Skip to main content
Oncology Reports logoLink to Oncology Reports
. 2014 Jun 13;32(2):505–512. doi: 10.3892/or.2014.3262

Differential promoter methylation of kinesin family member 1a in plasma is associated with breast cancer and DNA repair capacity

RAFAEL GUERRERO-PRESTON 1,2,✉, TAL HADAR 1, KIMBERLY LASKIE OSTROW 1, ETHAN SOUDRY 1, MIGUEL ECHENIQUE 3, CARMEN ILI-GANGAS 1,4, GABRIELA PÉREZ 1, JIMENA PEREZ 1, PRISCILLA BREBI-MIEVILLE 1,4, JOSÉ DESCHAMPS 1, LUISA MORALES 5, MANUEL BAYONA 6, DAVID SIDRANSKY 1, JAIME MATTA 5,✉
PMCID: PMC4091885  PMID: 24927296

Abstract

Methylation alterations of CpG islands, CpG island shores and first exons are key events in the formation and progression of human cancer, and an increasing number of differentially methylated regions and genes have been identified in breast cancer. Recent studies of the breast cancer methylome using deep sequencing and microarray platforms are providing a novel insight on the different roles aberrant methylation plays in molecular subtypes of breast cancer. Accumulating evidence from a subset of studies suggests that promoter methylation of tumor-suppressor genes associated with breast cancer can be quantified in circulating DNA. However, there is a paucity of studies that examine the combined presence of genetic and epigenetic alterations associated with breast cancer using blood-based assays. Dysregulation of DNA repair capacity (DRC) is a genetic risk factor for breast cancer that has been measured in lymphocytes. We isolated plasma DNA from 340 participants in a breast cancer case control project to study promoter methylation levels of five genes previously shown to be associated with breast cancer in frozen tissue and in cell line DNA: MAL, KIF1A, FKBP4, VGF and OGDHL. Methylation of at least one gene was found in 49% of the cases compared to 20% of the controls. Three of the four genes had receiver characteristic operator curve values of ≥0.50: MAL (0.64), KIF1A (0.51) and OGDHL (0.53). KIF1A promoter methylation was associated with breast cancer and inversely associated with DRC. This is the first evidence of a significant association between genetic and epigenetic alterations in breast cancer using blood-based tests. The potential diagnostic utility of these biomarkers and their relevance for breast cancer risk prediction should be examined in larger cohorts.

Keywords: epigenetics, epigenetic biomarker panel, breast cancer, KIF1A, OGDHL, FKBP4, VGF, MAL promoter methylation, DNA repair capacity

Introduction

According to the World Health Organization, more than 1.2 million women worldwide will be diagnosed with breast cancer (BC) this year. Worldwide, the incidence of BC is increasing by 3.1% annually (1980 to 2010 statistics) (1). BC is the most common malignancy in women, accounting for 23% of all female malignancies (2,3). BC is also the leading cause of cancer-related death among Puerto Rican women. Data from the Puerto Rico Cancer Registry show that BC accounted for 30.3% of all female cancers between 2005 and 2009 and 18.8% of all female cancer-related deaths between 2004 and 2008 (4). Mammography’s limitations in early detection of BC have been documented, particularly in women with pre-menopausal BC (5).

BC is a complex disease resulting from a combination of genetic, epigenetic and environmental factors (6). Aberrant promoter methylation of several known or putative tumor-suppressor genes (TSGs) occurs frequently during the pathogenesis of human cancer, including BC. Methylated TSGs are promising biomarkers for cancer screening that can be measured in plasma (7,8). Similarly, dysregulation of DNA repair pathways predisposes cells to accumulating damage and eventually mutations. Epidemiological studies using functional repair assays in lymphocytes or other cell types have demonstrated that DNA repair capacity (DRC) varies greatly among individuals and that a low repair capacity is a significant risk factor for the development of several types of cancers, including BC (9,10). Our previous studies have shown that a low DRC is an important risk factor for BC in Puerto Rican women (11,12). Few studies have examined the combined contribution of genetic and epigenetic alterations associated with BC using blood-based assays. To test the association of MAL, KIF1A, FKBP4, VGF, and OGDHL promoter methylation with BC, we obtained plasma DNA from 340 participants in a case-control BC study (9). Since women with BC in this cohort have an average decrease of 60% in their DCR levels we also performed a subset analysis to examine the association between promoter methylation of MAL, KIF1A, FKBP4 and OGDHL and DRC levels.

Materials and methods

Study design

Plasma DNA from 340 participants, randomly selected from an incident-case case-control study of 1,186 Puerto Rican resident women representing ~83% of the island’s municipalities (counties) was obtained after IRB approval from the Institutional Review Boards (IRB) of the Johns Hopkins School of Medicine and the Ponce School of Medicine and Health Sciences. The participants were selected with the random selection subroutine of SPSS: Select Cases, Random Sample of Cases (IBM SPSS, version 22; Chicago IL, USA).

