Novel type of adenylyl cyclase participates in tabtoxinine-β-lactam-induced cell death and occurrence of wildfire disease in Nicotiana benthamiana

Abstract

Tabtoxinine-β-lactam (TβL), a non-specific bacterial toxin, is produced by Pseudomonas syringae pv. tabaci, the causal agent of tobacco wildfire disease. TβL causes the plant cell death by the inhibiting glutamine synthetase, which leads to an abnormal accumulation of ammonium ions. To better understand the molecular mechanisms involved in TβL-induced cell death and necrotic wildfire lesions, we focused on adenylyl cyclase in Nicotiana benthamiana. We isolated the gene designated as NbAC (Nicotiana benthamiana adenylyl cyclase). Recombinant NbAC protein showed adenylyl cyclase activity in vitro. TβL-induced necrotic lesions were significantly suppressed in NbAC-silenced leaves compared with control plant leaves. However, the amount of ammonium ions was scarcely affected by NbAC-silencing. Furthermore, the silencing of NbAC also suppressed l-methionine sulfoximine-induced cell death without any changes in the amount of ammonium accumulated. When inoculated directly with P. syringae pv tabaci, NbAC-silenced plants showed reduced symptoms. These results suggest that NbAC might play an essential role in intracellular signal transduction during TβL-induced cell death and necrotic wildfire disease development.

Introduction

Programmed cell death (PCD) has important roles in incompatible plant-microbe interaction, and the PCD is designated as hypersensitive response (HR).¹ HR is a immune response characterized by rapid, localized cell death triggered by an incompatible pathogen.² Recent studies suggest that PCD occurring in susceptible plant-pathogen interactions.³ A compatible race of Puccinia coronata f.sp. avenae and Magnaporthe grisea are reportedly to induce apoptotic PCD in oat cells.⁴ The host-specific fungal AAL toxins are reported to induce ethylene signaling-dependent PCD in susceptible tomato plants.⁵ Our previous report also showed apoptotic cell death is closely associated with lettuce developing of bacterial rot and eggplants developing of necrotic leaf spot caused by Pseudomonas cichorii.^6,7 Inoculation with a host-nonspecific toxin-producing strain of Pseudomonas syringae is also reportedly to induced apoptotic PCD, suggesting induction of PCD by host-non specific bacterial toixins.⁴ However, the molecular mechanisms of PCD induction by host-non-specific bacterial toxin are not fully understood.

P. syringae pv. tabaci is the causal agent of wildfire disease in tobacco plants, and development of wildfire lesions was associated with PCD.⁸ This disease symptom is promoted by tabtoxinine-β-lactam (TβL), a host non-specific bacterial toxin produced by the bacterium. Our previous report showed that host Hsp70 is required for TβL-induced cell death and to induce wildfire lesions, and also suggests the involvement of plant intracellular signaling.⁹ However, the signaling cascade(s) related to TβL-induced PCD has not been clarified. TβL causes the plant cell death through the inhibition of glutamine synthetase, leading to an abnormal accumulation of ammonium ions. Accumulated ammonium induces cell death due to its toxicity, resulting in wildfire lesions.¹⁰ Ammonia is a toxic agent to plant cells, and induces PCD. For example, ammonia produced by Colletotrichum coccodes induces PCD during the necrotic lesion development.¹¹ However, the molecular mechanisms of ammonia-induced a PCD are less characterized in plants. In mammalian microglial cells, ammonia-induced PCD is reportedly to be mediated by the cyclic AMP (cAMP)-mediated signaling cascade.¹² In this study, therefore, we focused on cAMP-producing enzyme, adenylyl cyclase (AC). Our present results suggest that NbAC might play an essential role in the TβL-mediated cell death induction pathway downstream of glutamine synthetase-inhibition (ammonium ion accumulation) by TβL.

Results

In this study, we focused on cAMP-producing enzyme, AC from N. benthamiana. A database search of AC turned up a putative AC (ACR77530) whose function has not been analyzed. We then, isolated the full-length cDNA based on the nucleotide sequence of the putative AC. The deduced amino acid sequence of the isolated cDNA contained an open reading frame encoding a polypeptide of 406 amino acids. The nucleotide sequence of isolated cDNA showed 100% nucleotide identity to a previously reported putative AC (ACR77530). A protein database search showed 96% amino acid identity with AC from N. tabacum, 53%, 57%, and 54% amino acid identity with putative proteins from Zea mays, Arabidopsis thaliana, Oryza sativa, respectively (Fig. 1A). In addition, the recombinant protein produced based on an open reading frame of the cDNA showed AC activity in vitro (Fig. 1B). We then, designated the cDNA as NbAC (N. benthamiana adenylyl cyclase). Phylogenic analysis identified at least 5 groups of AC, and NbAC and AC from N. tabacum were classified into independent cluster from AC from Zea mays (NP_001149561) and A. thaliana (BAB02340). The later AC were previously reported to have AC activity (Fig. 1C).^13,14

