Skip to main content
eLife logoLink to eLife
. 2014 Jun 18;3:e02372. doi: 10.7554/eLife.02372

Thrombospondin-4 controls matrix assembly during development and repair of myotendinous junctions

Arul Subramanian 1, Thomas F Schilling 1,*
Editor: Tanya T Whitfield2
PMCID: PMC4096842  PMID: 24941943

Abstract

Tendons are extracellular matrix (ECM)-rich structures that mediate muscle attachments with the skeleton, but surprisingly little is known about molecular mechanisms of attachment. Individual myofibers and tenocytes in Drosophila interact through integrin (Itg) ligands such as Thrombospondin (Tsp), while vertebrate muscles attach to complex ECM fibrils embedded with tenocytes. We show for the first time that a vertebrate thrombospondin, Tsp4b, is essential for muscle attachment and ECM assembly at myotendinous junctions (MTJs). Tsp4b depletion in zebrafish causes muscle detachment upon contraction due to defects in laminin localization and reduced Itg signaling at MTJs. Mutation of its oligomerization domain renders Tsp4b unable to rescue these defects, demonstrating that pentamerization is required for ECM assembly. Furthermore, injected human TSP4 localizes to zebrafish MTJs and rescues muscle detachment and ECM assembly in Tsp4b-deficient embryos. Thus Tsp4 functions as an ECM scaffold at MTJs, with potential therapeutic uses in tendon strengthening and repair.

DOI: http://dx.doi.org/10.7554/eLife.02372.001

Research organism: zebrafish

eLife digest

Tendons, the tough connective tissues that link muscles to bones, are essential for lifting, running and other movements in animals. A matrix of proteins, called the extracellular matrix, connects the cells in a tendon, giving it the strength it needs to prevent muscles from detaching from bones during strenuous activities.

To achieve this strength, extracellular matrix proteins bind to one another and to receptors on the muscle cell surface that are linked to its internal scaffolding, thereby organizing other proteins into a structure called a myotendinous junction. However, despite the essential roles of tendons, scientists do not fully understand how this organization occurs, or how it can go awry.

Subramanian and Schilling screened zebrafish for genes that are essential for proper muscle attachment, and zeroed in on a gene encoding a protein called Thrombospondin-4b (Tsp4b). A similar protein helps to connect muscle and tendon cells in fruit flies. Without Tsp4b, zebrafish are able to form connections between muscles and tendons, but the muscles detach easily during movement. This weakened connection is caused by disorganization of the proteins in the extracellular matrix, which results in reduced signaling from the muscle cell receptors.

When a human form of this protein was injected into zebrafish embryos lacking Tsp4b, it settled into the junctions between muscle and tendon cells. The human protein repaired the detached muscles and restored the proper organization of the matrix. This improved the strength of the muscle-tendon attachment in the treated fish embryos, suggesting that similar injections could also help to strengthen and repair muscles and tendons in people.

DOI: http://dx.doi.org/10.7554/eLife.02372.002

Introduction

Cellular structure and function depend on dynamic interactions with extracellular matrix (ECM) proteins, defects in which cause many diseases such as muscular dystrophies and osteoarthritis (Emery, 2002; Mayer, 2003; Kanagawa and Toda, 2006; Carmignac and Durbeej, 2012; Maldonado and Nam, 2013). Tendons and ligaments are especially rich in ECM proteins, predominantly laminins (Lams) and collagens (Cols) (Hauser et al., 1995; Kannus, 2000; Kjaer, 2004; Södersten et al., 2007; Snow and Henry, 2009; Schweitzer et al., 2010; Aparecida de Aro et al., 2012; Charvet et al., 2011). These multimeric proteins assemble into extremely strong fibrillar structures capable of resisting the contractile forces of muscles and enabling movement (Banos et al., 2008; Thorsteinsdóttir et al., 2011; Thorpe et al., 2013). Muscles interact with these tendon ECM proteins through integrin (Itg) heterodimers as well as the dystrophin-associated glycoprotein complex to form attachments at myotendinous junctions (MTJs) (Kannus et al., 1998; Kardon, 1998; Blake et al., 2002; Bassett et al., 2003; Henry et al., 2005; Carmignac and Durbeej, 2012). While the organization of the ECM at MTJs has been described (Kardon, 1998; Aparecida de Aro et al., 2012), the developmental processes underlying its establishment and maintenance are poorly studied.

In zebrafish embryos, early MTJs form as epithelial attachments between muscle fibers and ECM at somite boundaries (Henry et al., 2005; Snow and Henry, 2009). Initially this ECM is rich in fibronectin (Fn) but accumulates other ECM proteins as it matures. Like other vertebrate tendons, these early embryonic MTJs form through transmembrane interactions between ECM proteins with Itgs and the dystroglycan-complex, thereby linking the ECM with the muscle cytoskeleton (Henry et al., 2001; Crawford et al., 2003; Hall et al., 2007; Câmara-Pereira et al., 2009; Jacoby et al., 2009; Goody et al., 2010; Charvet et al., 2011) Downstream components of Itg signaling such as Paxillin (Pxn), Talin (Tln) and Integrin Linked Kinase (ILK) are also required for establishment and maintenance of functional MTJs in both zebrafish and mice (Gheyara et al., 2007; Conti et al., 2008; Postel et al., 2008; Câmara-Pereira et al., 2009).

The arrangement of ECM proteins at MTJs also changes in architecture and composition to withstand the forces exerted by muscle contraction (Kjaer, 2004; Câmara-Pereira et al., 2009; Snow and Henry, 2009; Charvet et al., 2013; Bricard et al., 2014). Lams, for example, become incorporated into collagen fibrils at MTJs, in contrast to the Lam meshwork that forms around Schwann cells and or Lam fibril networks in endothelia or lung alveolar cells (Hamill et al., 2009). At somite boundaries in mice, Lam–Itg interactions are essential for elongation and differentiation of muscle progenitors (Bajanca et al., 2006). Lam deposition (as well as localization of Itgs, FAK, Paxillin (Pxn), and Fn to MTJs) also depends on Itg signaling and Rho GTPases that regulate actin cytoskeletal dynamics (Hamill et al., 2009). Thus, bidirectional Itg signaling is required for MTJ maturation (Parsons et al., 2002; Crawford et al., 2003; Snow et al., 2008; Snow and Henry, 2009). In zebrafish embryos, this includes a gradual assembly of collagen fibrils between 1–6 days post fertilization into an orthogonal arrangement at myosepta (Bader et al., 2009; Charvet et al., 2011). Mutations in human LAMA2 cause a congenital form of muscular dystrophy called merosin-deficient muscular dystrophy (Tome et al., 1994; Kanagawa and Toda, 2006; Carmignac and Durbeej, 2012) and COL6 mutations cause Ullrich congenital muscular dystrophy (Bertini et al., 2011; Bönnemann, 2011; Grässel and Bauer, 2013; Pan et al., 2013), highlighting the importance of an appropriately organized muscle ECM. However, mechanisms that control this assembly of the MTJ matrix are largely unknown.

In Drosophila, the long splice form of the Itg ligand thrombospondin (Tsp)-TspA (Chanana et al., 2007; Subramanian et al., 2007), is a critical calcium-binding ECM protein secreted by tenocytes (tendon cells) that binds Itgs (Position Specific (PS)-beta and PS-alpha2 subunits) on myoblasts. Of the five vertebrate Tsp genes, subclass B including Tsp4 and Tsp5 have been observed in connective tissues associated with the musculoskeletal system (Hauser et al., 1995; Tucker et al., 1995; Hecht et al., 1998; Jelinsky et al., 2010; Frolova et al., 2014) and have been shown to function as homo- and hetero-pentamers through a conserved coiled-coil region (Hauser et al., 1995; Narouz-Ott et al., 2000; Södersten et al., 2006). Human TSP4 levels are highly elevated in patients with Duchenne muscular dystrophy (DMD), α-sarcoglycan deficiency, as well as in cardiac ECM in response to stress, and TSP5 levels increase during joint injury, osteoarthritis and cartilage degradation (Chen et al., 2000; Hecht et al., 1998; Timmons et al., 2005). Purified Tsp4 and Tsp5 also interact with a multitude of ECM proteins including Lam, Col and Fn in vitro (Narouz-Ott et al., 2000; Chen et al., 2007). Tsp4 facilitates collagen fibril packing in mouse tendons and ECM of the heart (Frolova et al., 2014). However, there are no known functions for Tsps during formation of muscle attachments and MTJ development in vertebrates.

We have identified a novel zebrafish Tsp, Tsp4b, expressed and localized at all muscle attachment sites in the developing embryo and in adults. We show that zebrafish Tsp4b, in its pentameric form alone, interacts with ECM proteins such as Lam, activates Itg signaling within muscles, and is required for establishment and maintenance of muscle attachments. Furthermore, recombinant human TSP4 is functionally interchangeable with Tsp4b and capable of repairing and strengthening tendons when provided exogenously. Our results reveal a novel mechanism for pentameric Tsp4 in ECM protein assembly and maintenance at MTJs and a potential therapeutic approach for improving tendon strength and repair.

Results

Requirements for Tsp4b in muscle attachments

Through an in situ expression screen for markers of muscle attachments, we identified a zebrafish tsp4, tsp4b (69% similar to human TSP4; Figure 1—figure supplement 1A–C), which is expressed at all muscle attachment sites (Figure 1—figure supplement 1E,F). In zebrafish, two genes share sequence similarity with other vertebrate Tsp4 genes—Tsp4a and Tsp4b (previously designated as zgc: 111910, tsp-4a and thbs4 on chromosome 21). Similar to other subclass B Tsps, Tsp4b is predicted to be secreted as a pentamer as it contains a conserved CX2C motif (CQAC—Cys-Gln-Ala-Cys) identical to human TSP4 in its hydrophobic coiled-coil oligomerization domain (CCD) (25/36 residues are identical with human and mouse Tsp4), which is required for inter-subunit disulfide linkage (Efimov et al., 1994) (Figure 1—figure supplement 1C). In situ analyses revealed tsp4b mRNA throughout the differentiating myotomes of embryonic somites beginning at 16 hr post fertilization (hpf, Figure 1—figure supplement 1D). Expression disappears in myoblasts as they differentiate and by 60 hpf becomes restricted to putative tendon cells near somite boundaries and along the horizontal myoseptum (arrowheads in Figure 1—figure supplement 1E) as well as at all muscle attachment sites of the head by 72 hpf (arrowheads in Figure 1—figure supplement 1F). The expression of tsp4b resembles that of tenomodulin (tnmd), a known tenocyte-specific marker (Figure 1—figure supplement 2), and their relatives are co-expressed in tendons and ligaments in humans (Docheva et al., 2005; Jelinsky et al., 2010). Combined fluorescent localization of tsp4b mRNA and myosin heavy chain (MHC) protein revealed that down regulation of tsp4b in myotome occurs abruptly as the wave of muscle differentiation passes medio-laterally through each somite (Figure 1—figure supplement 3A–H; Devoto et al., 1996; Henry et al., 2005). By 60 hpf, tsp4b expression was only detected in putative tenocytes along the somite boundaries, where muscle attachments have been established (Figure 1—figure supplement 3I–P).