Study population

All participants were female residents of Puerto Rico, recruited primarily from private practice offices of oncologists, gynecologists and surgeons in the cities of San Juan, Ponce, Salinas and Yauco. The age of the participants ranged from 30 to 89 years. A total of 502 BC cases and 684 controls, prospectively recruited over 7 years (2006 to 2013), were included in the original study sample (11).

Cases were women with a diagnosis of primary BC recruited consecutively from individuals visiting gynecological and primary care medical offices in Puerto Rico. The inclusion criteria for cases were as follows: patients who were recently diagnosed with primary BC, confirmed by histopathology and not receiving chemotherapy, blood transfusions, or radiotherapy. Patients with BC secondary to other types of cancer were not included. The pathology report from each case was reviewed to confirm the diagnosis.

Controls were women without BC recruited consecutively from individuals visiting gynecological and primary care medical offices in Puerto Rico for their routine mammograms and other types of wellness screenings. The two inclusion criteria for controls were: have a normal clinical breast examination performed by their primary physicians and normal mammogram result, both no more than six months prior to enrollment. Controls were recruited from the same population (clinics, physician offices and hospitals) where the cases came from; if they were to eventually develop BC, they would be treated in the same clinics where the cases were recruited. These selection criteria minimized selection bias. Women with BC secondary to another type of cancer were excluded from the present study.

BC patients and controls completed informed consent and HIPAA forms, as well as a self-administered questionnaire. The seven-page epidemiological questionnaire was used to gather epidemiological information on risk factors in relation to family history, genetic, hormonal and lifestyle factors. The characteristics of study participants including age, body mass index (BMI), family history of BC, age of menopause, alcohol consumption, smoking habits, consumption of multivitamins and DRC are summarized in Table I.

Table I.

Socio-demographic characteristics and risk factors of the study participants.

Variable Cases n (%) Controls n (%) P-value Total
Age (years)
 ≤53 89 (44) 85 (62) 0.001a 174 (51)
 >53 114 (56) 53 (38) 167 (49)
 Mean ± SD 56±11.8 51±12.3 <0.001a 54.3±12.3
 Median (range) 56 (30–89) 50 (22–86) 53 (22–89)
BMI
 ≤25 54 (27) 51 (37) 0.042a 105 (30)
 >25 149 (73) 86 (63) 235 (69)
Family history of BC
 Yes 32 (23) 41 (32) 0.505 73 (21)
 No 106 (77) 86 (68) 268 (79)
Menopausal status
 Yes 25 (18) 35 (18) >0.999 60 (18)
 No 112 (82) 161 (82) 273 (82)
Alcohol consumption
 Yes 38 (29) 34 (17) 0.015 72 (21)
 No 98 (71) 169 (83) 267 (79)
Smoking status
 Yes 22 (16) 32 (16) >0.999 54 (16)
 No 114 (84) 171 (84) 285 (84)
Multivitamin use
 Yes 63 (46) 67 (33) 0.023a 130 (38)
 No 74 (54) 135 (67) 209 (62)
DRC
 Low 39 (29) 167 (82) <0.001a 206 (60)
 High 99 (71) 36 (18) 135 (40)
a

Statistically significant.

BMI, body mass index; BC, breast cancer; DRC, DNA repair capacity.

DNA methylation analysis

DNA from 340 participants was extracted from 500 μl of plasma. Genomic DNA from 280 (81%) patients had 260/280 ratios >1.7 and amplified β-actin, thus meeting our stringent QC filter. We randomly divided the participants into a discovery set (20 cases and 20 controls) and a validation set (154 cases and 86 controls). Briefly, bisulfite-modified DNA was used as template for fluorescence-based real-time PCR, as previously described (13). Fluorogenic PCR reactions were carried out in a reaction volume of 20 ml consisting of 600 nmol/l of each primer; 200 mmol/l probe; 0.75 units Platinum Taq polymerase (Invitrogen); 200 mmol/l each of dATP, dCTP, dGTP and dTTP; 200 nmol/l ROX dye reference (Invitrogen); 16.6 mmol/l ammonium sulfate; 67 mmol/l Trizma (Sigma); 6.7 mmol/l magnesium chloride; 10 mmol/l mercaptoethanol; and 0.1% dimethyl sulfoxide. Duplicates of 3 ml of bisulfite-modified DNA solution were used in each real-time MSP amplification reaction. Primers and probes were designed to amplify a segment of a CpG island in the promoter of the genes of interest and of a reference gene, β-actin (ACTB), as previously described. Primers and probes were tested on positive (genomic methylated bisulfite converted DNA) and negative controls (genomic unmethylated bisulfite converted DNA) to ensure amplification of the desired product and non-amplification of unmethylated DNA, respectively. Primer and probe sequences and annealing temperatures are provided in Table II.

Table II.

qMSP primers and probe information.

