNF-α level

Plasma was obtained from whole blood by centrifugation and was aliquoted and stored at −80 °C until the assay was performed. Plasma cytokine levels were measured using a Human Immunoassay Valukine ELISA Kit for IL-6 and TNF-α (R&D San Diego, CA, USA), according to the instructions of the manufacturer. The detection limit was 0.70 pg/ml for IL-6 and 8 pg/ml for TNF-α, respectively.

DNA extraction sodium bisulfite modification

DNA from PBMCs was extracted with phenol-chloroform using a QIAamp DNA Blood Mini Kit (QIAGEN, Valencia, CA, USA) following the standard protocol provided by the manufacturer and stored at −20 °C. DNA was collected in a final elution volume of 50 µl. The extracted DNA was treated with sodium bisulfite using an EZ DNA methylation kit (Zymo Research, Orange, CA, USA) to convert all unmethylated cytosines to uracils. Bisulfite-modified DNA was resuspended in 10 µl of elution buffer and stored at −20 °C until methylation-specific polymerase chain reaction (MS-PCR).

Methylation-specific PCR

The bisulfite-modified DNA was subjected to amplification using PCR. SOCS1-specific primers for MS-PCR were previously described by Miyoshi et al..28 Amplification was carried out in a thermal cycler for a total of 35 cycles consisting of 95 °C for 30 s, 60 °C for 30 s and 30 s at 72 °C in a 25 µl reaction mixture containing 55 ng bisulfite modified DNA, 2.5 µl 10× PCR buffer, 200 µM of each dNTP, 1 µM of each primer and 1 U of Taq polymerase (Zymo Taq DNA Polymerase; Zymo Research Corp., Foster City, CA, USA). Human Methylated & Non-methylated DNA Set (Zymo Research, Orange, CA, USA) was used as positive and negative controls for methylated alleles. Water blanks were included with each assay. The PCR products were separated using a 2.0% agarose gel and visualized under UV illumination by staining with ethidium bromide.

Statistical analysis

The data were analyzed using SPSS (Statistical Package for the Social Sciences) 17.0 statistical software (SPSS Inc., Chicago, IL, USA). The results are expressed as the mean±standard deviation (s.d.). Student's t-test was further applied. The Pearson test was used for correlation analysis. Survival rates were analyzed using the Kaplan–Meier method using the Breslow test to assess the difference between survival curves. All statistical analyses were two-sided, and P<0.05 was considered to be statistically significant.

Results

Clinical response of ACHBLF patients

Patients were selected in this study according to the guidelines of the APASL. Forty-seven patients survived through the twenty-eighth day of treatment. There were 10 females and 37 males; the mean age was 44.48±11.93 years. On the twenty-eighth day of treatment, the number of patients displaying hepatic encephalopathy with different grading was down significantly (grades: 0/1/2/3/4, cases pre-treatment: 18/15/6/5/3, cases on the twenty-eighth day post-treatment: 23/14/6/3/1, respectively). Patients with three grades of ascites29 also showed remarkable improvement (grades: 0/1/2/3, cases pre-treatment: 17/17/9/4, cases on the twenty-eighth day post-treatment: 25/15/5/2, respectively). The MELD score reduced from 19.78±3.88 to 10.61±4.96 in 28 days. The clinical and biochemical features of disease in the 47 surviving patients at admission as well as healthy controls are provided in Table 2.

Table 2. Clinical and biochemical features.

Groups Pre-treatment ACHBLF patients (0 day) Post-treatment ACHBLF patients (28th day) Healthy controls
Cases 47 47 30
Age (year) 44.48±11.93 44.48±11.93 40.50±9.24
Sex (male/female) 37/10 37/10 16/14
TBIL (mmol/l) 318.74±118.73*,§ 146.59±137.35§ 12.28±4.37
ALT (U/l) 358.11±249.52*,§ 62.16±29.83§ 19.37±7.43
PTA (%) 34.34±6.74*,§ 58.65±16.88§ 106.77±10.28
ALB (g/l) 32.01±4.35*,§ 37.01±4.35§ 42.26±3.46
HBeAg (+/−) 30/17 27/20 NA
HBV DNA (log copies/ml) 4.09±2.81§ 3.685±2.43§ NA
MELD score 19.78±3.88*,§ 10.61±4.96§ NA
Encephalopathy (0/1/2/3/4) 18/15/6/5/3 23/14/6/3/1 NA
Ascites (0/1/2/3) 17/17/9/4 25/15/5/2 NA
Open in a new tab

Abbreviations: ALT, alanine aminotransferase; AST, aspartate aminotransferase; HBeAg, hepatitis B e antigen; HBV, hepatitis B virus; MELD, model for end-stage liver disease; PT, prothrombin time; PTA, prothrombin activity; TBIL: total bilirubin.

Values are expressed as the mean±standard deviation (s.d.) or median (average).

*

P<0.05 for pre-treatment ACHBLF patients vs. post-treatment patients;

§

P<0.05 for ACHBLF patients vs. healthy controls.