Figure 1. Deduced amino acid sequence, phylogenic analysis and functional analysis of NbAC. (A) Alignment of deduced amino acid sequence of NbAC (ACR77530) and its ortholog in N. tabacum (NtAC: AAB87670), adenylyl cyclase-like proteins from A. thaliana (BAB02340), Z. mayz (NP_001149561) and O. sativa (BAC83401). Asterisks mean that the residues in that column are identical in all sequences in the alignment. Colone means that conserved substitutions have been observed. Dot means that semi-conserved substitutions are observed. (B) Adenylyl cylase activity of recombinant NbAC and dehydrofolate reductase (DHFR; negative control) was determined as described in Materials and Methods. Values are means and SD from triplicate experiments. Asterisks denote values significantly different from those of control (*; P < 0.05). (C) Phylogenic tree of adenylyl cyclase in plants. Phylogeny analysis was performed by ClustalW (http://clustalw.ddbj.nig.ac.jp/). Gray boxes show NbAC and adenylyl cyclase like gene in N. tabacum. The scale bar represents 0.1 JTT distance matrix units. Accession numbers are ACR77530 for NbAC, AAB87670 for NtAC, BAB02340 for AtAC, NP_001149561 for ZmAC, BAC83401 for OsPAC, XP_004243706 for Solanum lycopersicum uncharacterized protein, CAC59976 for Z. mayz pollen signaling protein with adenylyl cyclase activity (ZmPSiP), At1g62590 for A. thaliana pentatricopeptide repeat-containing protein (AtPPR), Q9FRH3 for A. thaliana putative clathrin assembly protein, AEE74054 for A. thaliana TIR-NBS-LRR class disease resistance protein, XP_002276104 for Vitis vinifera uncharacterized protein, XP_003529590 for Glycine max uncharacterized protein, XP_002312757 for Populus trichocarpa predicted protein, EEC80558 for O. sativa hypothetical protein and XP_004153708 for Cucumis sativus adenylate cyclase-like protein.

To analyze the involvement of NbAC on TβL-induced necrotic wildfire lesions, we created NbAC-silenced N. benthamiana. Results of qRT-PCR analysis suggested that NbAC was well-silenced (Fig. 2A). Drastic morphological change was not observed in NbAC-silenced plants (Fig. 2B). Typical necrotic lesions were observed in control plants 1 d after infiltration of TβL. In contrast, significant suppression of necrotic wildfire lesion was observed in NbAC-silenced plants (Fig. 3A upper). These results suggest that NbAC might play a role in TβL-induced necrotic wildfire lesions. Cell death induced by TβL infiltration was observed 24h after infiltration in control plants, whereas significant suppression of TβL-induced cell death was observed in NbAC-silenced plants (Fig. 3B upper). To further understand the role of NbAC in TβL-induced cell death and lesion formation, we analyzed changes in ammonium ion concentration. Accumulation of ammonium ions was observed in both control and NbAC-silenced plants (Fig. 3C upper). Next, we analyzed the effect of NbAC silencing on cell death induction by MSX, specific inhibitor of glutamine synthetase that mimic the TβL.^15,16 Cell death was detected at 48 h after infiltration in control plants, whereas MSX-induced cell death and necrotic lesions were compromised in NbAC-silenced plants (Fig. 3A,B lower). Accumulation of ammonium ions was observed in both control and NbAC-silenced plants (Fig. 3C lower). Although induction of hin1 gene, the marker gene for HR induction,^24,25 was observed in control plants treated with TβL and MSX, the hin1 expression were compromised in NbAC-silenced plants (Fig. 3D).

Figure 2.Phenotypic observation of NbAC1-silenced plants. (A) Total RNA was isolated from control (control) and NbAC-silenced (VIGS) plants. Expression values of NbAC were estimated by qRT-PCR, and expressed as [Qty] after normalization with actin. Values represent the means and SD from triplicate experiments. Asterisks denote values significantly different from empty PVX controls (*; P < 0.05). (B) Photograph was taken three weeks after inoculation with Agrobacterium tumefaciens.