Gene Genbank # Forward 5′-3′ Reverse 5′-3′ Annealing temp. °C
ACTB Y00474 TGGTGATGGAGGAGGTTTAGTAAG T AACCAATAAAACCTACTCCTCCCTTAA 60
MAL NM_002371 GTTTTTAGTTTTGGACGTTCGTAG CCAACCCCGCCCCCCGC 60
KIF1A NM_004321 GCG CGA TAA ATT AGT TGG CGA TT CTCGACGACTACTCTACGCTA T 58
OGDHL NM_012446 TCGTTAGTATCGTGGATAGC TACAAATCAAAAAACTACGCG 55
VGF NM_003378 GGATAGCGTTCGTAGGCG AAAAACCGAATTCCCCACCCCG 60

Probe 6 FAM 5′-3′ TAMRA Amplicon size (bp) (nucleotide range)

ACTB ACCACCACCCAACACACAATAACAAACACA 133 (390–522)
MAL AACACCGCCCTAAACCTCTTCGAAAC 104 (−204–100)
KIF1A CCTCCCGAAACGCTAATTAACTACGCG 140 (870–1010)
OGDHL CGCCGTACCAATTACCTAAATCAC 161 (881–1042)
VGF GCGCCCAAAAACGACGTAAACCTAAATAC 84 (−502--418)

Temp., temperature.

Amplification reactions were carried out in 384-well plates in a 7900 Sequence Detector (Perkin-Elmer Applied Biosystems) and were analyzed by SDS 2.2.1 (Sequence Detector System; Applied Biosystems). Thermal cycling was initiated with an initial denaturation step at 95°C for 3 min, followed by 50 cycles at 95°C for 15 sec and annealing temperature for 1 min. Each plate included patient DNA samples, positive (bisulfite converted hypermethylated universal DNA standard; Zymo Research), and multiple water blanks as non-template controls. Serial dilutions (60-0.006 ng) of this DNA were used to construct a calibration curve for each plate. The relative level of methylated DNA for each gene in each sample was determined as a ratio of qMSP for the amplified gene to ACTB and then multiplied by 100 for easier tabulation. The samples were categorized as unmethylated or methylated based on detection of methylation above a threshold set for each gene.

Statistical analysis

Data were entered and compiled in the SPSS® 22 statistical package (IBM SPSS, Chicago, IL, USA), following a standardized procedure to verify the data and correct for sample gaps or errors. Frequency distribution and cross-tabulation of selected variables were used to initially explore crude data, to evaluate the crude associations of each gene methylation value (along with other covariates) in regard to BC and DRC, and to explore the feasibility of further data analysis of each variable under study.

Methylation values were first analyzed as continuous variables and were also dichotomized into ‘methylated and not methylated’ using a cut-off identified by area under the curve (AUC) analyses (14,15). Unadjusted and adjusted analyses were used to examine the association between promoter methylation, BC and DRC levels, which were previously measured in this cohort with the host cell reactivation assay and using a luciferase reporter gene (11). In addition, the associations of all covariates with each gene methylation as compared to no methylation were an integral part of the analysis. After transforming continuous variables to approximate normality, we used the mean difference (differential methylation) to compare BC and control data. Mean differences in promoter methylation were also compared along high and low DRC levels. The 95% confidence intervals were used to assess the precision of the mean difference, and the Wilcoxon test was used to assess the statistical significance of the mean differences since the distribution of some of these variables was unknown or skewed. For categorical variables, the odds ratio (OR) was used as a measure of association, with a 95% confidence interval as an assessment of the precision of this estimate. The two-tailed Fisher’s exact test was calculated to measure the statistical significance of the crude OR.

We also explored confounding and interaction effects to establish associations between promoter methylation and BC, DRC level (low <4.97%; high ≥4.97%), and other covariates by means of the Mantel and Hansel stratified analysis. We used multiple logistic regressions to measure the adjusted OR and analyze possible interactions. After fitting the best model to adjust for potential confounders, we adjusted all associations by age, BMI, family history of BC, menopausal status, alcohol consumption, smoking status, multivitamin use and DRC.

Results

Cases and controls differ in several categories

Fifty-six percent of the cases and 38% of the controls were over 54 years of age; 73% of the cases and 63% of the controls had a BMI ≥25; 23% of the cases and 32% of the controls had a family history of BC; 29% of the cases and 17% of the controls had a history of alcohol consumption; 46% of the cases and 33% of the controls had a history of multivitamin use; 71% of the cases and 18% of the controls had high levels of DRC.

Discovery cohort

Differential promoter methylation of MAL, KIF1A, FKBP4, VGF and OGDHL was examined by qMSP in the discovery cohort. We observed a significant association between MAL promoter methylation and BC (p=0.01), after adjusting for age, family history of cancer and DRC. A receiver operating curve analysis revealed that MAL promoter methylation had 94.1% sensitivity and 86.7% specificity; and 0.93 AUC.

The MAL promoter in women with BC had 44 times more odds to be methylated when compared to the controls. After adjusting for age and family history of BC, the OR increased from 44.0 to 46.3. Furthermore, after adjusting for DRC, the association increased almost 2-fold from 46.3 to 83.0. Promoter methylation of KIF1A (OR=21) and FKBP4 (OR=5.9) was also associated with BC after adjusting for age, family history of BC, and DRC, albeit not significantly (Table III). We decided to drop VGF from further analyses since only 1 out of 18 cases was methylated.

Table III.

