The TREM2 variant p.R47H is a risk factor for sporadic amyotrophic lateral sclerosis

Abstract

Importance

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease in which microglia play a significant and active role. Recently, a rare missense variant (p.R47H) in the microglial activating gene TREM2 was found to increase the risk of several neurodegenerative diseases, including Alzheimer’s disease. Whether the p.R47H variant is a risk factor for ALS is not currently known.

Objective

To determine if p.R47H (rs75932628) in TREM2 is a risk factor for ALS and assess whether TREM2 expression is dysregulated in disease.

Design, setting, and participants

923 sporadic ALS subjects and 1854 normal controls self-reported as non-Hispanic white were collected from ALS clinics in the United States and genotyped for the p.R47H variant in TREM2. Clinical data was obtained on ALS subjects for genotype/phenotype correlations. Expression of TREM2 was measured by quantitative PCR and compared in spinal cord from 18 ALS subjects, 12 neurologically normal controls, as well as from wildtype and transgenic SOD1^G93A mice.

Main outcome measures

Minor allele frequency of rs75932628 and relative expression of TREM2.

Results

The TREM2 variant p. R47H was more common in subject with ALS than in controls and is therefore a significant risk factor for ALS (OR=2.40; 95%CI=1.29-4.15; p=4.1×10^-3). Furthermore, TREM2 expression was increased in spinal cords from ALS patients and SOD1^G93A mice (p=2.8×10^-4, p=2.8×10^-9 respectively), confirming dysregulated TREM2 in disease. TREM2 expression in human spinal cord was negatively correlated with survival (p=0.04), but not other phenotypic aspects of disease.

Conclusion and relevance

This study demonstrates that the TREM2 p.R47H variant is a potent risk factor for sporadic amyotrophic lateral sclerosis. These findings identify the first genetic influence on neuro-inflammation in ALS and highlight the TREM2 signaling pathway as a therapeutic target in ALS and other neurodegenerative diseases.

INTRODUCTION

Amyotrophic lateral sclerosis (ALS) is a fatal disease caused by the progressive degeneration of upper and lower motor neurons. Activated microglia in the vicinity of degenerating neurons are a long-recognized pathological feature of ALS¹, but whether such activation is a beneficial response or injurious contributor to the disease process remains unclear. In fact the answer may be both- mouse model data show that microglia express both neuroprotective and neurotoxic factors simultaneously² and may transition from a neuroprotective phenotype at symptom onset to become more neurotoxic later in the disease course³.

There are many signaling pathways governing microglial phenotype, including a complex formed by TREM2 (MIM 605086) and TYROBP (also known as DAP12, MIM 604142)⁴. Activation of TREM2/TYROBP results in a potentially neuroprotective microglial state, with improved phagocytosis of apoptotic cellular debris and down-regulation of inflammatory cytokines⁵. The importance of signaling through TREM2/TYROBP is made clear by the fact that recessive mutations in either gene cause early onset frontotemporal-like dementia, either in isolation⁶ or as part of the recessive human disease polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (PLOSL or Nasu-Hakola Disease, MIM 221770)^7,8. Furthermore, recent studies have demonstrated that a rare non-synonymous variant in TREM2, rs75932628 (encoding p.R47H) is strong risk-factor for Alzheimer’s disease (AD), another neurodegenerative disease characterized by microglial activation^9-13. Other studies have implicated the same variant in frontotemporal dementia and Parkinson’s disease^14,15. It has been hypothesized that this variant impairs TREM2/TRYOBP signaling, thereby blunting neuroprotective microglial activation and exacerbating the disease process^9,11.

In this study we demonstrate that p.R47H is a risk factor for sporadic ALS, and demonstrate upregulation of TREM2 in human ALS spinal cord and in spinal cord from the G93A mouse model of SOD1 ALS¹⁶.

METHODS

Study Subjects and TREM2 p.R47H genotyping

923 sporadic ALS (SALS) subjects and 1854 normal controls, all of self-reported non-Hispanic white background, were included and provided written informed consent at their contributing institution. Diagnoses of probable or definite ALS were made by neuromuscular specialists according to El Escorial criteria (Washington University in St. Louis, n= 273; Virginia Mason Medical Center, n=143; Methodist Neurological Institute, n= 47; Coriell plates NDPT025, NDPT026, NDPT100, NDPT103, NDPT106, n=460). Control subjects were without ALS, Parkinson’s disease, or dementia and were collected from ongoing studies (Washington University, n=1390) or Coriell panels (NDPT020, NDPT079, NDPT082, NDPT095, NDPT096, n=464). 55% of SALS cases were male and age at DNA collection was 61.0±11.6 years old (mean ± stdev), while the control cohort was 44% male and 68±13.6 years old (mean ± stdev). An additional control group of 25,023 individuals of European or European American descent was collated from published studies (Table 1) and from the unrelated European Americans (EA) genotyped by whole-exome sequencing as part of the NHLBI’s Exome Sequencing Project (ESP)¹⁷. Icelandic controls were not included given the isolation of the population and significantly higher MAF at rs75932628⁹.