Figure 3.Effect of NbAC silencing on TβL- and MSX-induced cell death, ammonium ion accumulation and hin1 gene expression. Control (PVX) and NbAC-silenced (PVX:AC) leaves were infiltrated with TβL (1.5 mM: upper panel) or MSX (150 μM: lower panel). (A) Photographs were taken 24 and 48 h after infiltration of TβL and MSX. (B) Cell death estimation was performed by detection of ion leakages as described in Materials and Methods. Asterisks denote values significantly different from empty PVX controls (*; P < 0.05, n = 4). (C) Ammonium ion content was determined as described in Materials and Methods. Asterisks denote values significantly different from empty PVX controls (*; P < 0.05, n = 4). (D) Total RNA was isolated from control and NbAC-silenced leaves infiltrated with TβL or MSX. Expression values of hin1 are expressed as [Qty] after normalization with actin. Relative expression of hin1 transcripts (relative to the absolute non-treated control, and normalized with actin) in control or NbAC-silenced plants. Values represent the means and SD from triplicate experiments. Asterisks denote values significantly different from empty PVX controls (*; P < 0.05).

Our present results showed that TβL-induced cell death and necrotic wildfire lesions were suppressed in NbAC-silenced plants. These results led us to test the effect of NbAC-silencing on the development of wildfire disease by inoculation with P. syringae pv tabaci. Inoculation with P. syringae pv. tabaci induced wildfire lesions and the leaves completely died within 10 d in control plants. In contrast, development of wildfire lesions was significantly suppressed in NbAC-silenced leaves, which were still alive 10 d after inoculation (Fig. 4).

Figure 4.Effect of NbAC silencing on wildfire disease development by inoculation with P. syringae pv tabaci. Control (PVX) and NbAC-silenced (PVX:AC) leaves were infiltrated with P. syringae pv tabaci. Lesion extension of wildfire was measured daily in control and NbAC-silenced plants. Asterisks denote values significantly different from empty PVX controls (*; P < 0.05, n = 8).

Discussion

In animal cells, the roles of AC and cAMP have been well established, whereas the occurrence and roles of AC and cAMP have been more contentious in plants.¹⁷ Nevertheless, recent study shows the presence of cAMP and AC activity in several plant species. AC activity was reported in alfalfa and tobacco.^18,19 Plant AC has been isolated and enzymatic properties were also analyzed in Zea mays and A. thaliana, indicating AC is in plants.^13,14 In this study, we isolated AC (NbAC) from N. benthamiana (Fig. 1A,B). Phylogenic analysis showed NbAC and AC from N. tabacum were classified into independent cluster to previously identified and well-characterized AC from A. thaliana and Z. mays (Fig. 1C). Therefore, we determined NbAC to be a novel type of adenylyl cyclase from N. benthamiana.

AC and cAMP have been implicated in the regulation of important plant processes such as cell development, morphological changes, intracellular signaling and stress response.¹⁷ For example, plant AC is closely associated with signaling cascade for pollen tube growth,¹⁴ and cAMP have been shown to regulate Ca²⁺ signaling in N. plumbaginofolia protoplasts.²⁰ In addition, it has been reported that self-incompatibility is associated with the level of cAMP in pistils after pollination, and the level of cAMP depends on AC activity.²¹ AC and cAMP are also related to plant immune responses, and cAMP is transiently elevated in elicited bean cells.²² Pretreatment with dibutyryl cAMP enhanced the production of reactive oxygen species in bean cells by treatment with an elicitor from Colletotrichum lindemuthianum. It was also reported that pharmacological inhibition of the AC blocked RPM1-resistance gene-dependent HR in A. thaliana.²³ Our present data showed that NbAC-silencing reduced cell death and necrotic lesions caused by TβL and MSX (Fig. 3A,B). Accumulation of ammonium ions by TβL and MSX was observed in both control and NbAC-silenced plants (Fig. 3C). Therefore, the glutamine synthetase-inhibiting action of TβL (MSX) is not affected by NbAC-silencing, suggesting that NbAC may regulate signaling cascade downstream of glutamine synthetase-inhibition by TβL (ammonium accumulation). Moreover, NbAC-silencing compromised hin1 gene expression (Fig. 3D,H). Therefore, NbAC may act as signaling component required for PCD cascade at least partially shared by both HR and disease associated PCD.