Crude and adjusted ORs and 95% CIs for promoter methylation of the MAL, KIF1A, FKBP4 and OGDHL genes in breast cancer cases and controls.

Gene BC cases Controls Crude OR (95% CI) P-value Adjusted ORa (95% CI) P-value Adjusted ORb (95% CI) P-value
MAL
 Methylated 16 4 44 (4.3–448.6) <0.001c 46.3 (3.9–550.3) 0.002c 83 (2.8–2422.7) 0.01c
 Not methylated 1 11
KIF1A
 Methylated 3 2 1.6 (0.2–10.8) >0.999 1.8 (0.3–12.7) 0.564 21 (0.5–819.6) 0.104
 Not methylated 16 17
FKBP4
 Methylated 4 1 4.8 (0.5–47.7) 0.340 4.2 (0.4–43.0) 0.229 5.9 (0.3–130.1) 0.258
 Not methylated 15 18
OGDHL
 Methylated 4 0 7.0d (1.56e-60–3.15e+61) 0.978 6.7d (1.24e-60–3.62e+61) 0.979 6.5d (8.61e-61–4.94e+61) 0.979
 Not methylated 15 19
a

Adjusted by age and family history of breast cancer;

b

adjusted by age, family history of breast cancer and DRC.

c

Statistically significant results.

d

Only cases are methylated, thus GLM was used to estimate odds, risk, by exponentiation of the appropriate coefficients.

BC, breast cancer; OR, odds ratio; CI, confidence interval.

The trend in the association between BC and promoter methylation of MAL, KIF1A and FKBP4, was strengthened in every case after adjusting for DRC, which led us to examine the association between promoter methylation of these genes and DRC. Table IV lists the crude and adjusted results of the association between promoter methylation and DRC in the discovery cohort. Women with low DRC had 3.0 and 3.3 times more odds to have MAL promoter and FKBP4 methylation respectively, and less likely to have KIF1A methylation, when compared to women with high DRC.

Table IV.

Promoter methylation of the MAL, KIF1A, FKBP4 and OGDHL genes in breast cancer patients with low and high DNA repair capacity (DRC).

Gene Low DRC <4.97% High DRC ≥4.97% Crude OR (95% CI) P-value Adjusted ORa (95% CI) P-value
MAL
 Methylated 14 6 3.2 (0.7–15.6) 0.150 3 (0.6–14.6) 0.182
 Not methylated 5 7
KIF1A
 Methylated 2 3 0.4 (0.06–2.96) 0.632 0.4 (0.06–3.0) 0.385
 Not methylated 20 13
FKBP4
 Methylated 4 1 3.3 (0.3–33.1) 0.374 3.3 (0.3–34.0) 0.319
 Not methylated 18 15
OGDHL
 Methylated 4 0 0.1b (3.06e−62–7.28e+59) 0.979 0.2b (1.77e−62–1.99e+60) 0.980
 Not methylated 18 16
a

Adjusted by age and family history of breast cancer.

b

Only cases are methylated, thus GLM was used to estimate odds, risk, by exponentiation of the appropriate coefficients.

OR, odds ratio; CI, confidence interval.

Validation cohort

Promoter methylation of MAL, KIF1A and OGDHL was then quantified by qMSP in the validation cohort. Three of the four genes had receiver characteristic operator curve values of ≥0.50: MAL (0.64), KIF1A (0.51) and OGDHL (0.53). The mean of log-transformed promoter methylation values for MAL, KIF1A and OGDHL were higher in BC cases compared to the controls (Table V). The mean difference in log-transformed methylation values was highest for OGDHL, followed by KIF1A. This difference was statistically significant for KIF1A (p=0.032), borderline for OGDHL (p=0.096), and not significant for MAL (p=0.18). KIF1A (p=0.012) and OGDHL (p=0.048) were significantly associated with BC, after adjusting for age, family history of cancer and DRC.

Table V.

Mean methylation values, mean differences, and crude and adjusted ORs and 95% CIs for promoter methylation of the MAL, KIF1A, FKBP4 and OGDHL genes in breast cancer cases and controls.

Gene Cases mean (n) Controls mean (n) Mean difference (95% CI) P-value Crude OR (95% CI) P-value Adjusted ORa (95% CI) P-value Adjusted ORb (95% CI) P-value
MAL 1.5 (154) 1.4 (86) −0.1 (−0.2–0.04) 0.180 1.4 (0.8–2.4) 0.179 1.4 (0.8–2.5) 0.257 1.3 (0.7–2.6) 0.407
KIF1A 1.6 (50) 1.4 (38) −0.2 (−0.4, −0.02) 0.032c 0.4 (0.2–0.9) 0.033c 3.8 (1.3–10.8) 0.012c 2.4 (0.7–8.3) 0.169
OGHDL 1.6 (30) 1.3 (15) −0.3 (−0.6–0.1) 0.096 3.0 (0.8–11.0) 0.097 5.2 (1.1–27.1) 0.048c - 0.992
a

Adjusted by age, BMI, family history of breast cancer, menopausal status, alcohol use, smoking status and multivitamin use;

b

adjusted by age, BMI, family history of breast cancer, menopausal status, alcohol use, smoking, multivitamin use and DRC.

c

Indicates statistically significant results.