A polyclonal antibody raised against the unique N-terminus of zebrafish Tsp4b revealed extracellular protein localization around the notochord and medial somite boundaries at 20 hpf (Figure 1A–C) where myofibers of the axial musculature first elongate and attach, and this localization progressed laterally as more lateral fibers formed functional attachments at the somite boundary. By 72 hpf, Tsp4b protein was detected at the ends of all larval axial, appendicular, pharyngeal and extraocular muscles (Figure 1D–L). In the cranial region, these include muscle-cartilage attachments, inter-muscular attachments (between segments of the sternohyoideus [SH] muscle) and muscle-soft tissue attachments. These results suggest that during initial stages of muscle development in the trunk, myoblasts secrete their own Tsp4b to initiate attachment and MTJ assembly, and at later stages of somite muscle maturation, Tsp4b levels are maintained by secretion from tenocytes in mature MTJs.

Figure 1. Zebrafish Tsp4b localizes to all muscle attachments.

(A–L) Whole mount immunostaining of wild type embryos using anti-MHC (A, D, G, J; green) and anti-Tsp4b (B, E, H, K; red) and merged (C, F, I, L). (A–C) 20-22 hpf and (D–F) 72 hpf (lateral view) trunk showing early Tsp4b localization around notochord and medial somite boundaries (B and C) and later at somite boundaries (E and F). (G–L) Ventral (G–I) and lateral (J–L) views of 72 hpf showing Tsp4b at cranial muscle attachments. Abbreviations: AM-Adductor Mandibularis, AH-Adductor Hyoideus, AO-Adductor Operculae, DO-Dilator Operculae, HH-HyoHyal, IH-InterHyal, IMA-InterMandibularis Anterior, IMP-InterMandibularis Posterior, IO-Inferior Oblique, IR-Inferior Rectus, LAP-LevatorArcus Palatini, MR-Medial Rectus, SH-SternoHyoideus. Scale bar = 30 microns.

DOI: http://dx.doi.org/10.7554/eLife.02372.003

Figure 1.

Figure 1—figure supplement 1. Tsp4b is expressed at muscle attachments.

Figure 1—figure supplement 1.

(A) Phylogenetic tree showing zebrafish tsp4a and tsp4b. (B) Sequence and protein domains place Tsp4b in Thrombospondin subclass B. (C) Predicted Tsp4b functional domains: an N-terminal region (epitope aa: 31-236) containing the Heparin Binding Domain (HBD) and Leucine Zipper Motif (LZM) with Coiled-Coil Domain (CCD) with CQAS motif (261..264 aa), an integrin-binding KGD motif in the first Type 3 Calcium Binding Repeats (TCBR) domain (492-494 aa), Type II (EGF-like) Repeats (TER) and a Thrombospondin C-Terminal Region (TspCTR). Scale bar = 10 aa. (D–F) Whole mount in situ for tsp4b mRNA, anterior left, showing expression at: (D) 18 hpf (lateral view) in somites, (E) 72 hpf (lateral view) at somite boundaries. (F) 72 hpf (ventral head) at cranial muscle attachments. Scale bar = 30 microns.
Figure 1—figure supplement 2. tsp4b and tnmd are expressed in tenocytes at MTJs.

Figure 1—figure supplement 2.

(A and B) Wild type embryos at 72 hpf, labeled by fluorescent in situ hybridization and viewed laterally in whole mounts show similar patterns of expression of tsp4b (A) and tnmd (B) in groups of cells along somite boundaries (arrowheads). Scale bar = 30 microns.
Figure 1—figure supplement 3. Tsp4b expression is downregulated in myoblasts as they differentiate.

Figure 1—figure supplement 3.

(A–P) Embryos triple-labeled with anti-MHC (A, green) marking differentiating myoblasts, in situ hybridization for tsp4b mRNA (B, red) and DAPI (C, blue). (A–D) Lateral views, anterior to the left, of embryos at 18 hpf show that differentiating myoblasts adjacent to the notochord lose tsp4b mRNA while expression is maintained in undifferentiated mesoderm cells, located laterally. At these stages no DAPI positive nuclei are located at somite boundaries where MHC-positive myofibers attach (arrowheads). (E–H) Optical sections of the same confocal stacks in dorsal view show absence of tsp4b expression in differentiated medial myofibers. (I–L) Lateral views of 60 hpf embryos show tsp4b mRNA localized immediately adjacent to DAPI + nuclei (dashed white ovals) of putative tenocytes along somite boundaries (arrowheads). (M–P) Optical sections in dorsal view show localized expression of tsp4b to myosepta (arrowheads). Scale bars = 35 microns.

Zebrafish embryos injected with antisense morpholino oligonucleotides (MOs) (0.32 ng/embryo) targeting the translation start site of tsp4b completely lacked Tsp4b protein by 72 hpf, as determined by whole-mount immunostaining with anti-Tsp4b. tsp4b-MO injected embryos (hereafter referred to as Tsp4b-deficient) were slightly curved downward, but showed no defects in muscle morphology or swimming ability (Figure 2A–C). However, muscle contractions induced with mild electrical stimulation caused dramatic muscle detachment in tsp4b-deficient embryos (Figure 2D–F,J). While stimulation with repeated 8 millisecond pulses at 30 volts caused the occasional isolated myofiber to detach in 23% (N = 16/68) of wild-type embryos, similar stimulation led to large portions of somites with detached fibers in 76% (N = 60/79) of tsp4b-deficient animals (Figure 2J). Furthermore, this phenotype was dependent both on the strength of stimulation as well as the dose of tsp4b-MO (Figure 2—figure supplement 1A,B). This weakening of muscle attachments was specific to reduction of Tsp4b since it was partially rescued by injection of full-length tsp4b mRNA (Figure 2K). Furthermore, a mosaic distribution of exogenous mRNA restored Tsp4b protein specifically at the attachment sites of rescued myofibers in a dose-dependent manner (Figure 2G–I, Figure 2—figure supplement 2).

Figure 2. Tsp4b is required for muscle attachment.

Whole mount immunostaining of 36 hpf Tsp4b-deficient embryos using anti-MHC (A, D, G; green) and anti-Tsp4b (B, E, H; red) and merged (C, F, I). (A–C) Injection of 0.32 ng tsp4b-MO eliminates Tsp4b protein at 72 hpf but myofibers attach. (D–F) Electrical stimulation (30 V) of these larvae causes muscle detachment. (G–I) Co-injection of tsp4b RNA (80 pg/embryo) rescues muscle attachment and Tsp4b localization. (J) Histogram showing muscle detachment in 76% (N = 79) of stimulated Tsp4b-deficient embryos (Chi squared test p-value<0.001). (K) Co-injection of tsp4b mRNA rescues muscle attachment in 67% (N = 92) of stimulated Tsp4b-deficient embryos (Chi squared test p-value<0.001). (p-value representation legend: significant *<0.05, highly significant **<0.01, extremely significant ***<0.001, extremely significant ****<0.0001). Scale bar = 30 microns.

DOI: http://dx.doi.org/10.7554/eLife.02372.007

Figure 2.

Figure 2—figure supplement 1. Tsp4b-deficient muscles show dose-dependent detachment upon stimulation.

Figure 2—figure supplement 1.

(A) Histogram quantifying the percentage of embryos with at least one detached muscle fiber in wild type (white bars) and tsp4b-MO injected (gray bars) embryos subjected to mild electrical stimulation at 48 hpf to induce muscle contractions. Tsp4b-deficient embryos were more sensitive to stimulation with 30 V than 20 V, but similar amounts of detachment were observed at higher voltages, in contrast to wild-type embryos (N = 20 embryos respectively). Frequency = 4 Hz; Duration = 8 ms; Delay = 6 ms. (B) Higher tsp4b-MO doses cause more frequent detachment. Percentages of embryos with at least one detached myofiber after stimulation when injected with 0.32 ng (62.5%; N = 64) or 0.16 ng (28%; N = 64)–which reduces but does not eliminate Tsp4. (Chi squared test: p-Value<0.001).
Figure 2—figure supplement 2. Exogenous tsp4b mRNA rescues Tsp4b localization in a dose-dependent manner.

Figure 2—figure supplement 2.

Lateral views, anterior to the left, of somites in 48 hpf embryos stained with anti-MHC and anti-Tsp4b. (A and B) Wild types. (C and D) Tsp4b-deficient embryos injected with 0.32 ng tsp4b-MO show complete loss of Tsp4b protein. (E and F) Co-injection with 0.01 ng of full-length tsp4b mRNA restores small amounts of Tsp4b protein. (G and H) This is more pronounced with 0.02 ng of tsp4b mRNA. (I and J) 0.04 ng of tsp4b mRNA largely restores protein at somite boundaries. (K) Histogram shows that the dose-dependent increase in number of embryos with restored Tsp4b protein matches the concentration of tsp4b mRNA coinjected with tsp4b MO (N = 50 embryos). Scale bar = 30 microns.
Figure 2—figure supplement 3. Ultrastruture of MTJs in Tsp4b deficient embryos.

Figure 2—figure supplement 3.

(A–D) MTJ ultrastructure in wild type 72 hpf embryos before (A) and after stimulation (B), Tsp4b-deficient embryos before (C) and after stimulation (D). Arrowheads–electron-dense basement membrane (BM) at MTJs. Scale bar = 0.5 μm. (E) Histogram depicting the average spacing at MTJs, as measured in TEM images, between the BM of muscle attachments in wild type (wt) (N = 6), wild-type stimulated (N = 4), tsp4b-MO injected (N = 5), and tsp4b-MO injected and stimulated (N = 4). ‘N’ represents the number of somite boundaries analyzed in the embryos (t test one-tailed, unequal variance p-value <0.05 ANOVA posthoc Tukey test: p-value<0.001).

In order to understand the effects of reducing Tsp4b levels on ECM organization at the MTJ, we examined MTJ ultrastructure with transmission electron microscopy (TEM). While wild-type embryos at 72 hpf showed basement membranes (BM) flanking a tightly packed electron dense MTJ (∼278 nm, Figure 2—figure supplement 3A,E), both stimulated wild-type embryos and Tsp4b-deficient embryos prior to stimulation showed perturbation of the ECM at MTJs with intermittent separations of BM (∼423 nm and ∼527 nm, respectively; Figure 2—figure supplement 3B,C,E). In contrast, electrically stimulated Tsp4b-deficient embryos showed catastrophic defects in both ECM and BM integrity as well as a dramatic increase in MTJ separation (∼2668 nm, Figure 2—figure supplement 3D,E), while muscle fibers remained intact. These results demonstrate a requirement for Tsp4b in maintenance and strengthening of MTJs.