Table 1.

TREM2 p.R47H carriers in published cohorts and this study

Cohort		No. Subjects	p.R47H carriers	MAF (%)
Controls	ESP-EA17	4,300	22	0.26
	Spain12	550	0	0.00
	Georgia, USA9	402	1	0.12
	Germany9	1,891	7	0.19
	Netherlands9	4,950	15	0.15
	Norway9	2,484	8	0.16
	N. America/UK11	5,166	20	0.19
	Utah, USA13	2,540	12	0.24
	France10	783	4	0.26
	N. America/Ireland/Poland14	1,957	8	0.20
	This Study (N. America)	1,848	3	0.08
	Total Controls	26,871	100	0.19
ALS	This Study (N. America)	920	10	0.54
	N. America14	765	5	0.33
	Total ALS Subjects	1685	15	0.45

Abbreviations: MAF= minor allele frequency; ESP-EA= Exome Sequencing Project European American; N. America=North American

DNA was extracted from blood or saliva using standard methods and genotyped for rs75932628 (TREM2 p.R47H) using a custom KASPar (KBioscience) assay¹². Genotype call rate was 99.7% in both cases and controls. p.R47H carriers were validated by sequencing.

TREM2 Expression Analysis

Expression in human lumbar spinal cord

Total RNA was extracted from snap-frozen transverse sections of lumbar spinal cord of 18 autopsied subjects with ALS (Table 2) and 12 controls without neurological disease using the miRNeasy kit (Qiagen). Extracted RNA was quantified and 40ng was used as input for the Express One-Step Superscript qRT-PCR Universal (Invitrogen: 11781-200) with validated Taqman assays for human TREM2 and three endogenous controls, GAPDH, PPIA, and RPLPO (Applied Biosystems 4331182, 4333764F, 4333763F, 4333761F respectively). Reactions were run in duplicate on an ABI 7500 fast thermocycler. TREM2 expression was normalized to the geometric mean of the three endogenous controls. 10 subjects had provided separate informed consent for genetic analysis, but none were found to carry the p.R47H variant.

Table 2.

ALS autopsy subjects studied for TREM2 expression in lumbar spinal cord

Demographic Category	Metric		Correlation	P-value
Age at onset (years, n=17)	Mean ± stdev (range)	61±13 (29-75)	r=-0.03	0.9c
Survivala (months, n=18)	Mean ± stdev (range)	31.3±28.0 (4-108)	r=-0.49	0.04c
Postmortem interval (hours, n=11)	Mean ± stdev (range)	12.4±7.5 (2-28)	r=-0.45	0.17c
Site of onset (n=16)	% Bulbar (n)	31 (5)		0.21d
Genetic causeb (n=18)	% With known gene (n)	33 (6)		0.21d

^aSurvival defined as symptom onset to death or full-time ventilation.

^b3 subjects had SOD1 mutations (A4V, G85R, I133T) and 3 had C9ORF72 repeat expansions.

^cSpearman correlation, unadjusted for multiple comparisons.

^dMann-Whitney U rank test, unadjusted for multiple comparisons.

Expression in mouse spinal cord

Total RNA was extracted from saline-perfused and snap-frozen spinal cords of 8 end-stage SOD1^G93A transgenic mice (Jackson Lab B6.Cg-Tg(SOD1*G93A)1Gur/J) and 6 negative littermate controls. TREM2 expression was quantified using a mouse-specific TREM2 Taqman assay (Applied Biosystems 4331182) and normalized to the endogenous control SMRT using primers and probe from IDT DNA (Probe: AGACGTCTCACACAAGGAAGGACTCGCC, Forward primer: GGGTATATTTTTGATACCTTCAATGAGTTA, Reverse primer TCTGAAACAGTAGGTAGAGACCAAAGC). Reactions were run in duplicate on an ABI 7500 fast thermocycler.

Statistics

All statistics were computed using R version 3.0.1 except as noted. Fisher’s exact test was used to compare proportions of p.R47H carriers in cases and controls. Comparisons of TREM2 expression utilized student t-tests, while correlations between TREM2 expression and subject characteristics utilized Spearman correlations (continuous variables) or Mann-Whitney U (dichotomous variables). Logistic regression was performed in PLINK with age and gender as covariates using cases and controls for whom this data was available (913/920 of ALS subjects and 1803/1848 of controls). All tests were two-tailed, with the significance level set at p=0.01 to correct for multiple comparisons.