Before the glucocorticoid treatment, twenty-nine patients had not received antiviral treatment or had drug withdrawal for more than one year. ADV was administered at a daily dose of 10 mg to 18 patients, 100–300 mg lamivudine (LMV) to five patients and 0.5 mg entecavir to six patients. In addition, two patients were administered a combination of LMV and ADV. When the serum HBV DNA level was more than 104 copy/ml after diagnosis with ACHBLF, 31 patients were given antiviral treatment. The detailed information about the anti-HBV drugs are provided in Table 3.

Table 3. Patients in use of anti-HBV drugs.

  Without antiviral treatment ADV10 mg LMV100–300 mg ETV0.5 mg LMV+ADVLMV: 100 mgADV: 10 mg
Before glucocorticoid treatment 21 13 5 6 2
In glucocorticoid treatment 5 20 3 17 2
Open in a new tab

Abbreviations: ADV, adefovir; ETV, entecavir; HBV, hepatitis B virus; LMV, lamivudine.

The altered mRNA level of SOCS1 gene and related cytokines/genes in ACHBLF patients

SOCS1 mRNA levels were presented as gene expression normalized to an endogenous reference GAPDH from healthy controls. SOCS1 expression was significantly higher in ACHBLF patients compared with healthy controls (6.86×10−2±7.82×10−3 for ACHBLF patients vs. 3.89×10−2±4.92×10−3 for healthy controls, P<0.05). The baseline expression in non-survivors was significantly lower than was observed in survivors (7.05×10−2±7.17×10−3 for survivors vs. 6.45×10−2±7.83×10−3 for non-survivors, P=0.007). On the third day of treatment, survivors showed higher expression of SOCS1 than non-survivors (8.18×10−2±1.35×10−2 for survivors vs. 6.56×10−2±1.82×10−2 for non-survivors, P<0.05). The expression of SOCS1 was significantly increased in survivors on the twenty-eighth day after glucocorticoid treatment (7.41×10−2±7.29×10−3), while non-survivors (6.27×10−2±6.76×10−3) remained unchanged (Figure 2a).

Figure 2.

Figure 2

Open in a new tab

Effect of glucocorticoid in ACHBLF patients. The mRNA levels were quantified by RT-PCR. Levels of plasma IL-6 and TNF-α were determined by ELISA. *P<0.05. ACHBLF, acute-on-chronic hepatitis B liver failure; TNF, tumor-necrosis factor.

The plasma levels of IL-6 and TNF-α increased significantly in ACHBLF patients who completed the treatment compared with healthy controls (IL-6: 89.9±46.8 pg/ml for ACHBLF patients vs. 8.22±3.30 pg/ml for healthy controls; and TNF-α: 111.9±21.2 pg/ml for ACHBLF patients vs. 11.18±1.64 pg/mlL for healthy controls, P<0.05, respectively). Levels of both cytokines decreased after glucocorticoid treatment. There were no significant differences in plasma levels of IL-6 or TNF-α between survivors and non-survivors before treatment. On the third day, when SOCS1 expression was maximal, IL-6 and TNF-α levels were decreased to their lowest levels (IL-6: 60.77±32.12 pg/ml and TNF-α: 89.82±38.70 pg/ml for ACHBLF patients). TNF-α levels of non-survivors was higher than survivors though there was no significant difference in IL-6 levels between the two groups. On the twenty-eighth day of treatment, IL-6 and TNF-α levels were statistically lower (P<0.05) in survivors than non-survivors (Figure 2b and c).

Because SOCS1 has been shown to negatively regulate JAK/STAT signaling, we sought to investigate the relationship between the IFN-γ-responsive, STAT1-dependent genes and SOCS1 under the influence of glucocorticoids. The PBMCs of ACHBLF patients had higher expression of STAT1, IRF-1, CXCL9, CXCL10 and CXCL11 than a healthy control (STAT1: 8.04×10−2±1.30×10−2 for ACHBLF patients vs. 2.17×10−2±3.46×10−3 for healthy controls, IRF-1: 4.02×10−2±6.47×10−3 for ACHBLF patients vs. 1.35×10−2±2.69×10−3 for healthy controls, CXCL9: 2.41×10−1±3.81×10−2 for ACHBLF patients vs. 1.79×10−1±4.23×10−2 for healthy controls, CXCL10: 2.47×10−1±3.84×10−2 for ACHBLF patients vs. 1.03×10−1±3.42×10−2 for healthy controls, CXCL11: 7.84×10−4±1.23×10−4 for ACHBLF patients vs. 4.95×10−4±1.78×10−4 for healthy controls, P<0.05, respectively). Before treatment, the STAT1, IRF-1, CXCL9 and CXCL10 RNA expression of survivors was significantly higher than non-survivors and was concomitant with a dramatically lower level of SOCS1 in non-survivors. STAT1, IRF-1, CXCL9 and CXCL10 began to decline on the third day. The expression of all of these genes was higher in survivors than non-survivors on the twenty-eighth day. Except for CXCL11, the mRNA levels were reduced >30% relative to the level before glucocorticoid treatment (Figure 2f–j).