Tsp4b functions in both muscle and tendon to maintain MTJ integrity

During development of the axial musculature in zebrafish, early myofibers attach at somite boundaries by 20–24 hpf (Devoto et al., 1996), at least a day before tendon progenitors are detectable at somite boundaries by tsp4b mRNA expression (Figure 1—figure supplement 3). To address cell autonomous roles for Tsp4b in muscle versus tendon, we used cell transplantation to create mosaic embryos in which wild type mesoderm capable of forming either muscles or tenocytes was transplanted into Tsp4b-deficient hosts. Consistent with a requirement for Tsp4b in muscle attachment, both isolated donor-derived, wild-type muscle cells (Figure 3A–D), as well as putative tenocytes along somite boundaries (Figure 3E–H), restored Tsp4b protein and attachment of both donor and adjacent host myofibers (70%, N = 73), and these remained attached even when stimulated (Figure 3I–L; 40%, N = 51). This demonstrates a non cell-autonomous role of Tsp4b in maintenance of muscle attachments.

Figure 3. Tsp4b has a non cell-autonomous function in muscle attachments.

Figure 3.

(A–L) 48 hpf (lateral views) of genetic mosaics generated by cell transplantation. GFP-labeled wild type muscle cells (green) (A and I) or putative tenocytes (arrow heads) (green) (E) were grafted into Tsp4b-deficient host embryos and stained with anti-Tsp4b (B, F, J; red), and anti-MHC (C, G, K; gray/white). (I–L) Transplants locally rescued muscle detachment after stimulation in regions where Tsp4b was restored (white line denotes region lacking Tsp4b). Scale bars = 30 microns.

DOI: http://dx.doi.org/10.7554/eLife.02372.011

Tsp4b is required for muscle-specific integrin signaling

Tsps function as Itg ligands. For example, interactions between vertebrate subclass A Tsps and Itgs are essential for wound healing (Kyriakides and Bornstein, 2003; Bornstein et al., 2004). The RGD (Arg-Gly-Asp) motif in Drosophila Tsp is required for its interactions with muscle-specific Itg to form stable attachments (Chanana et al., 2007; Subramanian et al., 2007). Zebrafish Tsp4b lacks an RGD but contains a non-canonical Itg-binding (KGD—Lys-Gly-Asp) motif in its C-terminus (Figure 1—figure supplement 1C; Ruoslahti, 1996; Adams, 2004). We hypothesized that secreted Tsp4b in the ECM interacts with Itgs on muscle cell surfaces to promote attachment. To address this we examined effects of depleting Tsp4b on Itg activation and functional interactions with downstream Itg signaling components. Tsp4b-deficient animals showed severe reductions in key indicators of Itg signaling within myofibers. First, in 20–22 hpf embryos injected with tsp4b-MO, levels of activated focal adhesion kinase (FAK, detected with an antibody that recognizes phosphorylation at Tyrosine 861—pFAKy861) were dramatically reduced (Figure 4A–D,G), which was rescued by injection of tsp4b mRNA (Figure 4E–G; Henry et al., 2001), and at later stages (36 hpf) were mislocalized or lost in local regions along somite boundaries (Figure 4H–K), which was also rescued by co-injection of tsp4b mRNA (Figure 4L,M). In regions where pFAK was mislocalized along the somite boundaries, muscle attachments appeared disorganized. Second, simultaneous partial reduction of Tsp4b (sub-threshold doses of tsp4b-MO) and Itg signaling in heterozygous integrin-linked kinase (ilk+/−) mutants, neither of which causes any detachment on its own, led to dramatic and widespread muscle detachment upon stimulation (Postel et al., 2008; Figure 4N). Third, in Tsp4b-deficient embryos, expression and localization of a GFP-tagged Paxillin (Pxn)—Tg[Pxn-GFP] - was significantly reduced, indicating a severe reduction in Itg signaling within the myofibers themselves (Figure 4—figure supplement 1A–C). In addition, a Tg[Itga5-RFP] transgenic line showed specific localization of RFP at MTJs, while Itga6-GFP localized more broadly along the entire length of each muscle fiber, which is reduced in Tsp4b-deficient embryos (Figure 4—figure supplement 2A–D). These results are consistent with a functional role for Tsp4b as a ligand for muscle-specific Itgs at MTJs required to stabilize muscle attachments and point to Itga5 as one likely receptor.

Figure 4. Tsp4b is required for muscle-specific integrin signaling at MTJ.

(A–F) Lateral views of 20–24 hpf embryos stained with anti-phosphorylated (Tyrosine 861) FAK (pFAK; red) and anti-MHC (green). (A and B) pFAK localizes to the ends of early myofibers at wild-type somite boundaries. (C and D) Reduced pFAK levels in Tsp4b-deficient embryos. (E and F) pFAK levels are restored in Tsp4b-deficient embryos injected with full length tsp4b mRNA. (G) Fluorescence intensity measurements (arbitrary units [A.U.]) for pFAK staining along somite boundaries confirm significant reductions in Tsp4b-deficient embryos, and partial rescue by co-injection of full length tsp4b mRNA (t test: one tailed, unequal variance; p-value: wt and tsp4b-deficient <0.05; Tsp4b-deficient and Tsp4b-deficient + tsp4b RNA p<0.001). (H–M) 36 hpf (lateral views) stained with anti-pFAK (red), and anti-MHC (green). Insets show higher magnification images of white boxed areas. (H and I) pFAK localizes to muscle sarcolemma. (J and K) In Tsp4b-deficient embryos, pFAK is reduced/discontinuous at somite boundaries. pFAK associates with ectopic muscle attachments (arrowheads). (L and M) pFAK localization is restored in Tsp4b-deficient embryos injected with full length tsp4b mRNA. (N) Embryo percentages (N = 70 embryos) with detached muscles from an intercross between two ilk+/− heterozygotes, injected with sub-threshold amounts (0.16 ng) of tsp4b-MO and stimulated (30 V) (Chi squared test; p-value: wt+ tsp4b-MO (stimulated) and ilk+tsp4b-MO (stimulated) p<0.0001, ilk (stimulated) and ilk+tsp4b-MO (stimulated) p<0.0001, ilk+ tsp4b-MO and ilk+tsp4b-MO (stimulated) p<0.0001). Scale bar = 30 microns.

DOI: http://dx.doi.org/10.7554/eLife.02372.012

Figure 4.

Figure 4—figure supplement 1. Tsp4b-deficient muscles show reduced localization of Paxillin.

Figure 4—figure supplement 1.

(A and B) 20 hpf tg(pxn-egfp) embryo showing localization of the Pxn-EGFP fusion protein to the sarcolemma of myotubes at MTJs and reductions in embryos injected with tsp4b MO. (C) Fluorescence intensity measurements (arbitrary units [A.U.]) of Pxn-EGFP at somite boundaries confirm a significant reduction in Tsp4b deficient animals. (t test: one tailed, unequal variance; p-value<0.01) Scale bar = 30 microns.
Figure 4—figure supplement 2. Itga5-RFP localizes to MTJs and Itga6-GFP localizes to muscle, and both require Tsp4b.

Figure 4—figure supplement 2.

(A and B) Live imaging of embryos showing localization of tg[Itga5-RFP] in wild type (A) and Tsp4b-knockdown (B) embryos at 36 hpf. (C and D) Embryos stained with anti-GFP show localization of Itga6-GFP in wild type (C) and reduced localization in Tsp4b-knockdown samples at 36 hpf (D). Scale Bar = 20 microns.

Tsp4b is required for laminin localization at MTJs

In addition to Tsp4, the myotendinous ECM (both early zebrafish myosepta and MTJs) contains Lams, Dystrophin (Dys), Tenascin, Fn, Cols and other Itg ligands. Lam and Dys deficiencies cause muscular dystrophies in humans and zebrafish. lam mutants show defects in myoseptum formation (lama2) and muscle patterning (lamb1 and lamc1 [Hall et al., 2007; Peterson and Henry, 2010]). Many of these ECM components interact with Itgs, and the defects in Itg activation that we have observed suggest that Tsp4b may regulate assembly of some of these other ECM components (Narouz-Ott et al., 2000; Frolova et al., 2012). To address this hypothesis we examined Lam localization (with a pan-Lam antibody) in Tsp4b-deficient embryos. We found that injection of tsp4b-MO caused a reduction in localization of Lam at somite boundaries at 24 hpf (Figure 5A–D,G,N), which was rescued by co-injection of tsp4b mRNA (Figure 5E–G). This correlated with disorganized muscle attachments. At later stages (36 hpf), Tsp4b-deficient embryos showed discontinuities in Lam distribution at somite boundaries (Figure 5H–K,N), with many fibers forming aberrant attachments at sites of localized Lam, which could be rescued by co-injection of tsp4b mRNA (Figure 5L,M). lam mRNA (lama2, lamb1, lamc1, lamc2) levels were not significantly affected by tsp4b depletion suggesting that these effects are post-transcriptional (Figure 5—figure supplement 1) and most likely due to Tsp4b-Lam interactions. In vitro binding assays using purified rat TSP4 have shown interactions with Lam, Col, and Fn among other ECM components (Narouz-Ott et al., 2000). Thus, Tsp4b could interact with Lam in a similar heteromeric complex, and initiate an Itg signaling cascade necessary for maintenance of MTJs.

Figure 5. Tsp4b is required for Laminin assembly at MTJs.

(A–F) Lateral views of somites in 20 hpf embryos stained with anti-MHC (green) and anti-pan-Laminin (Lam, red) antibodies. Insets show higher magnification images of the areas marked by white boxes, where Lam localizes to developing myotendinous ECM (arrowheads). (A and B) Wild-type siblings. (C and D) tsp4b-MO injected embryos showing local loss of Lam at 20 hpf, and ectopic muscle attachments (arrowheads) at remaining Lam foci. (E and F) Lam localization was restored in Tsp4b-deficient embryos injected with full length tsp4b mRNA. (G) Fluorescence intensity measurements (arbitrary units [A.U.]) at somite boundaries of anti-Lam in 20–24 hpf wild type controls versus embryos injected with tsp4b-MO or co-injected with tsp4b-MO and tsp4b RNA. (t test: one tailed, unequal variance; p-value: wt and Tsp4b-deficient <0.01, Tsp4b-deficient and Tsp4b-deficient and tsp4b RNA <0.05) Scale bar = 30 microns. (H and I) Lateral views of somites in wild type embryos at 36 hpf stained with anti-pan-Lam (red), and anti-MHC (green). Insets show higher magnification images of white boxed areas. Lam localizes to myotendinous ECM (I, arrowheads). (J and K) In Tsp4b-deficient embryos, Lam is reduced/discontinuous at somite boundaries (K, arrowheads). (L and M) Lam localization is restored in Tsp4b-deficient embryos injected with full length tsp4b mRNA. (N) Embryo percentages (20 hpf embryos N = 30, 72 hpf embryos N = 50) with reduced/mislocalized Lam at 20 and 48 hpf in wild type and Tsp4b-deficient embryos. (Chi squared test; p-values: 20 hpf **<0.01, 48 hpf ***<0.001) Scale bar = 30 microns.