RESULTS

TREM2 p.R47H in sporadic ALS

1.09% (10/920) of sporadic ALS subjects and 0.162% (3/1848) of normal controls were heterozygous carriers of the p.R47H variant, showing a significant enrichment in ALS (OR=6.77; 95% CI 1.86-24.65; p=0.0016). No cases or controls were homozygous for this allele. Because the proportion of p.R47H carriers in the population declines with age⁷ and our cases were younger than controls, we also analyzed our data by logistic regression with age and gender as covariates. This produced a similar risk estimate (OR=7.38; 95%CI = 1.95-27.9, p= 0.0032). To provide a more conservative estimate of effect size, we also compared our sporadic ALS cohort to an aggregate control population of European ancestry gleaned from published studies and databases (n=25,023, Table 1). We again observed an enrichment in sporadic ALS, albeit with a lower effect size (OR=2.81; CI 1.31-5.41; p=4.8×10^-3). A prior study of a smaller cohort of North American ALS patients found a non-significant but increased frequency in cases versus controls (0.7% vs. 0.45%)¹⁴. A combined analysis of this study with ours compared to all available controls also showed a significant association (OR=2.40; 95%CI=1.29-4.15; p=4.1×10^-3), confirming that TREM2 p.R47H is a risk factor for ALS. TREM2 p.R47H carriers in our cohort showed no difference in age of symptom onset, site of first symptom, or in survival compared to those without. However, the rarity of the variant limited our power to detect such a difference. A larger cohort of p.R47H carriers with ALS will be required to definitively determine effects on disease parameters.

TREM2 expression in spinal cords from humans with ALS and SOD1^G93A mice

We examined spinal cord expression of TREM2 in lumbar spinal cord sections from 18 subjects with ALS and found a 2.8-fold upregulation compared to controls (p=2.8×10^-4; Figure panel A). Expression levels did not correlate with age of onset, site of symptom onset, or presence of a known disease-causing mutation (Table 2). However, the degree of upregulation showed a modest inverse correlation with disease survival that was not statistically significant after correction for multiple comparisons. Because markers of microglial activation are also upregulated in models of SOD1 ALS¹⁸, we evaluated TREM2 expression in SOD1^G93A transgenic mice and found a 13-fold increase compared to non-transgenic littermates (p=2.8×10^-9; Figure panel B).

Figure 1. TREM2 expression is increased in human ALS and SOD1^G93R mouse spinal cord.

TREM2 expression was measured by qPCR in A) lumbar spinal cord sections from 18 ALS subjects and 12 controls and normalized to the geometric mean of three endogenous control genes.

B) In mice, expression was measured in spinal cords from 8 SOD^G93R mice and 6 wild-type littermates with normalization to an endogenous control. p-values were calculated using two-tailed student’s t-test.

DISCUSSION

Our study demonstrates that a rare variant in TREM2 (p.R47H), more than doubles the risk of ALS. In addition to identifying a novel risk factor for ALS, this finding provides the first link between genetic variation and microglial activation in ALS pathogenesis. This is important in light of a recent study demonstrating that higher degrees of microglial activation on pathological examination were correlated with both the degree of upper motor neuron symptoms and a more rapid disease progression¹⁹. Interestingly, our evaluation of TREM2 expression in ALS spinal cord showed a similar trend, with higher levels of TREM2 correlating with shorter survival. Furthermore, our finding that TREM2 expression is also increased in spinal cords from SOD1^G93A mice is congruent with recent studies of isolated microglia from this same model² and suggests that studies of microglial activation in this model may provide insights relevant to human ALS.

p.R47H was first shown to increase risk for Alzheimer’s disease with subsequent associations with frontotemporal dementia and Parkinson’s disease^9-14. How the p.R47H variant affects TREM2 function and predisposes to neurodegeneration is currently unknown. Because TREM2 signaling mediates potentially neuroprotective microglial activities (including phagocytosis of apoptotic cells and secretion of anti-inflammatory cytokines), one model hypothesizes that p.R47H is a loss-of-function allele. Inadequate clean-up of cellular debris and counter-productive inflammation would predispose to symptomatic disease. The p.R47H variant is located in the extracellular domain of TREM2 where it could interfere with binding to unidentified ligand(s) or disrupt signaling through its receptor complex partner TYROBP. As dysregulated TREM2 signaling confers risk for several neurodegenerative disorders, insights gleaned from the study of TREM2 in ALS are likely to be applicable to other diseases and vice versa. This includes the important possibility that manipulation of TREM2 signaling or microglial activation would be a worthwhile therapeutic strategy.