In summary, our experimental results show that NbAC appears to positively regulate the process of disease-related (TβL-induced) plant PCD in N. benthamiana. Therefore, our identifying a role for NbAC in disease-associated PCD will facilitate future studies aimed at determining molecular events during disease development. In addition, analyzing host signaling cascade associated with NbAC-mediated cell death by TβL may provide new insights into controlling the disease development processes and creating wildfire disease-resistant plants.

Materials and Methods

Plant materials, bacterial isolates, tabtoxinine-β-lactam and chemicals

N. benthamiana was grown in a growth room.²⁶P. syringae pv tabaci 6605 was cultured in PY medium containing 20 µg/mL rifampicin.²⁷ Purification of TβL was performed according to the method described by Tomas et al.²⁸ Bacterial suspension, l-methionine sulfoximine (MSX; Funakoshi) and TβL were infiltrated into N. benthamiana leaves as described previously.⁹

Isolation of RNA and cDNA synthesis

Total RNA was isolated from N. benthamiana leaves with RNAiso (Takara), and RNA samples were treated with DNase I (RNase-free; Takara) to degrade contaminating genomic DNA as described previously.²⁶ CDNA (cDNA) was synthesized by PrimeScript RT reagent Kit (Takara).

Sequencing

Sequencing analysis was performed using M4 (GTTTTCCCAGTCACGAC) and RV (CAGGAAACAGATATGAC) primers with the reagents for the Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems) and Applied Biosystems 3100 Avant Automated Sequencer (Applied Biosystems) according to the manufacturer’s instructions. The sequence analysis was performed using DNASIS (version 3.6; Hitachi) and the BLAST network service from the National Center for Biotechnology Information.²⁹

Isolation of Full-Length cDNA

PCR primers were designed based on previously reported putative adenylyl cyclase (Accession number ACR77530). PCR amplification was performed with the primers NbAC-S (ATGCAAAGGGTTTTGAAGGCTCGCC) and NbAC-A (TCAAGATAAGACACCTTCTTTTCTTGTCAA). Cycling parameters were as follows: 30 cycles of 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min. The full-length cDNA was cloned into pMD20 (Takara), creating pMD20-NbAC.

Plasmid construction and cell-free protein synthesis

The open reading frame of NbAC fused with a glutatione S transferase-tag was used for in vitro protein synthesis.³⁰ The recombinant NbAC was synthesized by a robotic protein synthesizer, Protemist^® DT (CellFree Sciences) according to the manufacturer’s instructions.

Adenylyl cyclase activity assay of NbAC in vitro

AC activity was performed using the cAMP EIA system (GE Healthcare), as described previously.¹³

Vector constructs and seedling infection for virus-induced gene silencing

A 611bp cDNA fragment of NbAC was amplified with primers NbAC-SalI (GTCGACGTTTTGAAGGCTCGCCAGCT) and NbAC-Sse8387I (CCTGCAGGGTGAGCAGATCCAATATTAG), using pMD20-NbAC as template. This cDNA fragment was subcloned into pMD20 (pMD20-NbAC-PVX). The pMD20-NbAC-PVX was digested with SalI and Sse8387I (Takara) and ligated into pPVX201.³¹ The construct containing this insert in the antisense orientation was designated as pPVX:AC. The plasmid was transformed into Agrobacterium tumefaciens strain GV3101 and inoculated into N. benthamiana leaves as described previously.²⁶

Quantitative Real Time PCR

Quantitative real-time PCR (qRT-PCR) was performed using the SYBR GreenER qPCR Reagent System (Invitrogen), with an Applied Biosystems 7300 real-time PCR system as described by Maimbo et al.²⁶ Primers used in this experiment were follow; NbACrtpF (AGACTGGCCTTTGGAGGTGAT) and NbACrtpR (TGCAGCCAACTCCTTTCTCTTC) for NbAC, ActrtpF (GCCGATGAGGACACCAGAA) and ActrtpR (GACAGAACAGTCCCATTAGATTCCA) for actin, hin1rtpF (CGGTCCACCCGAAGTCAA) and hin1rtpR (ACGCCCTCGATGAAGTAGTCA) for hin1 gene.

Quantification of cell death and ammonium ion content

Cell death quantification by measuring ion leakage, and amount of ammonium was determined as described by Ito et al.⁹

Glossary

Abbreviations:

AC

adenylyl cyclase

HR

hypersensitive response

MSX

L-methionine sulfoximine

PCR

polymerase chain reaction

PCD

programmed cell death

RT-PCR

reverse transcription-polymerase chain reaction

qRT-PCR

quantitative real time polymerase chain reaction

TβL

tabtoxinine-β-lactam

VIGS

virus-induced gene silencing