DOI: http://dx.doi.org/10.7554/eLife.02372.015

Figure 5.

Figure 5—figure supplement 1. Tsp4b depletion does not alter lam transcription.

Figure 5—figure supplement 1.

Histogram showing relative fold-changes in quantitative PCR (qRT-PCR) assays using cDNA prepared from wild-type and Tsp4b-deficient 36hpf embryos. Tsp4b-deficient embryos show no significant difference in alpha2 (lama2), beta2 (lamb2), gamma1 (lamc1) and gamma2 (lamc2), all of which are expressed in muscle. Samples are normalized against ef1alpha as a basal expression marker. rpl13a serves as an internal control.

Pentameric Tsp4b is required for ECM organization and Itg signaling at MTJs

The reduction of Itg signaling and Lam localization in Tsp4b-deficient embryos suggests that Tsp4b has both a functional role in muscle adhesion and attachment as well as a structural role in ECM assembly at the MTJ. Itg ligands commonly bind Itgs through a canonical RGD motif, which fails to bind when Aspartate (D) is replaced with Glutamate (E) (Erb et al., 2001; Balasubramanian and Kuppuswamy, 2003; Takahashi et al., 2007). Tsp4 contains a non-canonical KGD binding motif. To test requirements for this motif in promoting Itg activation in muscles, we designed a KGE mutant tsp4b mRNA (Figure 6A). Injecting the mutant form (KGD>KGE) of tsp4b mRNA failed to rescue the muscle detachment phenotype in Tsp4b-deficient embryos (Figure 6B), confirming a requirement for Itg binding in the function of Tsp4b.

Figure 6. Integrin binding and pentamerization of Tsp4b are essential for its function.

(A) Schematic representation of Tsp4b domains showing the location of the conserved coiled-coil region with its CQAC motif (70% identical across species). Amino acid substitutions used to study the functions of KGD and CQAC motifs are underlined. (B) Muscle detachment frequencies in uninjected wild-type controls, wildtypes injected with tsp4b morpholino (MO), tsp4b RNA, KGE tsp4b mutant RNA, SQAS tsp4b mutant RNA, or co-injected with tsp4b MO and tsp4b RNA, KGE tsp4b mutant RNA, or SQAS tsp4b mutant RNA, after stimulation (N = 60 embryos each). (C) Western blot performed on whole embryo protein extract using anti-GFP and anti-FLAG antibodies under non-reducing conditions. Lanes: 1–wt (AB), 2–Tsp4b-deficient embryos injected with tsp4b-GFP mRNA, 3–Tsp4b-deficient embryos injected with SQAS-GFP mRNA, 4–Tsp4b-deficient embryos co-injected with tsp4b-FLAG and SQAS-GFP mRNAs. Pentameric Tsp4b-GFP (∼663 kDa) and pentameric Tsp4b-FLAG (∼535 kDa) bands (black arrow head). Monomeric SQAS-GFP (∼132 kDa) (grey arrow head). The band corresponding to a 100 kDa size marker in all lanes of the blot reacted with anti-GFP is a background signal.

DOI: http://dx.doi.org/10.7554/eLife.02372.017

Figure 6.

Figure 6—figure supplement 1. tsp4b-SQAS-gfp mRNA is expressed similar to wild type tsp4b-gfp mRNA.

Figure 6—figure supplement 1.

(A, D, G) Live embryos at tail bud (∼10hpf) showing show GFP fluorescence. (B, E, H) embryos imaged in bright field. (C, F, I) Merged images. (A–C) Wild type embryos (D–F) Embryos injected with tsp4b-gfp transcript. (G–I) Embryos injected with SQAS-gfp mutant transcript. Scale bar = 100 microns.
Figure 6—figure supplement 2. The CQAC motif is essential for Tsp4b localization and function.

Figure 6—figure supplement 2.

(A–H) 48 hpf embryos stained with anti-GFP (green) and anti-Tsp4b (red) show localization of all Tsp4b (A) vs injected Tsp4b-GFP protein (B) in wild type embryos. (C and D) Tsp4b localizes to the MTJ (C) but injected SQAS-GFP does not (D) in wild type embryos, (E and F) Neither Tsp4b (E) nor SQAS-GFP (F) localizes to the MTJ in Tsp4b-deficient embryos. (G and H) Injected Tsp4b-FLAG (G) localizes to the MTJ while SQAS-GFP (H) does not in Tsp4b-deficient embryos (G–H). Scale bar = 20 microns.
Figure 6—figure supplement 3. Laminin and FAK localization are dependent on pentameric Tsp4b.

Figure 6—figure supplement 3.

Fluorescence intensity measurements (arbitrary units [A.U.]) at somite boundaries of anti-pFAK and anti-Lam immunohistochemical staining in wild type and Tsp4b-deficient embryos (48hpf), co-injected with tsp4b RNA, co-injected with SQAS tsp4b mutant RNA. (t test: one tailed, unequal variance; p-values * <0.05, ** <0.01, ****<0.0001).

Subclass B Tsps function as pentamers through the highly conserved 36 residue coiled-coil motif (Figure 6A). To test requirements for oligomerization of Tsp4b in its localization we perturbed Tsp4b function by preventing it from forming the functional homo-pentameric form. To do this, we mutated the conserved CCD of Tsp4b, CQAC (Efimov et al., 1994; McKenzie et al., 2006) to SQAS (Ser-Gln-Ala-Ser) to prevent formation of inter-subunit disulfide bridges that are required for pentamerization. To verify SQAS-gfp mRNA expression, we injected wild type tsp4b-gfp and SQAS-gfp into one-cell stage embryos and analyzed them for expression at gastrula stages. Both SQAS-gfp and tsp4b-gfp were expressed similarly and strongly fluorescent at 7–8 hpf, suggesting that the mutated SQAS protein is synthesized and secreted (Figure 6—figure supplement 1). However, at later stages while tsp4b-gfp localized to MTJs similar to wild-type Tsp4b, SQAS-gfp fluorescence was not localized and gradually disappeared (Figure 6—figure supplement 2A–D). SQAS-gfp also failed to localize to MTJs in Tsp4b-deficient embryos, in contrast to tsp4b-FLAG mRNA (Figure 6—figure supplement 2E–H). To confirm the role of CQAC motif in maintaining stable functional Tsp4b pentamers, we extracted whole embryo protein under non-reducing conditions, from 36 hpf Tsp4b-deficient embryos expressing Tsp4b-GFP, SQAS-GFP and co-expressing SQAS-GFP and Tsp4b-FLAG respectively. A western blot of the protein extract showed that Tsp4b-FLAG and Tsp-GFP predominantly existed as a pentamers, while SQAS-GFP was exclusively present as monomers, further confirming that the oligomerization function of Tsp4b mediated by CQAC motif of CCD is essential for localization of Tsp4b to the MTJ (Figure 6C).

To test requirements for oligomerization of Tsp4b in muscle attachment, ECM organization and Itg signaling we injected wild type embryos with the SQAS form of tsp4b mRNA. Injected larvae at 3 dpf showed significantly increased muscle detachment upon stimulation compared to controls. Furthermore, when co-injected with the tsp4b MO, the SQAS tsp4b mRNA failed to rescue muscle detachment (Figure 6B), FAK activation or Lam localization at MTJs (Figure 6—figure supplement 3). These results suggest that in addition to a requirement for its own assembly and localization at MTJs, pentameric Tsp4b is a key scaffolding component that is required for MTJ ECM assembly and muscle-specific Itg signaling.

Human TSP4 rescues muscle attachments in Tsp4b-deficient zebrafish

Studies of bovine, equine and human TSP4 have shown that it localizes to tendons (Hauser et al., 1995; Chen et al., 2000; Södersten et al., 2006). To determine if the functional roles of zebrafish Tsp4b are evolutionarily conserved, we injected recombinant human TSP4 (2 ng/embryo) into the interstitial space between myofibers of 60 hpf Tsp4b-deficient embryos. Exogenous TSP4 protein localized to MTJs adjacent to the site of injection and rescued muscle detachment in Tsp4b-deficient larvae when stimulated (22% detached [N = 136] compared to 52% detached [N = 96] in stimulated Tsp4b-deficient embryos) (Figure 7A–I). In addition, injection of exogenous TSP4 protein reduced the occurrence of muscle detachments by ∼20% in wild-type embryos (N = 40 embryos) electrically stimulated with increasing voltages (Figure 7J). These results suggest that TSP4 and zebrafish Tsp4b are both structurally and functionally similar, and that TSP4 also serves as a scaffold for ECM assembly at MTJs.

Figure 7. Conserved functions for TSP4 in maintenance of MTJs.

Figure 7.

(A–H) Lateral views of trunk muscles in 72 hpf embryos stained with anti-MHC (green), anti-human TSP4 (red) and anti-Tsp4b (blue) antibodies. (A–D) Injected recombinant human TSP4 co-localizes with zebrafish Tsp4b at muscle attachments in wild type embryos. (E–H) Injected TSP4 localizes to somite boundaries in Tsp4b-deficient embryos. (I) Injected TSP4 rescues muscle attachments in Tsp4b-deficient embryos upon stimulation (N = 96 embryos) (Chi squared test, p value<0.001). (J) Histogram showing percentage of embryos with detached muscles in 60 hpf wt+BSA (white columns) and wt+TSP4 (shaded columns) embryos, stimulated at 30 V, 40 V and 50 V, respectively. N = 40 embryos for each sample. (Scale bars = 30 microns).

DOI: http://dx.doi.org/10.7554/eLife.02372.021

Discussion

Vertebrate tendons consist of a complex network of collagen-rich fibrils, which interact with other ECM proteins and membrane adhesion complexes on the surfaces of muscle cells to form attachments strong enough to bear contractile forces (Ros et al., 1995). How does such a complex network of ECM proteins assemble and maintain its organization? Muscles of the embryonic zebrafish undergo dynamic changes in ECM composition (Henry et al., 2001; Crawford et al., 2003; Snow and Henry, 2009; Sen et al., 2011), in which early high levels of Fn are replaced by Lams and Cols and later by an orthogonal array of collagen fibrils (Kannus, 2000; Câmara-Pereira et al., 2009; Charvet et al., 2013). These changes in ECM are critical for muscle attachment and maturation of MTJs. Here we show a novel role for pentameric Tsp4 as a key scaffolding protein that orchestrates the ECM organization of MTJs necessary for muscle attachments.