Correlation of SOCS1 expression with MELD scores in ACHBLF patients

The MELD score is widely accepted and used as a relatively accurate model to assess prognosis in acute liver failure. We analyzed the correlation between expression of SOCS1 and the MELD score in ACHBLF patients before the treatment. The results showed that SOCS1 expression was negatively correlated with the MELD score in both pre-treatment (r=−0.054, P<0.001) and post-treatment ACHBLF patients (r=−0.645, P<0.001) (Figure 3).

Figure 3.

Figure 3

Open in a new tab

Linear correlations between MELD scores and SOCS1 mRNA levels in ACHBLF patients. SOCS1 expression was significantly negatively associated with MELD scores both in pre-treatment ACHBLF patients (a) and post-treatment patients (b). ACHBLF, acute-on-chronic hepatitis B liver failure; MELD, model for end-stage liver disease; SOCS, suppressor of cytokine signaling.

Effect of glucocorticoid on liver function in ACHBLF patients

TBIL, PTA, and MELD score were the major laboratory indices in the presently studied ACHBLF patients. Compared with healthy controls, the TBIL in ACHBLF patients was higher (343.89±149.88 mmol/l for ACHBLF patients vs. 12.28±4.37 mmol/l for healthy controls, P<0.05), and PTA decreased significantly (32.96±7.51% for ACHBLF patients vs. 106.77±10.28% for healthy controls, P<0.05) before treatment.

The effect of corticosteroid treatment on the survival ratios of enrolled patients was investigated in this study. The mortality rate was 52.3% at the end of a 90-day follow-up period. We further divided the ACHBLF patient group into survivors who survived more than 90 days after treatment or non-survivors. In the 47 ACHBLF patients who completed the glucocorticoid treatment, the survivor number was 32 at the end of the 90-day follow-up period. There was no significant difference between survivors and non-survivors in TBIL and PTA before glucocorticoid treatment (P>0.05). TBIL decreased and PTA increased significantly in survivors (P<0.05) while non-survivors showed no improvement on the twenty-eighth day (Figure 2d and e).

Effect of glucocorticoid on methylation status of SOCS1 in ACHBLF patients

To investigate the methylation status of SOCS1, the PBMC DNA for MS-PCR from ACHBLF patients and healthy controls was collected before the application of glucocorticoid. Previous studies showed that there is a persistence of glucocorticoid-induced DNA change in both the blood and the brain for up to 4 weeks, and even 3 months, following glucocorticoid withdrawal.30 Because CpGs are stable once demethylated in the absence of glucocorticoids,31,32 we chose the third and twenty-eighth days of glucocorticoid treatment for assessment of the methylation status of SOCS1. Representative examples of MS-PCR assay results are presented in Figure 4a. MS-PCR of SOCS1 promoter revealed 34% of methylation in ACHBLF patients. No SOCS1 promoter methylation was detected in the 30 healthy controls.

Figure 4.

Figure 4

Open in a new tab

Effect of glucocorticoid on methylation statue of SOCS1 in ACHBLF patients. (a) A typical SOCS1 promoter methylation analysis result of ACHBLF patients and HC groups. Lane m for methylation-specific primers. Lane u for unmethylation-specific primers. The detection of 164- and 171-bp bands indicates the presence of the methylated sequences and the unmethylated sequences, respectively. (b) The mRNA levels of SOCS1 in a subgroup of ACHBLF patients. (c) Kaplan–Meier curves showing the 90-day survival rate. Survival curves were estimated by the Kaplan–Meier method and Breslow significance test. M for patients with methylated SOCS1. U for patients with unmethylated SOCS1. HC for healthy control, Neg for negative controls, Pos for positive controls. S for survivors. N for non-survivors. *P<0.05. ACHBLF, acute-on-chronic hepatitis B liver failure; MELD, model for end-stage liver disease; SOCS, suppressor of cytokine signaling.

When comparing the difference between patients with methylated and unmethylated DNA who completed the glucocorticoid treatment at baseline, the clinicopathological features of the two groups were shown in Table 4. The mRNA level of SOCS1 from methylated patients was significantly lower than that from unmethylated (6.12×10−2±5.90×10−3 vs. 7.24×10−2±5.72×10−3, P<0.001) (Figure 4b).

Table 4. Laboratory parameters between methylated and unmethylated groups in ACHBLF patients at baseline.

Groups Methylated group (n=16) Unmethylated group (n=31) P value
ALT (IU/l) 350.54±213.18 362.02±269.63 0.883
AST (IU/l) 278.59±310.18 272.05±259.89 0.942
TBIL (µmol/l) 367.47±113.85 293.58±114.95 0.042
PTA (%) 34.42±7.07 34.31±6.70 0.958
HBV DNA (log copies/ml) 5.15±2.67 3.56±2.78 0.125
MELD score 21.16±4.46 18.76±3.17 0.038
Open in a new tab

Abbreviations: ACHBLF, acute-on-chronic hepatitis B liver failure; ALT, alanine aminotransferase; AST, aspartate aminotransferase; HBV, hepatitis B virus; MELD, model for end-stage liver disease; PTA, prothrombin activity; TBIL: total bilirubin.