OR, odds ratio; CI, confidence interval; BMI, body mass index; DRC, DNA repair capacity.

We also found a significant difference in log transformed KIF1A promoter methylation (p=0.007) when comparing patients with high and low DRC (Table VI). Multivariate analysis showed that KIF1A promoter methylation was inversely associated with DRC after adjusting for age, BMI, family history of cancer, menopausal status, alcohol use, smoking, multivitamin use and BC (p=0.012).

Table VI.

Mean methylation values, mean differences and crude and adjusted ORs and 95% CIs for promoter methylation of the MAL, KIF1A, FKBP4 and OGDHL genes in breast cancer cases with low and high DRC levels.

Gene Low DRCs mean (n) High DRCs mean (n) Mean difference (95% CI) P-value Crude OR 95% (CI) P-value Adjusted ORa 95% (CI) P-value Adjusted ORb 95% (CI) P-value
MAL −3.3 (154) −3.6 (82) 0.3 (−0.2–0.7) 0.27 0.8 (0.5–1.4) 0.392 0.8 (0.4–1.4) 0.396 0.9 (0.4–1.7) 0.726
KIF1A −3.9 (49) −5.2 (33) 1.3 (0.4–2.3) 0.007b 0.3 (0.1–0.7) 0.009b 0.1 (0.04–0.5) 0.002b 0.1 (0.04–0.7) 0.015b
OGHDL −5.3 (26) −5.6 (17) 0.6 (−0.9–1.6) 0.603 0.4 (0.1–1.5) 0.194 0.3 (0.1–1.3) 0.112 0.7 (0.1–6.6) 0.728
a

Adjusted by age, BMI, family history of breast cancer, menopausal status, alcohol use, smoking status and multivitamin use;

b

adjusted by age, BMI, family history of breast cancer, menopausal status, alcohol use, smoking status, multivitamin use and BC.

c

Indicates statistically significant results.

OR, odds ratio; CI, confidence interval; BMI, body mass index.

Discussion

We demonstrated that KIF1A promoter methylation can distinguish breast cancer (BC) cases from controls in plasma and was inversely associated with DNA repair capacity (DRC) levels in a BC case control study. KIF1A is directly involved in the microtubule-based transport of dense-core vesicles in mammalian neurons (16). Methylation of KIF1A is known to be frequent and show higher levels in thyroid cancer for example, when compared to normal thyroid tissue (17). Previous studies also showed it to be differentially hypermethylated (but not significantly associated with survival) in head and neck squamous cell carcinoma (HNSCC) (18). This was also found in plasma and saliva of lung cancer and HNSCC patients compared to controls, which suggests it could serve as a biomarker for early detection, particularly when used as part of a methylation panel of several genes (19,20). In BC, overexpression of KIF1A was found to correlate with chemotherapy resistance in cell lines (21).

The genes we analyzed in the present study, MAL, FKBP4, KIF1A, VGF and OGDHL, are differentially methylated in BC cell lines and tissue samples (7). MAL encodes a trans-membrane protein involved in the sorting of proteins for signaling and transport, and therefore is expressed in most types of epithelial cells (22). Epigenetic regulation of MAL in BC has been described and associated with silencing of expression. It is observed in up to 95% of BCs, more commonly in estrogen receptor (ER)- and progesterone receptor (PR)-positive tumors (7). MAL is methylated in other types of cancer as well (23,24). FKBP4 is a component of a subclass of steroid receptor complexes, which by binding to heat shock protein 90 regulates the maturation of the receptor (25). Its expression was found to be upregulated in prostate cancer (26) and in ER-positive BCs (27). The VGF gene encodes a neuropeptide precursor with a restricted pattern of expression that is limited to a subset of neurons in the central and peripheral nervous systems and to specific populations of endocrine cells in the adenohypophysis, adrenal medulla, gastrointestinal tract and pancreas (28). VGF peptides play a multiplicity of roles including endocrine functions, local intercellular communication, as well as the possible mediation of intracellular mechanisms (29). VGF is also methylated in ovarian, testicular and head and neck tumors (8,30,31). OGDHL is part of the OGDH complex, whose malfunction is associated with neurodegeneration. Promoter methylation of the gene was noted in different tissue types. Cancer-specific methylation was evident in several types of cancer, including breast, while absent in others (32). The correlation between expression of the gene and proliferation properties of cells was also functionally demonstrated in cervical cancer cell lines.

Epigenetic changes, and specifically promoter methylation, have been well described in various types of tumors, and are known to be early events in cancer progression. Tumor-suppressor genes in tumors are frequently inactivated epigenetically by methylation when compared to normal tissue (33). However, the relationship between DRC and CpG promoter methylation has not previously been described in BC. Promoter methylation is involved in the pathogenesis of BC, and there is a constant attempt to utilize this for risk assessment, early detection, therapy monitoring among other applications, with no current consensus regarding the correct epigenetic alteration or combination of these. Recently, as part of the Cancer Genome Atlas Network project, methylation arrays were used to classify 802 BCs as part of a multiplatform BC subtype classification study (31). A cluster of tumors displayed a ‘hypermethylation phenotype’, in which 490 genes demonstrated promoter methylation associated with lower expression. This study, as well as ours, demonstrates an association between epigenetic and genetic mechanisms that contributes to cancer progression.