Because Tsps interact with other Itg ligands (e.g., Lam, Col, Fn) in vitro it has been debated as to whether Tsps play instructive or merely permissive roles in ECM organization and cell-ECM interactions (Narouz-Ott et al., 2000; Södersten et al., 2006; Tan and Lawler, 2009). In Drosophila, by virtue of its canonical RGD motif, Tsp plays a primary role as an Itg ligand in developing tendons. In contrast, our results suggest that zebrafish Tsp4 has a dual role, both binding Itgs through its non-canonical KGD domain and organizing the tendon ECM at MTJs to maintain muscle attachments. We propose a model in which pentameric Tsp4 in vivo functions as a scaffold to assemble other ECM components, and their interactions with Itgs and Dys complexes at MTJs (Figure 8). Our mutational studies of the CQAC motif support this hypothesis and show, for the first time in vivo, that pentamerization of Tsp4 is central to its scaffolding role, which organizes collagen fibrils in tendons in response to contractile force from muscles (Hauser et al., 1995; Kjaer, 2004; Aparecida de Aro et al., 2012).

Figure 8. Tsp4b establishes and maintains MTJ ECM organization.

Figure 8.

A model for ECM assembly at an MTJ. Pentameric assemblies of Tsp4b (red) associate with Lam (green), Col fibrils and other ECM components. Tsp4b and Lam bind Itgs (orange) on the muscle cell surface, activating FAK (green) and recruiting Pxn (yellow) and Ilk (purple) to promote muscle specific Itg signaling and stabilize myofiber attachment.

DOI: http://dx.doi.org/10.7554/eLife.02372.022

Human TSP4, which forms pentamers (Lawler et al., 1995; Frolova et al., 2012), is also capable of rescuing Tsp4b-deficient zebrafish, demonstrating that the two are functionally interchangeable. Zebrafish Tsp4b shares the conserved C-terminal domain with human TSP4 and TSP5. The C-terminal region of mammalian Tsp5, which also functions as a pentamer, has been suggested to interact with multiple ECM proteins in cartilage (Hecht et al., 1998; Chen et al., 2007) and with collagen fibrils in tendons (Chen et al., 2007; Södersten et al., 2007; Tan and Lawler, 2009). We hypothesize that Tsp4 serves as a central organizing factor in MTJs by interacting with multiple ECM proteins, proteoglycans and receptors on muscle membranes. Other Tsps could play similar organizational roles as pentamers (subclass B) or trimers (subclass A) in contexts where they are required such as neurite outgrowth, synapse formation, wound healing and tumorigenesis (Arber and Caroni, 1995; Kyriakides et al., 1998, 1999; Sid et al., 2004; Christopherson et al., 2005).

Analysis of Tsp4b expression in zebrafish reveals surprising differences in muscle-tendon cell interactions during MTJ development in different muscle groups. Axial muscles attach directly to the basement membrane at somite boundaries in the early embryo and become contractile and functional at least 12 hr before tenocytes are detected at MTJs (Devoto et al., 1996; Barresi et al., 2001; Henry et al., 2005; Snow and Henry, 2009). Our results suggest that after axial muscle progenitors attach, they secrete their own Tsp4b, which they downregulate upon differentiation, while later Tsp4b is secreted and maintained by tenocytes. Tenocytes in the zebrafish trunk likely originate from the syndetome compartment in each somite, similar to their counterparts in the chick, and migrate to sites of muscle attachment (Brent et al., 2003; Shukunami et al., 2006; Chen and Galloway, 2014). In contrast, we observe Tsp4b expression in cranial tenocytes at MTJs but not in cranial muscles. This difference in the timing and sources of Tsp4b between cranial and axial muscles suggests that there are distinct types of interactions between myoblasts and tenocytes involved in forming different types of MTJs. Our results suggest that Tsp4b is required for both initial attachments of some early muscles, which correlates with defects in early ECM, as well as more broadly in the maintenance of all types of attachments.

Tsp4−/− mice show progressive weight loss, atrophy of muscle mass and disrupted packing of collagen fibrils, but they are viable and fertile (Frolova et al., 2010, 2014). Similarly, Tsp4b-deficient zebrafish appear largely unaffected until their muscles are subjected to multiple contractions. Stress-induced expression appears to be a common feature of many Tsps. For example, TSP4 (and other Tsps) is upregulated in response to exercise, myocardial infarction and in several types of muscular dystrophy (Chen et al., 2000; Timmons et al., 2005; Frolova et al., 2012). Tsp5 expression is elevated in response to biomechanical stress (Hecht et al., 1998). Subclass A Tsps (Tsp 1–2) are also elevated in response to injury or inflammation (Bornstein et al., 2004). Elevated Tsp expression in all these scenarios could reflect an attempt by cells at ECM repair but may also be detrimental by causing tissue fibrosis. Consistent with this idea, in Tsp2−/− mutant mice, wound healing progresses rapidly without scarring, but with abnormal Col fibril structure (Kyriakides et al., 1998; Bornstein et al., 2004). Tsp4−/− mice show elevated levels of Col (Col I, II, III, V) in the heart. This elevated accumulation of Col is reversed with application of TSP4 in an in vitro cell culture system (Frolova et al., 2012). This result is similar to our in vivo study, where injected TSP4 rescues the Tsp4b-deficient phenotype, suggesting that the scaffolding function of Tsp4 is evolutionarily conserved and functions as a modulator of ECM organization in multiple tissue types. Recent work on the functions of Tsp4 in cardiac ECM has shown interesting intracellular functions, where Tsp4 localized to the endoplasmic reticulum of cardiac fibroblasts promotes nuclear shuttling of activating transcription factor 6 alpha (Lynch et al., 2012). While this intracellular role of Tsp4 cannot be ruled out in MTJ organization, the ability of exogenous TSP4 protein injected extracellularly to rescue a Tsp4b-deficient phenotype suggests that the primary function of Tsp4 is in ECM organization at MTJs.

Muscular dystrophies are characterized by loss of muscle activity due to defects in interactions between muscles and the myomatrix ECM at MTJs. A mouse model for congenital muscular dystrophy caused by Lama2 deficiency can be treated effectively by injecting recombinant Laminin1-1-1 trimer (Rooney et al., 2012). Hence, the strategy of treating such ‘myotendinopathies’ by injecting recombinant ECM proteins is a viable option. In addition, sports- and age-related tendon injuries are often difficult to treat and require prolonged recovery periods. Our work provides a potential new therapeutic strategy using TSP4 to promote efficient tendon and MTJ repair and correcting defects in the ECM in a whole range of myotendinopathies.

Materials and methods

Fish lines

Wild type embryos of the tupfel long fin (TL) line were used for all experiments with the exception of lost contact (loc) mutants, which disrupt integrin-linked kinase (ilk) (Postel et al., 2008), tg(itga5:tagrfp) (Lackner et al., 2013) and tg(bactin:pxn-egfp) transgenics (Goody et al., 2010). All embryos were raised in standard embryo medium at 28.5°C (Westerfield, 2007) and staged as described previously (Kimmel et al., 1995). Craniofacial muscles of zebrafish embryos were labeled as described previously (Schilling and Kimmel, 1997). Adult fish and embryos were collected and processed in accordance with the rules and protocols approved by UCI-IACUC.

Morpholinos and mRNA injections

An antisense morpholino (MO) oligonucleotide—CGGCCATCCTTCAATCACAACCTTC—was designed against the translation start site of tsp4b by Gene Tools, LLC. To reduce MO-induced cell death a p53-MO (AGAATTGATTTTGCCGACCTCCTCT) was co-injected at 0.35 ng/embryo. All primers used are listed in Supplementary file 1. The full-length tsp4b mRNA used in rescue experiments was synthesized from a full- length tsp4b cDNA clone (Cat No. MDR1734-202795262; Fisher Scientific, Pittsburgh, PA, USA) in pBS SK+ vector, using T3 RNA polymerase (mMessage mMachine T3 transcription kit AM1348, Life Technologies, Grand Island, NY, USA) and tailed (Poly(A) tailing kit, AM1350 Life Technologies, Grand Island, NY, USA). The pCS2-itga6-GFP clone was prepared using CloneEZ (Cat No: L00339; GenScript USA Inc., Piscataway, NJ, USA). The cloning followed a two-step protocol. In the first step, pCS2 vector was cut at ClaI site and itga6 amplicon synthesized with complementary overhangs was cloned. The following primers were used for amplifying itga6; FP: gttctttttgcaggatcccatatcgatATGGAGCTCTTTGAGAAAGCGC (lower case—pCS2 sequence, bold—ClaI site, upper case—itga6 sequence) RP: GAGAGGCCTTGAATTCGAatcgattgagtagctctcgttctcatcccac (lower case—pCS2 sequence, bold—ClaI site, upper case—itga6 sequence). The gfp amplicon synthesized with complementary overhangs was cloned into a pCS2-itga6 clone at a BstBI site. The following primers were used for amplifying gfp from pEGFP-C1 vector; FP: CGAGAGCTACTCAATCGATTTAATGGTGAGCAAGGGCGAGG (upper case—tsp4b sequence, bold—bridge to maintain translation frame, upper case under lined—gfp sequence); RP: ccttgaattcgaatcgatggaattcCTATAGGGCTGCAGAATCTAGAGGCTCG (lower case—pCS2 sequence, bold—EcoRI site, upper case—gfp sequence).