Moreover, we evaluated the methylation status of SOCS1 on the third and twenty-eighth days of treatment with glucocorticoids. There was no change in the methylation status on the third day. We found eight methylated patients who exhibited SOCS1 demethylation on the twenty-eighth day when the corticosteroid therapy ended. Five in six survivors had demethylated SOCS1, while the number was three in ten for non-survivors (Figure 5). The corticosteroid therapy did raise the survival ratios significantly in patients without SOCS1 methylation compared with the methylated patients after a 90-day follow-up (P<0.05) (Figure 4c).

Figure 5.

Figure 5

Open in a new tab

Clinical outcomes of patients with the methylated SOCS1 gene before glucocorticoid treatment. Sixteen patients were found with methylated SOCS1 before glucocorticoid treatment. Five in six survivors had demethylated SOCS1 on the twenty-eighth day after treatment, while the number was three in ten for non-survivors. SOCS, suppressor of cytokine signaling.

Discussion

Our study provides a new insight into understanding the role of the SOCS1 gene and the effect of corticosteroids on the inflammatory response in ACHBLF patients. We found the baseline difference of SOCS1 gene expression between ACHBLF patients and healthy controls. The dynamic change in SOCS1 and IL-6/TNF-α levels during the glucocorticoid treatment was correlated with the severity of the patient's condition. Moreover, we also observed the methylation and demethylation of the SOCS1 promoter in PBMCs under corticosteroid influence. The liver function and survival ratios of patients without SOCS1 methylation improved significantly during the clinical follow-up.

The pathogenesis of ACHBLF was related to immune-mediated liver injury and over enhancement of immunologic function.33,34 The immunopathological damage and microcirculation disturbance could lead to liver cells in ischemia, hypoxia, and edema. As an immunomodulator, corticosteroids suppress the function of CTL to prevent or delay primary liver injury. They can prevent liver cells from necrosis and rapidly progressive acute exacerbation by protecting the cell membrane, lysosomal enzymes and mitochondria.35 Previous studies suggest that the use of corticosteroids was crucial for preventing liver cell necrosis when used in the early stage of severe hepatitis.19 Given this, we speculated that the potential direct effect of glucocorticoids on certain inflammatory regulators could be evaluated for better therapeutic efficacy. Previous studies revealed that overwhelming pro-inflammatory cytokines were secreted after the activation of mononuclear macrophages.36 They destroyed the endothelial cells of the liver sinus, led to microcirculatory disturbance, and caused ischemia necrosis of the liver in an extremely brief period.37,38 In our study, it was expected that the liver function would be improved after corticosteroid treatment. The serum levels of pro-inflammatory cytokines IL-6 and TNF-α were also significantly decreased. The cytokine levels were higher in non-survivors than survivors. These cytokine levels were negatively correlated with the SOCS1 mRNA levels (r=−0.717, P<0.001 for IL-6, and r=−0.388, P=0.023 for TNF-α, respectively). These findings confirmed that the cytokines regulated by SOCS1 may participate in the pathogenesis of ACHBLF.

As an integral component of a negative feedback regulator, there were obvious correlations between the expression of SOCS1 and the inflammatory grade and the severity of hepatitis.39 The regulatory role of SOCS1 in oxidative stress-induced apoptosis has also been investigated to determine the role of SOCS1 in inhibition of cellular apoptosis.40 Our study investigated expression of SOCS1 before and after glucocorticoid treatment and found that increased transcription levels of SOCS1 were positively associated with the MELD score pre- and post-treatment. The SOCS1 expression level in survivors changed while the level remained unchanged in the non-survivors. These findings suggested that the increased SOCS1 mRNA levels in PBMCs were correlated with improvement of liver function. It was confirmed that inducible expression of SOCS1 was stimulated by Toll-like receptor and triggered the innate immune responses to the pathogen.41 SOCS1 is known to be induced by IFN, and it coordinates the adaptive and innate immune responses in a STAT1-dependent manner.7,42 In adaptive immune responses, it has emerged that up regulation of SOCS1 also plays an important IFN-γ-independent role in T-lymphoid development and in the interaction mechanism of TH1/TH2 cells.43 Accumulating evidence revealed that the overexpression of SOCS1 abolished the IFN-γ-induced expression of pro-inflammatory genes and the release of related chemokines by blocking the JAK/STAT pathway.44,45,46,47 Our results showed that the low expression of SOCS1 was accompanied by a high level of IFN-γ-responsive and STAT1-dependent genes. The expression level of these genes dramatically decreased with rising expression of SOCS1 after glucocorticoid treatment. These results validated the negative effect of SOCS1 to regulate JAK/STAT signaling and the influence of glucocorticoid.

In addition to the general belief that high interferon levels are a result of exacerbated HBV infection, ACHBLF patients are expected to have higher SOCS1 levels compared to healthy controls (Figure 2a). However, this study did not find that the level of HBV DNA was correlated with the level of SOCS1 mRNA (P=0.21). This correlated with the findings of Koeberlein et al.,48 that HBV itself did not activate SOCS1. Even so, the nucleosides were used according to the APASL guideline to reduce the potential risk for stimulation of viral replication and precipitation.