The concept of ‘liquid biopsies’ is under research and development in recent years, for early detection, treatment response and follow-up monitoring, in order to minimize patient burden and increase compliance while maintaining accuracy compared to tumor tissue biopsies (34). Several platforms have been suggested: blood, urine, saliva, nipple aspirate fluid for different types of cancers, using different assays - circulating tumor cells, genetic and epigenetic alterations and more. BC studies have compared the efficacy between tumor biopsy and detection of markers in plasma, including gene methylation, and have shown much promise, although, again, not reaching a consensus (8,35–37).

Interestingly, DRC was inversely correlated with KIF1A promoter hypermethylation. In this BC case-control study patients exhibited a decreased repair phenotype, on average 60% lower than age-matched controls (9,11). Epigenetic inactivation of DNA repair genes in cancer has been reported for several DNA repair pathways (33) including the nucleotide excision repair (NER) pathway (14), the pathway primarily measured by the host cell reactivation assay we used. The critical importance of the NER in BC was recently demonstrated. Mean NER capacity in BC tissue samples is significantly lower than that of normal breast tissue samples, averaging only 44% of normal activity (p<0.001) (38). Interestingly, the NER is the major human pathway for repairing a variety of bulky, helix-distorting DNA lesions, such as those induced by crosslinking agents and base-damaging carcinogens (39). Considered a ‘generalist’ of DNA repair pathways, the NER works in multiple capacities, particularly when other repair pathways exhibit reduced functionality (40).

Promoter methylation status is a simple test to conduct in plasma. The assessment of DRC is a more complicated procedure. This makes the identification of promoter methylation as surrogate molecular markers of DRC an interesting endeavor with translational applications. For example, promoter methylation of KIF1A could be used as a ‘treatment effectiveness’ biomonitor of DNA repair inhibitors, currently tested as potential therapeutic targets for BC subtypes (41–43).

A limitation of the present study is inherent in the nature of the assay used for DRC evaluation. It measures primarily the global activity of nucleotide excision repair genes involved in DNA repair, and therefore cannot pinpoint to specific genes within this pathway or to genes involved in other repair pathways that may be also associated with an increase in BC risk such as the NER.

In summary, we propose KIF1A methylation status as a potential biomarker for BC in plasma and a surrogate of DRC-related BC risk. The study design we utilized does not allow us to determine whether KIF1A promoter methylation is a driver of BC tumorigenesis or a passenger mark. Nor does it allow us to determine whether it is a biomarker of BC risk. We plan to perform functional studies to elucidate this relationship as we move forward in our understanding of promoter methylation and BC risk.

Acknowledgements

This study was made possible by the participating volunteers and their physicians, which includes the following individuals: R. Barnes, G. Bolaños, J. González Cruz, J. Laboy, J. Ortiz Rosado, E. Ramirez Lizardi, A. Romero, F. Sanchez-Gaetán, A. Torres and S. Santiago-Medina. This study was supported in part by the following grant awards: the National Cancer Institute (36) Early Detection Research Network grant U01CA84986 (to D.S.); the NCI K01CA164092 (to R.G-P.) the NCI SC1-SA157250-01 and 9SC1CA182846-04 (to J.M.); and the NCI Center to Reduce Health Disparities/NIH-MBRS Program grant S06 GM008239-20 (to J.M.).