Knockdown and rescue

tsp4b antisense morpholino (MO) oligonucleotide was injected at either 0.16 or 0.32 ng/embryo; the former reduced and the latter eliminated Tsp4b protein as assayed immunohistochemically. For rescue experiments zebrafish tsp4b mRNA was synthesized from a full-length cDNA clone. KGE and SQAS mutant mRNAs were synthesized from the full-length tsp4b cDNA clone using modified site-directed mutagenesis protocol (Cat No: 200555 Quikchange II-E site-directed mutagenesis kit Agilent Technologies, Santa Clara, CA, USA) with the following primers: KGE forward-GGGAAGGGTGAGGCATGTG; KGE reverse-CACATGCCTCACCCTTCCC; SQAS forward-CATCTCTGAGAGCCAGGCCAGCGGGCTGAG; SQAS reverse- CTCAGCCCGCTGGCCTGGCTCTCAGAGATG. KGE mutated site (in bold underlined)—C1482G Asp>Glu; SQAS mutated sites (in bold underlined)—T781A and T790A, Cys>Ser. All RNAs were injected at 100 pg/embryo. The gfp and FLAG tagged constructs were constructed using Gibson Cloning on pCS2 vector backbones (Gibson et al., 2009). The following primers were used to amplify the pCS2 vector backbone, tsp4b mRNA, gfp and pCS2-3XFLAG vector backbone. pCS2 vector for tsp4b-gfp fusion: FP—GAGCCTCTAGATTCTGCAGCCCTATAGgaattcaaggcctctcgagcctctag (upper case under lined is gfp sequence, lower case is pCS2 vector sequence); RP—GAGGAGATGCATTGTGCCGGCCATgaatcgatgggatcctgcaaaaagaacaag (upper case is tsp4b sequence, lower case is pCS2 vector sequence). tsp4b for gfp fusion: FP—gttctttttgcaggatcccatcgattcATGGCCGGCACAATGCATCTCC (upper case is tsp4b sequence, lower case is pCS2 vector sequence); RP—GCTCCTCGCCCTTGCTCACCATCAAGGGGTCCATGCCATGTTGTGTACTG (upper case under lined is gfp sequence, upper case is tsp4b sequence). The same set of primers was used to amplify the SQAS mutant form of cDNA from the pCS2 clone. gfp for tsp4b fusion: FP—GTACACAACATGGCATGGACCCCTTGATGGTGAGCAAGGGCGAGGAGC (upper case is tsp4b sequence, upper case underlined is gfp sequence); RP—ctagaggctcgagaggccttgaattcCTATAGGGCTGCAGAATCTAGAGGCTC (upper case under lined is gfp sequence, lower case is pCS2 vector sequence).

tsp4b for FLAG fusion: FP—caagctacttgttctttttgcaggatcATGGCCGGCACAATGCATCTCCTC (upper case is tsp4b sequence, lower case is pCS2-3XFLAG vector sequence); RP—cgtcatggtctttgtagtccatgtcCAAGGGGTCCATGCCATGTTG (upper case is tsp4b sequence, lower case is pCS2-3XFLAG vector sequence). pCS2-3XFLAG for tsp4b fusion: FP—CAACATGGCATGGACCCCTTGgacatggactacaaagaccatgacg (upper case is tsp4b sequence, lower case is pCS2-3XFLAG vector sequence); RP—GAGGAGATGCATTGTGCCGGCCATgatcctgcaaaaagaacaagtagcttg (upper case is tsp4b sequence, lower case is pCS2-3XFLAG vector sequence).

The synthesized mRNA was purified and concentrated using RNA clean and concentrator-5 kit (Cat No: R1015; Zymo Research, Irvine, CA, USA). Recombinant human TSP4 (TSP4) protein solution was injected at 1 mg/ml, using a glass microelectrode, into the interstitial space between myofibers of anesthetized 48 hpf embryos. Embryos were allowed to recover for 12 hr in normal embryo medium before fixation for further analysis.

Muscle stimulation

To assess muscle attachment strength we designed an electrical stimulation protocol to induce muscle contraction. Teflon-insulated platinum microelectrodes (D10PW; Plastics One Inc., USA), with the insulation stripped from the ends, were connected to a Grass SD-5 stimulator (Grass Instruments, Warwick, RI, USA) with which we could vary pulse strength (volts), duration, frequency (λ), and delay. Electrodes were positioned at the anterior and posterior ends of individual wild type or Tsp4b-deficient embryos and stimulated at varying strengths—0 V, 20 V, 30 V, 40 V, 50 V—at duration = 8 ms, λ = 4 pulses/s, and delay = 6 ms. Embryos were anaesthetized with Tricaine (ethyl 3-aminobenzoate methanesulfonate; Cat No. A5040, Sigma-Aldrich, Milwaukee, WI, USA) and placed on a silicone plate with embryo medium and stimulated for 2.5 min before transfer into fixative. 30 V was found to be most effective in causing muscle detachment but allowing embryos to remain otherwise healthy with this protocol (10% of wild type embryos show any detached muscles, while 60% of Tsp4b-deficient embryos show widespread detachment in somites). To determine the dose–response, tsp4b-MO embryos injected with different amounts were subjected to muscle stimulation–28% (N = 7/25) injected with 0.16 ng/embryo of tsp4b-MO showed detachment, 63% (N = 40/64) injected with 0.32 ng/embryo showed detachment.

Whole mount in situ hybridization and immunohistochemistry

Zebrafish tsp4b (NM_173226) expression was visualized using an antisense RNA probe synthesized against a 626 bp (10–636 bp) region of tsp4b cDNA using T7 RNA polymerase (Cat No: 10881767001, Roche Diagnostic Corporation Indianapolis, IN, USA). Zebrafish tnmd (NM_001114413) expression was visualized using an antisense RNA probe synthesized to recognize a 602 bp (109–710 bp) region of tnmd cDNA using T7 RNA polymerase. Whole mount in situ hybridization was performed according to standard protocol and developed using NBT/BCIP (NBT-11383213001, BCIP- 11383221001, Roche Diagnostics Corporation, Indianapolis, IN, USA) or Fast Red (Cat No: 11496549001, Roche Diagnostics Corporation, Indianapolis, IN, USA) (Thisse and Thisse, 2008). A zebrafish-specific Tsp4b antibody was generated against 618 bp (91–708 bp) of the unique N-terminal region. This was cloned into pGEX-4T-2 expression vector, expressed as a GST tagged peptide, purified as per standard protocol and this fusion protein (206 aa) was used to raise antibodies in rabbits at Thermo Fischer/Open Biosystems, Rockford, IL, USA (Ring et al., 2002). Wild-type embryos stained with pre-immune serum from host showed absence of specific signal. Antibody specificity was verified by staining wild-type and Tsp4b deficient embryos with anti-Tsp4b. All embryos used for immunofluorescence experiments were fixed in 95% methanol and 5% glacial acetic acid for 4–6 hr at −20°C. They were rehydrated in Phosphate Buffered Saline (PBS) with 2% dimethyl sulfoxide (DMSO), 0.5% Triton (PBDT) and permeabilized with cold acetone for 10–15 min at −20°C. Following permeabilization, a standard antibody staining protocol with PBDT was used. Primary antibodies and concentrations used: rabbit anti-Tsp4b (1:500), rabbit monoclonal anti-human TSP4 (1:300; Abcam, Cambridge, MA, USA), mouse anti-myosin heavy chain (MHC) (A1025; Developmental Studies Hybridoma Bank, Iowa City, IA, USA - 1:250), rabbit anti-pan laminin (Peterson and Henry, 2010) (RB-082-A0; 1:250; Thermo Scientific Inc., Waltham, MA, USA), rabbit anti-FAK [pY861(Henry et al., 2001) [44-626G], 1:250; Life Technologies, Grand Island, NY, USA], and chicken anti-GFP (ab13970; 1:1000; Abcam, Cambridge, MA, USA). DiAmino PhenylIndole (DAPI) (D1306; 1:1000; Life Technologies, Grand Island, NY, USA) was used to mark cell nuclei. Preabsorbed secondary antibodies were all obtained from Jackson Immunoresearch, West Grove, PA, USA and used for indirect immunofluorescence at 1:1000, including: Alexa Fluor 488 conjugated donkey anti-mouse IgG (715-546-150), DyLight 549 conjugated donkey anti-rabbit IgG (711-506-152), Alexa Fluor 488 conjugated donkey anti-chicken IgY (703-486-155), Alexa Fluor 488 conjugated donkey anti-mouse IgG (715-546-150). After staining, embryos were mounted in 1% low melt agarose in PBS and imaged. The quantity of embryos chosen was dependent on the variance observed in the experiment. Experiments that involved stimulation of muscles after various treatments were performed on a larger data set to account for variability in the quantity and quality of treatments. Embryos that exhibited gross morphological defects associated with RNA toxicity or morpholino toxicity or other idiopathic growth defects were excluded from the analysis. In order to avoid background effects of adult parents, embryos from different tanks with adults of different age groups were used to collect the embryos for the analysis.

Western blot

Tsp4b forms pentamers through inter-chain interactions at the CCD and formation of inter-chain disulfide bonds with cysteine residues of the CQAC motif. In order to visualize the pentameric form on the blot it was necessary to perform the protein extraction and western blot protocol in a non-reducing condition (Narouz-Ott et al., 2000). Whole protein extract was prepared from 36 hpf embryos, de-yolked in Ringer's solution by rapid flushing using a pipette tip. The de-yolked embryos were pelleted at 1500 RPM to remove the yolk granules in the supernatant. After three washes in Ringer's solution, a modified radio immunoprecipitation assay (RIPA) buffer was added (2 μl per embryo). RIPA composition: 0.05 M Tris pH 7.4, 0.15 M NaCl, 1% Triton X100, 1.25 mM CaCl2, 0.9 mM MgCl2, 20 μM MnCl2, 0.2 mM ZnCl2 and protease inhibitors (PMSF and Leupeptin). The tissue was homogenized using a pestle and DNase added to the homogenate and incubated on ice for 30 min. A 3–10% gradient gel was cast using a gradient former. A non-reducing protein loading buffer was added to the protein extract and 20 μl of this protein extract was loaded on to the gel. A prestained PageRuler protein ladder (Cat No. 26616; Thermo Scientific Inc., Waltham, MA, USA) was used as a molecular weight reference. Western analysis was performed on the blot using mouse monoclonal anti-FLAG antibody (Clone M2; Cat No. F1804; Sigma-Aldrich, Milwaukee, WI, USA) and mouse monoclonal anti-GFP antibody (Clone JL-8; Cat No. 632381; Clontech) at 1:1000 dilution and secondary antibody anti-mouse-HRP (715-035-150; Jackson Immunoresearch, West Grove, PA, USA) at 1:10,000 dilution. Signal development was performed using a chemiluminescent assay with Luminol (Cat No. 123072, Sigma-Aldrich, Milwaukee, WI, USA) and Coumaric acid (Cat No. C9008, Sigma-Aldrich, Milwaukee, WI, USA).

qRT-PCR

Whole embryo RNA was extracted from wild-type and Tsp4b-deficient embryos were collected at 60 hpf according to standard protocols using Trizol (15596-018; Life Technologies, Grand Island, NY, USA). The experiment was designed in accordance with guidelines to conduct and report quantitative PCR (Bustin et al., 2009). The RNA quality was assessed on an Agilent bioanalyzer 2100 and a RIN value >9.0 was obtained for the samples. RNA concentration was normalized between samples and used as a template for cDNA synthesis. cDNA was synthesized with oligo dT primers using the standard protocol of ProtoScript M-MuLV First Strand cDNA Synthesis Kit (#E6300S; New England BioLabs Inc., Ipswich, MA, USA). The synthesized cDNA was diluted to 1:20 and used as a template for qRT-PCR using the protocol for LightCycler 480 SYBR Green I Master kit (04707516001; Roche). The reaction was run on LightCycler 480 II Real time-PCR Instrument (Roche Diagnostics Corporation, Indianapolis, IN, USA) and analyzed using LightCycler 480 Software release 1.5.0 SP3. The histogram was plotted on Microsoft Office–Excel.