There is growing evidence that corticosteroids could increase the expression of SOCS1. Haffner et al.22 observed that glucocorticoid receptor and SOCS1 form an intracellular complex by immunoprecipitation and appeared to increase the nuclear expression level of SOCS1. Cortisol treatment significantly elevated SOCS1 mRNA transcript levels in rainbow trout liver.23 Steroid-induced thymic lymphoid cell apoptosis is associated with reduced SOCS1 expression in the thymus of septic mice.24 On this basis, we studied the dynamic changes of SOCS1 and investigated the involvement of SOCS1 during corticosteroid treatment. We found that survivors displayed an obvious peak in SOCS1 expression after corticosteroid treatment accompanied by an improvement of liver function. It was demonstrated that corticosteroid therapy could upregulate SOCS1 expression in PBMCs.

Based on these results, we further focused on changes to the SOCS1 gene promoter and discovered a potential direct effect of glucocorticoids on SOCS1 methylation. Aberrant methylation of promoter regions in CpG islands, which silence transcription of the genes, is associated with the reduced mRNA level of SOCS1.49,50 In the present research, baseline SOCS1 mRNA expression in methylated patients was significantly lower than that in unmethylated. After glucocorticoid treatment, the SOCS1 expression increased with decreased cytokine levels and with the levels of related genes in the unmethylated group. The survival ratios were significantly lower in patients with methylated SOCS1 compared with unmethylated. This may represent a favorable response to corticosteroid treatment in ACHBLF patients without SOCS1 promoter methylation. In consideration of avoiding these steroidal side effects, patients with methylated SOCS1 should be particularly prudent when applying glucocorticoid.

Notably, it was also observed that demethylation occurred after corticosteroid treatment during the clinical follow-up. According to research into glucocorticoid-induced loss of DNA methylation of the Fkbp5 gene, the decrease of DNA methyltransferase 1 expression occurs 5 days after dexamethasone treatment.31 We speculated that the demethylation we observed may take place after the lessening of DNA methyltransferase. This was consistent with our result that there was no change in the methylation status on the third day of treatment. Previous studies found that glucocorticoid-induced DNA demethylation was stable following hormone withdraw experiments in rat hepatoma cells.30 Therefore, it is reasonable that the demethylation could be detected on the twenty-eighth day. Further mechanical studies will be required to explore the role glucocorticoids play in the status alteration of DNA methylation.

There are some limitations to this research. Complications may occur following corticosteroid treatment, such as bleeding, infections or even enhancement of HBV replication.6,39 Although still controversial, many research studies suggest that inhibition of the inflammatory response is an important advantage of corticosteroids. Insufficient blood samples prevented us from analyzing a larger selection of genes for detection. Coagulopathy and high bleeding risk made it infeasible to obtain a liver biopsy from the patients with liver failure. Although subsequent, long-term follow-up was difficult, we still made every effort to enroll as many patients as possible and continually monitor the change in SOCS1 methylation status after corticosteroid treatment.

In conclusion, we investigated the effect of corticosteroids on SOCS1 in ACHBLF patients with altered expression of mRNA and disparate methylation status. These results revealed the effect of glucocorticoid on downexpression and demethylation of SOCS1 in ACHBLF. The findings of ours study, at least to some extent, provide more data for the evaluation of corticosteroids and may provide a better therapeutic option for the treatment of ACHBLF.

Acknowledgments

This work was supported by grants from the Key Project of Chinese Ministry of Science and Technology (2012ZX10002007, 2013ZX10002001) and National Natural Science Foundation of China (81171579, 81201287).

The authors declare no conflict of interest.