References

  • 1.Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM. Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 2010;127:2893–2917. doi: 10.1002/ijc.25516. [DOI] [PubMed] [Google Scholar]
  • 2.Forouzanfar MH, Foreman KJ, Delossantos AM, et al. Breast and cervical cancer in 187 countries between 1980 and 2010: a systematic analysis. Lancet. 2011;378:1461–1484. doi: 10.1016/S0140-6736(11)61351-2. [DOI] [PubMed] [Google Scholar]
  • 3.Bray F, Ren JS, Masuyer E, Ferlay J. Global estimates of cancer prevalence for 27 sites in the adult population in 2008. Int J Cancer. 2013;132:1133–1145. doi: 10.1002/ijc.27711. [DOI] [PubMed] [Google Scholar]
  • 4.Figueroa-Vallés NR, Ortiz-Ortiz KJ, Pérez-Ríos N, Villanueva-Rosa E, Traverso-Ortiz M, Torres-Cintrón CR, Suárez-Ramos T, editors. Cancer in Puerto Rico, 2004–2009. Puerto Rico Central Cancer Registry; San Juan: 2012. [Google Scholar]
  • 5.Gøtzsche PC. Mammography screening: truth, lies, and controversy. Lancet. 2012;380:218. doi: 10.1016/S0140-6736(12)61216-1. [DOI] [PubMed] [Google Scholar]
  • 6.Ogino S, Lochhead P, Chan AT, et al. Molecular pathological epidemiology of epigenetics: emerging integrative science to analyze environment, host, and disease. Mod Pathol. 2013;26:465–484. doi: 10.1038/modpathol.2012.214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Ostrow KL, Park HL, Hoque MO, et al. Pharmacologic unmasking of epigenetically silenced genes in breast cancer. Clin Cancer Res. 2009;15:1184–1191. doi: 10.1158/1078-0432.CCR-08-1304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kim GE, Lee KH, Choi YD, et al. Detection of Slit2 promoter hypermethylation in tissue and serum samples from breast cancer patients. Virchows Arch. 2011;459:383–390. doi: 10.1007/s00428-011-1143-5. [DOI] [PubMed] [Google Scholar]
  • 9.Ramos JM, Ruiz A, Colen R, Lopez ID, Grossman L, Matta JL. DNA repair and breast carcinoma susceptibility in women. Cancer. 2004;100:1352–1357. doi: 10.1002/cncr.20135. [DOI] [PubMed] [Google Scholar]
  • 10.Matta JL, Villa JL, Ramos JM, et al. DNA repair and nonmelanoma skin cancer in Puerto Rican populations. J Am Acad Dermatol. 2003;49:433–439. doi: 10.1067/s0190-9622(03)00918-6. [DOI] [PubMed] [Google Scholar]
  • 11.Matta J, Echenique M, Negron E, et al. The association of DNA repair with breast cancer risk in women. A comparative observational study. BMC Cancer. 2012;12:490. doi: 10.1186/1471-2407-12-490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Morales L, Alvarez-Garriga C, Matta J, et al. Factors associated with breast cancer in Puerto Rican women. J Epidemiol Glob Health. 2013;3:205–215. doi: 10.1016/j.jegh.2013.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Hoque MO, Begum S, Topaloglu O, et al. Quantitation of promoter methylation of multiple genes in urine DNA and bladder cancer detection. J Natl Cancer Inst. 2006;98:996–1004. doi: 10.1093/jnci/djj265. [DOI] [PubMed] [Google Scholar]
  • 14.Rosner B. Fundamentals of Biostatistics. 7th edition. Brooks/Cole; Boston, MA: 2010. [Google Scholar]
  • 15.Szklo MNJ. Epidemiology Beyond the Basics. Jones and Bartlett Learning; Burlington, MA: 2006. [Google Scholar]
  • 16.Lo KY, Kuzmin A, Unger SM, Petersen JD, Silverman MA. KIF1A is the primary anterograde motor protein required for the axonal transport of dense-core vesicles in cultured hippocampal neurons. Neurosci Lett. 2011;491:168–173. doi: 10.1016/j.neulet.2011.01.018. [DOI] [PubMed] [Google Scholar]
  • 17.Brait M, Loyo M, Rosenbaum E, et al. Correlation between BRAF mutation and promoter methylation of TIMP3, RARβ2 and RASSF1A in thyroid cancer. Epigenetics. 2012;7:710–719. doi: 10.4161/epi.20524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Roh JL, Wang XV, Manola J, Sidransky D, Forastiere AA, Koch WM. Clinical correlates of promoter hypermethylation of four target genes in head and neck cancer: a cooperative group correlative study. Clin Cancer Res. 2013;19:2528–2540. doi: 10.1158/1078-0432.CCR-12-3047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ostrow KL, Hoque MO, Loyo M, et al. Molecular analysis of plasma DNA for the early detection of lung cancer by quantitative methylation-specific PCR. Clin Cancer Res. 2010;16:3463–3472. doi: 10.1158/1078-0432.CCR-09-3304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Demokan S, Chang X, Chuang A, et al. KIF1A and EDNRB are differentially methylated in primary HNSCC and salivary rinses. Int J Cancer. 2010;127:2351–2359. doi: 10.1002/ijc.25248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.De S, Cipriano R, Jackson MW, Stark GR. Overexpression of kinesins mediates docetaxel resistance in breast cancer cells. Cancer Res. 2009;69:8035–8042. doi: 10.1158/0008-5472.CAN-09-1224. [DOI] [PubMed] [Google Scholar]