Human TSP4 rescue

Lyophilized recombinant human TSP4 without the signal peptide (Ala22-Asn961, accession # P35443) tagged with a C-terminal His tag was derived from Chinese Hamster Ovary (CHO) cell line (2390-TH-050 Lot #MLO0612091; RD systems Inc., Minneapolis, MN, USA) It was reconstituted in a tris buffer (Narouz-Ott et al., 2000) (15 mM Tris pH 7.4, 75 mM NaCl, 1 mM ZnCl2, 1 mM CaCl2) at a concentration of 1 mg/ml as per the manufacturer's instructions. Control experiments were performed by injecting BSA solution in the same buffer at a 1 mg/ml concentration. Wild-type and Tsp4b-deficient 36 hpf embryos were anesthetized in tricaine and embedded in 2% low melting agarose (prepared using embryo medium). Using a microelectrode, 2 ng of human TSP4 protein is injected into the extracellular space between muscle fibers. Embryos were removed from the agarose and transferred to embryo medium and allowed to recover for 12 hr in 28°C. Approximately half of wild-type and Tsp4b-deficient embryos injected with the human TSP4 protein were subjected to mild electrical stimulation and fixed for staining.

Transmission electron microscopy (TEM)

Unstained 72 hpf wild-type and Tsp4b-deficient embryos (both before and after stimulation) were fixed in a 4% PFA (Cat # 15710; Electron Microscopy Sciences [EMS], Hatfield, PA, USA) and 2% Glutaraldehyde (Cat # 16020; EMS, Hatfield, PA, USA) cocktail for 6 hr at 4°C. Embryos were washed in PBS+0.1% Triton and embedded in 5% low melt agarose (Cat #20-104; Apex Chemicals). Vibratome sections (Leica VT1000S) were cut in cold PBS. Lateral sections (75 µm) were cut at 0.75 mm/s and a vibration frequency of 70 Hz. The sections were washed in 0.15 M Sodium Cacodylate (Cat # 12300; EMS, Hatfield, PA, USA), stained sequentially with 1% Osmium tetroxide (Cat No. RT 19100, EMS, Hatfield, PA, USA) and 1% Uranyl acetate (Cat No. RT 22400-1, EMS, Hatfield, PA, USA), and were embedded in Durcupan for ultrathin sections. The Imaging was performed on a JEOL 1200EX TEM (NCMIR, UCSD).

Microscopy and image analysis

Whole mount in situ stained embryos were photographed using a Zeiss Axioplan-2 microscope using Volocity image acquisition software (Improvision, Perkin Elmer Inc.). Embryos processed for fluorescent immunohistochemistry were imaged using either: (1) an Olympus Fluoview FV100 confocal system with an IX81 inverted microscope using Plan-Apo 20X/0.75 NA and Plan-Apo 40X/1.3 NA (oil) objectives, respectively, or (2) a Zeiss LSM780 confocal system with an Observer Z1 inverted microscope and a Plan-Apo 20X/0.8 NA objective. Confocal stacks were analyzed using ImageJ software (Hartig, 2013).

Sequence analysis

Multiple sequence alignment of protein sequences was performed using ClustalW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2/). Phylogenetic tree of Tsp genes was constructed using MegAlign on DNASTAR Lasergene suite.

Statistical analysis

Quantification of data from muscle stimulation studies was performed with Microsoft Excel (Office 2007). Statistical significance was calculated using a Chi-Squared test. Standard error calculated from the data set and plotted on the histogram.

Quantification of fluorescence intensity (FI)

In order to quantify protein localization, FI was measured within the area encompassing the somite boundary (Area-SB) in the embryo and compared with a similar area away from the boundary (Area S). Using the freehand drawing tool in ImageJ, a region encompassing the dorsal or ventral half of the SB was drawn, or the mid-section of S. Mean FI was measured in arbitrary units (A.U.) using the Measure function under Analyze tab in ImageJ. Since, the area under each SB is different, the mean FI for each SB is calculated to an area that is normalized with the area of S. The FI of localized protein = FI of Area SB − FI of Area S. FI was calculated for three somite boundaries per embryo, averaged and placed on a scatter plot.

Statistical significance of the distribution of FI between wild type and Tsp4b-deficient embryos was calculated by paired Student t-test with unequal variance. In experiments, where statistical significance is calculated using t test, ANOVA single factor analysis was performed with posthoc multiple comparisons using Tukey method. ANOVA analysis was performed using ‘Daniel's XL Toolbox version 6.22’ add-in for Microsoft Excel. In order to prevent bias during data collection, embryos were from different samples were first observed under the dissecting microscope and enumerated before establishing the sample identity.

Quantification of MTJ basement membrane width

The images chosen for quantification were of MTJs in the mid-section of a dorsal or ventral SB, at least a couple of cell diameters lateral to the edges of the notochord. The TEM images have a scale bar that is set for 0.5 microns. Using Set scale function under Analyze tab in ImageJ, the number of pixels along the length of the scale bar was recorded for each image. Using the line draw function, lines were drawn spanning the edges of the basement membranes at the three widest regions in the image. The number of pixels spanning the length of these lines were recorded and averaged for each image. The width of the basement membrane was calculated by: (total pixels along an average width of an MTJ − 0.5 micron)/(total pixels along the length of the scale bar). In most of the stimulated Tsp4b-deficient embryos, the MTJ gaps were very wide and not captured in a single image and hence not quantified.

Acknowledgements

We thank AThor and E Bushong from NCMIR at UCSD for assistance in TEM sample processing and imaging; R Meyer for assistance in constructing the electrical stimulation apparatus; M Waterman for advice on designing western blot experiments; C Rackauckas for advice on statistical analysis; T Volk, S Nair, A Muto, S Piloto, K Radtke, C Alexander and members of the lab for comments on the manuscript; T Zhang and I Gehring for fish care. This work was supported by NIH grants R01 DE013828 and R21 AR062792 to TFS.

Funding Statement

The funder had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Funding Information

This paper was supported by the following grant:

  • National Institutes of Health (NIH) FundRef identification ID: http://dx.doi.org/10.13039/100000002 R21 AR62792, R01 DE13828 to Thomas F Schilling.

Additional information

Competing interests

TFS: TFS has filed a provisional patent ‘Thrombospondin proteins and methods of using for treating tendons and ligaments’ with US application serial no. 61/835,325.

The other authors declare that no competing interests exist.

Author contributions

AS, Contributed towards intellectual discussions leading to design of experiments, Performing experiments, Data acquisition, Interpretation of data, Revising the manuscript.

TFS, Contributed towards intellectual discussions leading to design of experiments, Interpretation of data, Performing cell transplantation experiments, Revising the manuscript.

Ethics

Animal experimentation: This study was performed in accordance with rules and protocols approved by University of California, Irvine- Institutional Animal Care and Use Committee (UCI-IACUC) (Protocol # 2000-2149-4). Juveniles and adult fish were euthanized with Ethyl 3-aminobenzoate methanesulfonate (Tricaine). Embryos were anesthetized with Tricaine before stimulation assays.

Additional files

Supplementary file 1.

List of primer sequences used for qRT-PCR, cloning of mRNA and probe synthesis.