References

  1. Sarin SK, Kumar A, Almeida JA, Chawla YK, Fan ST, Garg H, et al. Acute-on-chronic liver failure: consensus recommendations of the Asian Pacific Association for the study of the liver (APASL) Hepatol Int. 2009;3:269–282. doi: 10.1007/s12072-008-9106-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Finkenstedt A, Nachbaur K, Zoller H, Joannidis M, Pratschke J, Graziadei IW, et al. Acute on chronic liver failure: excellent outcome after liver transplantation but high mortality on the wait list. Liver Transpl. 2013;19:879–886. doi: 10.1002/lt.23678. [DOI] [PubMed] [Google Scholar]
  3. Strebovsky J, Walker P, Dalpke AH. Suppressor of cytokine signaling proteins as regulators of innate immune signaling. Front Biosci. 2012;17:1627–1639. doi: 10.2741/4008. [DOI] [PubMed] [Google Scholar]
  4. Babon JJ, Kershaw NJ, Murphy JM, Varghese LN, Laktyushin A, Young SN, et al. Suppression of cytokine signaling by SOCS3: characterization of the mode of inhibition and the basis of its specificity. Immunity. 2012;36:239–250. doi: 10.1016/j.immuni.2011.12.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Linossi EM, Babon JJ, Hilton DJ, Nicholson SE. Suppression of cytokine signaling: the SOCS perspective. Cytokine Growth Factor Rev. 2013;24:241–248. doi: 10.1016/j.cytogfr.2013.03.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Baetz A, Frey M, Heeg K, Dalpke AH. Suppressor of cytokine signaling (SOCS) proteins indirectly regulate Toll-like receptor signaling in innate immune cells. J Biol Chem. 2004;279:54708–54715. doi: 10.1074/jbc.M410992200. [DOI] [PubMed] [Google Scholar]
  7. Shi J, Wei L. Regulation of JAK/STAT signalling by SOCS in the myocardium. Cardiovasc Res. 2012;96:345–347. doi: 10.1093/cvr/cvs321. [DOI] [PubMed] [Google Scholar]
  8. Kubo M, Hanada T, Yoshimura A. Suppressors of cytokine signaling and immunity. Nat Immunol. 2003;4:1169–1176. doi: 10.1038/ni1012. [DOI] [PubMed] [Google Scholar]
  9. He Y, Zhang W, Zhang R, Min W. SOCS1 inhibits tumor necrosis factor-induced activation of ASK1–JNK inflammatory signaling by mediating ASK1 degradation. J Biol Chem. 2006;281:5559–5566. doi: 10.1074/jbc.M512338200. [DOI] [PubMed] [Google Scholar]
  10. Fenner JE, Starr R, Cornish AL, Zhang JG, Metcalf D, Schreiber RD, et al. Suppressor of cytokine signaling 1 regulates the immune response to infection by a unique inhibition of type I interferon activity. Nat Immunol. 2006;7:33–39. doi: 10.1038/ni1287. [DOI] [PubMed] [Google Scholar]
  11. Rosenblum JM, Shimoda N, Schenk AD, Zhang H, Kish DD, Keslar K, et al. CXC chemokine ligand (CXCL) 9 and CXCL10 are antagonistic costimulation molecules during the priming of alloreactive T cell effectors. J Immunol. 2010;184:3450–3460. doi: 10.4049/jimmunol.0903831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Olière S, Hernandez E, Lézin A, Arguello M, Douville R, Nguyen TL, et al. HTLV-1 evades type I interferon antiviral signaling by inducing the suppressor of cytokine signaling 1 (SOCS1) PLoS Pathog. 2010;6:e1001177. doi: 10.1371/journal.ppat.1001177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Davey GM, Heath WR, Starr R. SOCS1: a potent and multifaceted regulator of cytokines and cell-mediated inflammation. Tissue Antigens. 2006;67:1–9. doi: 10.1111/j.1399-0039.2005.00532.x. [DOI] [PubMed] [Google Scholar]
  14. Diehl S, Anguita J, Hoffmeyer A, Zapton T, Ihle JN, Fikrig E, et al. Inhibition of Th1 differentiation by IL-6 is mediated by SOCS1. Immunity. 2000;13:805–815. doi: 10.1016/s1074-7613(00)00078-9. [DOI] [PubMed] [Google Scholar]
  15. Prele CM, Woodward EA, Bisley, Keith-Magee A, Nicholson SE, Hart PH. SOCS1 regulates the IFN but not NFkappaB pathway in TLR-stimulated human monocytes and macrophages. J Immunol. 2008;181:8018–8026. doi: 10.4049/jimmunol.181.11.8018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. O'Beirne J, Holmes M, Agarwal B, Bouloux P, Shaw S, Patch D, et al. Adrenal insufficiency in liver disease—what is the evidence. J Hepatol. 2007;47:418–423. doi: 10.1016/j.jhep.2007.06.008. [DOI] [PubMed] [Google Scholar]
  17. Gao L, Wang JF, Xiang M, Fan YC, Zhang ZG, Wang K. Expression of human glucocorticoid receptor in T lymphocytes in acute-on-chronic hepatitis B liver failure. Dig Dis Sci. 2011;56:2605–2612. doi: 10.1007/s10620-011-1656-4. [DOI] [PubMed] [Google Scholar]
  18. Fujiwara K, Yasui S, Yonemitsu Y, Fukai K, Arai M, Imazeki F, et al. Efficacy of combination therapy of antiviral and immunosuppressive drugs for the treatment of severe acute exacerbation of chronic hepatitis B. J Gastroenterol. 2008;43:711–719. doi: 10.1007/s00535-008-2222-5. [DOI] [PubMed] [Google Scholar]