  • 22.Horne HN, Lee PS, Murphy SK, Alonso MA, Olson JA, Jr, Marks JR. Inactivation of the MAL gene in breast cancer is a common event that predicts benefit from adjuvant chemotherapy. Mol Cancer Res. 2009;7:199–209. doi: 10.1158/1541-7786.MCR-08-0314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Suzuki M, Shiraishi K, Eguchi A, et al. Aberrant methylation of LINE-1, SLIT2, MAL and IGFBP7 in non-small cell lung cancer. Oncol Rep. 2013;29:1308–1314. doi: 10.3892/or.2013.2266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Lind GE, Danielsen SA, Ahlquist T, et al. Identification of an epigenetic biomarker panel with high sensitivity and specificity for colorectal cancer and adenomas. Mol Cancer. 2011;10:85. doi: 10.1186/1476-4598-10-85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Galigniana MD, Harrell JM, O‘Hagen HM, Ljungman M, Pratt WB. Hsp90-binding immunophilins link p53 to dynein during p53 transport to the nucleus. J Biol Chem. 2004;279:22483–22489. doi: 10.1074/jbc.M402223200. [DOI] [PubMed] [Google Scholar]
  • 26.Lin JF, Xu J, Tian HY, et al. Identification of candidate prostate cancer biomarkers in prostate needle biopsy specimens using proteomic analysis. Int J Cancer. 2007;121:2596–2605. doi: 10.1002/ijc.23016. [DOI] [PubMed] [Google Scholar]
  • 27.Ward BK, Mark PJ, Ingram DM, Minchin RF, Ratajczak T. Expression of the estrogen receptor-associated immunophilins, cyclophilin 40 and FKBP52, in breast cancer. Breast Cancer Res Treat. 1999;58:267–280. doi: 10.1023/a:1006390804515. [DOI] [PubMed] [Google Scholar]
  • 28.Levi A, Ferri GL, Watson E, Possenti R, Salton SR. Processing, distribution, and function of VGF, a neuronal and endocrine peptide precursor. Cell Mol Neurobiol. 2004;24:517–533. doi: 10.1023/B:CEMN.0000023627.79947.22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ferri GL, Noli B, Brancia C, D‘Amato F, Cocco C. VGF: an inducible gene product, precursor of a diverse array of neuro-endocrine peptides and tissue-specific disease biomarkers. J Chem Neuroanat. 2011;42:249–261. doi: 10.1016/j.jchemneu.2011.05.007. [DOI] [PubMed] [Google Scholar]
  • 30.Brait M, Maldonado L, Noordhuis MG, et al. Association of promoter methylation of VGF and PGP9.5 with ovarian cancer progression. PLoS One. 2013;8:e70878. doi: 10.1371/journal.pone.0070878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Brait M, Maldonado L, Begum S, et al. DNA methylation profiles delineate epigenetic heterogeneity in seminoma and non-seminoma. Br J Cancer. 2012;106:414–423. doi: 10.1038/bjc.2011.468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Sen T, Sen N, Noordhuis MG, et al. OGDHL is a modifier of AKT-dependent signaling and NF-κB function. PLoS One. 2012;7:e48770. doi: 10.1371/journal.pone.0048770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Lahtz C, Pfeifer GP. Epigenetic changes of DNA repair genes in cancer. J Mol Cell Biol. 2011;3:51–58. doi: 10.1093/jmcb/mjq053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Leary AF, Castro DG, Nicholson AG, et al. Establishing an EGFR mutation screening service for non-small cell lung cancer - sample quality criteria and candidate histological predictors. Eur J Cancer. 2012;48:61–67. doi: 10.1016/j.ejca.2011.09.022. [DOI] [PubMed] [Google Scholar]
  • 35.Silva JM, Dominguez G, Garcia JM, et al. Presence of tumor DNA in plasma of breast cancer patients: clinicopathological correlations. Cancer Res. 1999;59:3251–3256. [PubMed] [Google Scholar]
  • 36.Hoque MO, Feng Q, Toure P, et al. Detection of aberrant methylation of four genes in plasma DNA for the detection of breast cancer. J Clin Oncol. 2006;24:4262–4269. doi: 10.1200/JCO.2005.01.3516. [DOI] [PubMed] [Google Scholar]
  • 37.Heichman KA, Warren JD. DNA methylation biomarkers and their utility for solid cancer diagnostics. Clin Chem Lab Med. 2012;50:1707–1721. doi: 10.1515/cclm-2011-0935. [DOI] [PubMed] [Google Scholar]
  • 38.Latimer JJ, Johnson JM, Kelly CM, et al. Nucleotide excision repair deficiency is intrinsic in sporadic stage I breast cancer. Proc Natl Acad Sci USA. 2010;107:21725–21730. doi: 10.1073/pnas.0914772107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Li L. Nucleotide excision repair. In: Wei Q, Lei L, Chen DJ, editors. DNA Repair, Genetic Instability and Cancer. World Scientific; Singapore: 2007. pp. 65–86. [Google Scholar]
  • 40.Berwick M, Vineis P. Measuring DNA repair capacity: small steps. J Natl Cancer Inst. 2005;97:84–85. doi: 10.1093/jnci/dji038. [DOI] [PubMed] [Google Scholar]
  • 41.Curtin N. PARP inhibitors for anticancer therapy. Biochem Soc Trans. 2014;42:82–88. doi: 10.1042/BST20130187. [DOI] [PubMed] [Google Scholar]
  • 42.Eccles SA, Aboagye EO, Ali S, et al. Critical research gaps and translational priorities for the successful prevention and treatment of breast cancer. Breast Cancer Res. 2013;15:R92. doi: 10.1186/bcr3493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Glendenning J, Tutt A. PARP inhibitors - current status and the walk towards early breast cancer. Breast. 2011;20(Suppl 3):S12–S19. doi: 10.1016/S0960-9776(11)70288-0. [DOI] [PubMed] [Google Scholar]

Articles from Oncology Reports are provided here courtesy of Spandidos Publications

RESOURCES