  19. Fujiwara K, Yokosuka O, Kojima H, Kanda T, Saisho H, Hirasawa H, et al. Importance of adequate immunosuppressive therapy for the recovery of patients with “life-threatening” severe exacerbation of chronic hepatitis B. World J Gastroenterol. 2005;11:1109–1114. doi: 10.3748/wjg.v11.i8.1109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. He B, Zhang Y, Lü MH, Cao YL, Fan YH, Deng JQ, et al. Glucocorticoids can increase the survival rate of patients with severe viral hepatitis B: a meta-analysis. Eur J Gastroenterol Hepatol. 2013;25:926–934. doi: 10.1097/MEG.0b013e32835f4cbd. [DOI] [PubMed] [Google Scholar]
  21. Zhao J, Zhang JY, Yu HW, He YL, Zhao JJ. Improved survival ratios correlate with myeloid dendritic cell restoration in acute-on-chronic liver failure patients receiving methylprednisolone therapy. Cell Mol Immunol. 2012;9:417–422. doi: 10.1038/cmi.2011.51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Haffner MC, Jurgeit A, Berlato C, Geley S, Parajuli N, Yoshimura A, et al. Interaction and functional interference of glucocorticoid receptor and SOCS1. J Biol Chem. 2008;283:22089–22096. doi: 10.1074/jbc.M801041200. [DOI] [PubMed] [Google Scholar]
  23. Philip AM, Daniel Kim S, Vijayan MM. Cortisol modulates the expression of cytokines and suppressors of cytokine signaling (SOCS) in rainbow trout hepatocytes. Dev Comp Immunol. 2012;38:360–367. doi: 10.1016/j.dci.2012.07.005. [DOI] [PubMed] [Google Scholar]
  24. Chung CS, Chen Y, Grutkoski PS, Doughty L, Ayala A. SOCS-1 is a central mediator of steroid-increased thymocyte apoptosis and decreased survival following sepsis. Apoptosis. 2007;12:1143–1153. doi: 10.1007/s10495-007-0059-7. [DOI] [PubMed] [Google Scholar]
  25. Lee HJ, Kim SY, Lee SM, Heo J, Kim HH, Chang CL, et al. Elecsys hepatitis B surface antigen quantitative assay: performance evaluation and correlation with hepatitis B virus DNA during 96 weeks of follow-up in chronic hepatitis B patients. Ann Lab Med. 2012;32:420–425. doi: 10.3343/alm.2012.32.6.420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Wursthorn K, Zacher BJ, Jaroszewicz J, Darnedde M, Manns M, Wedemeyer H. Development of a protocol for the quantitative determination of HBeAg using the Elecsys® HBeAg immunoassay. J Viral Hepat. 2011;18:e179–e183. doi: 10.1111/j.1365-2893.2010.01419.x. [DOI] [PubMed] [Google Scholar]
  27. Malinchoc M, Kamath PS, Gordon FD, Peine CJ, Rank J, ter Borg PC. A model to predict poor survival in patients undergoing transjugular intrahepatic portosystemic shunts. Hepatology. 2000;31:864–871. doi: 10.1053/he.2000.5852. [DOI] [PubMed] [Google Scholar]
  28. Miyoshi H, Fujie H, Moriya K, Shintani Y, Tsutsumi T, Makuuchi M, et al. Methylation status of suppressor of cytokine signaling-1 gene in hepatocellular carcinoma. J Gastroenterol. 2004;39:563–569. doi: 10.1007/s00535-003-1343-0. [DOI] [PubMed] [Google Scholar]
  29. Wong F, Bernardi M, Balk R. Sepsis in cirrhosis: report on the 7th meeting of the International Ascites Club. Gut. 2005;54:718–725. doi: 10.1136/gut.2004.038679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Thomassin H, Flavin M, Espinás ML, Grange T. Glucocorticoid-induced DNA demethylation and gene memory during development. EMBO J. 2001;20:1974–1983. doi: 10.1093/emboj/20.8.1974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Yang X, Ewald ER, Huo Y, Tamashiro KL, Salvatori R, Sawa A, et al. Glucocorticoid-induced loss of DNA methylation in non-neuronal cells and potential involvement of DNMT1 in epigenetic regulation of Fkbp5. Biochem Biophys Res Commun. 2012;420:570–575. doi: 10.1016/j.bbrc.2012.03.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Lee RS, Tamashiro KL, Yang X, Purcell RH, Huo Y, Rongione M, et al. A measure of glucocorticoid load provided by DNA methylation of Fkbp5 in mice. Psychopharmacology (Berl) 2011;218:303–312. doi: 10.1007/s00213-011-2307-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Recknagel P, Gonnert FA, Halilbasic E, Gajda M, Jbeily N, Lupp A, et al. Mechanisms and functional consequences of liver failure substantially differ between endotoxaemia and faecal peritonitis in rats. Liver Int. 2013;33:283–293. doi: 10.1111/liv.12012. [DOI] [PubMed] [Google Scholar]
  34. Oketani M, Ido A, Nakayama N, Takikawa Y, Naiki T, Yamagishi Y, et al. Etiology and prognosis of fulminant hepatitis and late-onset hepatic failure in Japan: Summary of the annual nationwide survey between 2004 and 2009. Hepatol Res. 2013;43:97–105. doi: 10.1111/j.1872-034X.2012.01105.x. [DOI] [PubMed] [Google Scholar]
  35. Jaeschke H, McGill MR, Ramachandran A. Oxidant stress, mitochondria, and cell death mechanisms in drug-induced liver injury: lessons learned from acetaminophen hepatotoxicity. Drug Metab Rev. 2012;44:88–106. doi: 10.3109/03602532.2011.602688. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Nolan JP. The role of intestinal endotoxin in liver injury: a long and evolving history. Hepatology. 2010;52:1829–1835. doi: 10.1002/hep.23917. [DOI] [PubMed] [Google Scholar]
  37. Chastre A, Bélanger M, Beauchesne E, Nguyen BN, Desjardins P, Butterworth RF. Inflammatory cascades driven by tumor necrosis factor-alpha play a major role in the progression of acute liver failure and its neurological complications. PLoS ONE. 2012;7:e49670. doi: 10.1371/journal.pone.0049670. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Ramakers BP, de Goeij M, van der Hoeven JG, Peters WH, Pickkers P. Inflammation-induced hepatotoxicity in humans. Shock. 2009;31:151–156. doi: 10.1097/SHK.0b013e31818335ff. [DOI] [PubMed] [Google Scholar]
  39. Zhao ZX, Cai QX, Peng XM, Chong YT, Gao ZL. Expression of SOCS1 in the liver tissues of chronic hepatitis B and its clinical significance. World J Gastroenterol. 2008;14:607–611. doi: 10.3748/wjg.14.607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Oh J, Hur MW, Lee CE. SOCS1 protects protein tyrosine phosphatases by thioredoxin upregulation and attenuates Jaks to suppress ROS-mediated apoptosis. Oncogene. 2009;28:3145–3156. doi: 10.1038/onc.2009.169. [DOI] [PubMed] [Google Scholar]
  41. Wong VW, Wong GL, Chu WC, Chim AM, Ong A, Yeung DK, et al. Hepatitis B virus infection and fatty liver in the general population. J Hepatol. 2012;56:533–540. doi: 10.1016/j.jhep.2011.09.013. [DOI] [PubMed] [Google Scholar]
  42. Tamiya T, Kashiwagi I, Takahashi R, Yasukawa H, Yoshimura A. Suppressors of cytokine signaling (SOCS) proteins and JAK/STAT pathways: regulation of T-cell inflammation by SOCS1 and SOCS3. Arterioscler Thromb Vasc Biol. 2011;31:980–985. doi: 10.1161/ATVBAHA.110.207464. [DOI] [PubMed] [Google Scholar]
  43. Takahashi R, Nishimoto S, Muto G, Sekiya T, Tamiya T, Kimura A, et al. SOCS1 is essential for regulatory T cell functions by preventing loss of Foxp3 expression as well as IFN-{gamma} and IL-17A production. J Exp Med. 2011;208:2055–2067. doi: 10.1084/jem.20110428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Doti N, Scognamiglio PL, Madonna S, Scarponi C, Ruvo M, Perretta G, et al. New mimetic peptides of the kinase-inhibitory region (KIR) of SOCS1 through focused peptide libraries. Biochem J. 2012;443:231–240. doi: 10.1042/BJ20111647. [DOI] [PubMed] [Google Scholar]
  45. Satou R, Miyata K, Gonzalez-Villalobos RA, Ingelfinger JR, Navar LG, Kobori H, et al. Interferon-γ biphasically regulates angiotensinogen expression via a JAK–STAT pathway and suppressor of cytokine signaling 1 (SOCS1) in renal proximal tubular cells. FASEB J. 2012;26:1821–1830. doi: 10.1096/fj.11-195198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Pello OM, Moreno-Ortiz Mdel C, Rodríguez-Frade JM, Martínez-Muñoz L, Lucas D, Gómez L, et al. SOCS up-regulation mobilizes autologous stem cells through CXCR4 blockade. Blood. 2006;108:3928–3937. doi: 10.1182/blood-2006-02-006353. [DOI] [PubMed] [Google Scholar]
  47. Ramírez-Martínez G, Cruz-Lagunas A, Jiménez-Alvarez L, Espinosa E, B Ortíz-Quintero B, Santos-Mendoza T, et al. Seasonal and pandemic influenza H1N1 viruses induce differential expression of SOCS-1 and RIG-I genes and cytokine/chemokine production in macrophages. Cytokine. 2013;62:151–159. doi: 10.1016/j.cyto.2013.01.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Koeberlein B, zur Hausen A, Bektas N, Zentgraf H, Chin R, Nguyen LT, et al. Hepatitis B virus overexpresses suppressor of cytokine signaling-3 (SOCS3) thereby contributing to severity of inflammation in the liver. Virus Res. 2010;148:51–59. doi: 10.1016/j.virusres.2009.12.003. [DOI] [PubMed] [Google Scholar]
  49. Hussain S, Singh N, Salam I, Bandil K, Yuvaraj M, Akbar Bhat M, et al. Methylation-mediated gene silencing of suppressor of cytokine signaling-1 (SOCS-1) gene in esophageal squamous cell carcinoma patients of Kashmir valley. J Recept Signal Transduct Res. 201;31:147–156. doi: 10.3109/10799893.2011.553836. [DOI] [PubMed] [Google Scholar]
  50. Um TH, Kim H, Oh BK, Kim MS, Kim KS, Jung G, et al. Aberrant CpG island hypermethylation in dysplastic nodules and early HCC of hepatitis B virus-related human multistep hepatocarcinogenesis. J Hepatol. 2011;54:939–947. doi: 10.1016/j.jhep.2010.08.021. [DOI] [PubMed] [Google Scholar]

Articles from Cellular and Molecular Immunology are provided here courtesy of Nature Publishing Group

RESOURCES