DOI: http://dx.doi.org/10.7554/eLife.02372.023

elife02372s001.docx (17.3KB, docx)
DOI: 10.7554/eLife.02372.023

References

  1. Adams JC. 2004. Functions of the conserved thrombospondin carboxy-terminal cassette in cell-extracellular matrix interactions and signaling. The International Journal of Biochemistry & Cell Biology 36:1102–1114. doi: 10.1016/j.biocel.2004.01.022 [DOI] [PubMed] [Google Scholar]
  2. Aparecida de Aro A, Vidal BDC, Pimentel ER. 2012. Biochemical and anisotropical properties of tendons. Micron 43:205–214. doi: 10.1016/j.micron.2011.07.015 [DOI] [PubMed] [Google Scholar]
  3. Arber S, Caroni P. 1995. Thrombospondin-4, an extracellular matrix protein expressed in the developing and adult nervous system promotes neurite outgrowth. The Journal of Cell Biology 131:1083–1094. doi: 10.1083/jcb.131.4.1083 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bader HL, Keene DR, Charvet B, Veit G, Driever W, Koch M, Ruggiero F. 2009. Zebrafish collagen XII is present in embryonic connective tissue sheaths (fascia) and basement membranes. Matrix Biology 28:32–43. doi: 10.1016/j.matbio.2008.09.580 [DOI] [PubMed] [Google Scholar]
  5. Bajanca F, Luz M, Raymond K, Martins GG, Sonnenberg A, Tajbakhsh S, Buckingham M, Thorsteinsdóttir S. 2006. Integrin alpha6beta1-laminin interactions regulate early myotome formation in the mouse embryo. Development 133:1635–1644. doi: 10.1242/dev.02336 [DOI] [PubMed] [Google Scholar]
  6. Balasubramanian S, Kuppuswamy D. 2003. RGD-containing peptides activate S6K1 through beta3 integrin in adult cardiac muscle cells. The Journal of Biological Chemistry 278:42214–42224. doi: 10.1074/jbc.M303428200 [DOI] [PubMed] [Google Scholar]
  7. Banos CC, Thomas AH, Kuo CK. 2008. Collagen fibrillogenesis in tendon development: current models and regulation of fibril assembly. Birth Defects Research Part C, Embryo today: Reviews 84:228–244. doi: 10.1002/bdrc.20130 [DOI] [PubMed] [Google Scholar]
  8. Barresi MJF, D'Angelo JA, Hernández LP, Devoto SH. 2001. Distinct mechanisms regulate slow-muscle development. Current Biology 11:1432–1438. doi: 10.1016/S0960-9822(01)00428-6 [DOI] [PubMed] [Google Scholar]
  9. Bassett DI, Bryson-Richardson RJ, Daggett DF, Gautier P, Keenan DG, Currie PD. 2003. Dystrophin is required for the formation of stable muscle attachments in the zebrafish embryo. Development 130:5851–5860. doi: 10.1242/dev.00799 [DOI] [PubMed] [Google Scholar]
  10. Bertini E, D'Amico A, Gualandi F, Petrini S. 2011. Congenital muscular dystrophies: a brief review. Seminars in Pediatric Neurology 18:277–288. doi: 10.1016/j.spen.2011.10.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Blake DJ, Weir A, Newey SE, Davies KE. 2002. Function and genetics of dystrophin and dystrophin-related proteins in muscle. Physiological Reviews 82:291–329. doi: 10.1152/physrev.00028.2001 [DOI] [PubMed] [Google Scholar]
  12. Bönnemann CG. 2011. The collagen VI-related myopathies: muscle meets its matrix. Nature Reviews Neurology 7:379–390. doi: 10.1038/nrneurol.2011.81 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Bornstein P, Agah A, Kyriakides TR. 2004. The role of thrombospondins 1 and 2 in the regulation of cell-matrix interactions, collagen fibril formation, and the response to injury. The International Journal of Biochemistry & Cell Biology 36:1115–1125. doi: 10.1016/j.biocel.2004.01.012 [DOI] [PubMed] [Google Scholar]
  14. Brent AE, Schweitzer R, Tabin CJ. 2003. A somitic compartment of tendon progenitors. Cell 113:235–248. doi: 10.1016/S0092-8674(03)00268-X [DOI] [PubMed] [Google Scholar]
  15. Bricard Y, Rallière C, Lebret V, Lefevre F, Rescan PY. 2014. Early fish myoseptal cells: insights from the trout and relationships with amniote axial tenocytes. PLOS ONE 9:e91876. doi: 10.1371/journal.pone.0091876 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT. 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clinical Chemistry 55:611–622. doi: 10.1373/clinchem.2008.112797 [DOI] [PubMed] [Google Scholar]
  17. Câmara-Pereira ES, Campos LM, Vannier-Santos MA, Mermelstein CS, Costa ML. 2009. Distribution of cytoskeletal and adhesion proteins in adult zebrafish skeletal muscle. Histology and Histopathology 24:187–196 [DOI] [PubMed] [Google Scholar]
  18. Carmignac V, Durbeej M. 2012. Cell-matrix interactions in muscle disease. The Journal of Pathology 226:200–218. doi: 10.1002/path.3020 [DOI] [PubMed] [Google Scholar]
  19. Chanana B, Graf R, Koledachkina T, Pflanz R, Vorbrüggen G. 2007. AlphaPS2 integrin-mediated muscle attachment in Drosophila requires the ECM protein Thrombospondin. Mechanisms of Development 124:463–475. doi: 10.1016/j.mod.2007.03.005 [DOI] [PubMed] [Google Scholar]
  20. Charvet B, Guiraud A, Malbouyres M, Zwolanek D, Guillon E, Bretaud S, Monnot C, Schulze J, Bader HL, Allard B, Koch M, Ruggiero F. 2013. Knockdown of col22a1 gene in zebrafish induces a muscular dystrophy by disruption of the myotendinous junction. Development 140:4602–4613. doi: 10.1242/dev.096024 [DOI] [PubMed] [Google Scholar]
  21. Charvet B, Malbouyres M, Pagnon-Minot A, Ruggiero F, Le Guellec D. 2011. Development of the zebrafish myoseptum with emphasis on the myotendinous junction. Cell and Tissue Research 346:439–449. doi: 10.1007/s00441-011-1266-7 [DOI] [PubMed] [Google Scholar]
  22. Chen FH, Herndon ME, Patel N, Hecht JT, Tuan RS, Lawler J. 2007. Interaction of cartilage oligomeric matrix protein/thrombospondin 5 with aggrecan. The Journal of Biological Chemistry 282:24591–24598. doi: 10.1074/jbc.M611390200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Chen J, Galloway J. 2014. The development of zebrafish tendon and ligament progenitors. Development 141:2035–2045. doi: 10.1242/dev.104067 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Chen YW, Zhao P, Borup R, Hoffman EP. 2000. Expression profiling in the muscular dystrophies: identification of novel aspects of molecular pathophysiology. The Journal of Cell Biology 151:1321–1336. doi: 10.1083/jcb.151.6.1321 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Christopherson KS, Ullian EM, Stokes CC, Mullowney CE, Hell JW, Agah A, Lawler J, Mosher DF, Bornstein P, Barres BA. 2005. Thrombospondins are astrocyte-secreted proteins that promote CNS synaptogenesis. Cell 120:421–433. doi: 10.1016/j.cell.2004.12.020 [DOI] [PubMed] [Google Scholar]
  26. Conti F, Felder A, Monkley S, Schwander M, Wood MR, Lieber R, Critchley D, Müller U. 2008. Progressive myopathy and defects in the maintenance of myotendinous junctions in mice that lack talin 1 in skeletal muscle. Development 135:2043–2053. doi: 10.1242/dev.015818.Progressive [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Crawford BDB, Henry CA, Clason TA, Becker AL, Hille MB. 2003. Activity and distribution of paxillin, focal adhesion kinase, and cadherin indicate cooperative roles during zebrafish morphogenesis. Molecular Biology of the Cell 14:3065–3081. doi: 10.1091/mbc.E02-08-0537 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Devoto SH, Melançon E, Eisen JS, Westerfield M. 1996. Identification of separate slow and fast muscle precursor cells in vivo, prior to somite formation. Development 122:3371–3380 [DOI] [PubMed] [Google Scholar]
  29. Docheva D, Hunziker EB, Fässler R, Brandau O. 2005. Tenomodulin is necessary for tenocyte proliferation and tendon maturation. Molecular and Cellular Biology 25:699–705. doi: 10.1128/MCB.25.2.699-705.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Efimov VP, Lustig A, Engel J. 1994. The thrombospondin-like chains of cartilage oligomeric matrix protein are assembled by a five-stranded alpha-helical bundle between residues 20 and 83. FEBS Letters 341:54–58. doi: 10.1016/0014-5793(94)80239-4 [DOI] [PubMed] [Google Scholar]
  31. Emery AEH. 2002. The muscular dystrophies. Lancet 359:687–695. doi: 10.1016/S0140-6736(02)07815-7 [DOI] [PubMed] [Google Scholar]
  32. Erb L, Liu J, Ockerhausen J, Kong Q, Garrad RC, Griffin K, Neal C, Krugh B, Santiago-Pérez LI, González FA, Gresham HD, Turner JT, Weisman GA. 2001. An RGD sequence in the P2Y(2) receptor interacts with alpha(V)beta(3) integrins and is required for G(o)-mediated signal transduction. The Journal of Cell Biology 153:491–501. doi: 10.1083/jcb.153.3.491 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Frolova EG, Drazba J, Krukovets I, Kostenko V, Blech L, Harry C, Vasanji A, Drumm C, Sul P, Jenniskens GJ, Plow EF, Stenina-Adognravi O. 2014. Control of organization and function of muscle and tendon by thrombospondin-4. Matrix Biology doi: 10.1016/j.matbio.2014.02.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Frolova EG, Pluskota E, Krukovets I, Burke T, Drumm C, Smith JD, Blech L, Febbraio M, Bornstein P, Plow EF, Stenina OI. 2010. Thrombospondin-4 regulates vascular inflammation and atherogenesis. Circulation Research 107:1313–1325. doi: 10.1161/CIRCRESAHA.110.232371 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Frolova EG, Sopko N, Blech L, Popovic ZB, Li J, Vasanji A, Drumm C, Krukovets I, Jain MK, Penn MS, Plow EF, Stenina OI. 2012. Thrombospondin-4 regulates fibrosis and remodeling of the myocardium in response to pressure overload. FASEB Journal 26:2363–2373. doi: 10.1096/fj.11-190728 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Gheyara AL, Vallejo-Illarramendi A, Zang K, Mei L, St-Arnaud R, Dedhar S, Reichardt LF. 2007. Deletion of integrin-linked kinase from skeletal muscles of mice resembles muscular dystrophy due to alpha 7 beta 1-integrin deficiency. The American Journal of Pathology 171:1966–1977. doi: 10.2353/ajpath.2007.070555 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Gibson D, Young L, Chuang R. 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods 6:12–16. doi: 10.1038/NMETH.1318 [DOI] [PubMed] [Google Scholar]
  38. Goody MF, Kelly MW, Lessard KN, Khalil A, Henry CA. 2010. Nrk2b-mediated NAD+ production regulates cell adhesion and is required for muscle morphogenesis in vivo: Nrk2b and NAD+ in muscle morphogenesis. Developmental Biology 344:809–826. doi: 10.1016/j.ydbio.2010.05.513 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Grässel S, Bauer RJ. 2013. Collagen XVI in health and disease. Matrix Biology 32:64–73. doi: 10.1016/j.matbio.2012.11.001 [DOI] [PubMed] [Google Scholar]
  40. Hall TE, Bryson-Richardson RJ, Berger S, Jacoby AS, Cole NJ, Hollway GE, Berger J, Currie PD. 2007. The zebrafish candyfloss mutant implicates extracellular matrix adhesion failure in laminin alpha2-deficient congenital muscular dystrophy. Proceedings of the National Academy of Sciences of the United States of America 104:7092–7097. doi: 10.1073/pnas.0700942104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Hamill KJ, Kligys K, Hopkinson SB, Jones JC. 2009. Laminin deposition in the extracellular matrix: a complex picture emerges. Journal of Cell Science 122:4409–4417. doi: 10.1242/jcs.041095 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Hartig SM. 2013. Basic image analysis and manipulation in ImageJ. Current Protocols in Molecular Biology Chapter 14, p.Unit14.15. doi: 10.1002/0471142727.mb1415s102 [DOI] [PubMed] [Google Scholar]
  43. Hauser N, Paulsson M, Kale AA, DiCesare PE. 1995. Tendon extracellular matrix contains pentameric thrombospondin-4 (TSP-4). FEBS Letters 368:307–310. doi: 10.1016/0014-5793(95)00675-Y [DOI] [PubMed] [Google Scholar]
  44. Hecht JT, Deere M, Putnam E, Cole W, Vertel B, Chen H, Lawler J. 1998. Characterization of cartilage oligomeric matrix protein (COMP) in human normal and pseudoachondroplasia musculoskeletal tissues. Matrix Biology 17:269–278. doi: 10.1016/S0945-053X(98)90080-4 [DOI] [PubMed] [Google Scholar]
  45. Henry CA, Crawford BD, Yan YL, Postlethwait J, Cooper MS, Hille MB. 2001. Roles for zebrafish focal adhesion kinase in notochord and somite morphogenesis. Developmental Biology 240:474–487. doi: 10.1006/dbio.2001.0467 [DOI] [PubMed] [Google Scholar]
  46. Henry CA, McNulty IM, Durst WA, Munchel SE, Amacher SL. 2005. Interactions between muscle fibers and segment boundaries in zebrafish. Developmental Biology 287:346–360. doi: 10.1016/j.ydbio.2005.08.049 [DOI] [PubMed] [Google Scholar]
  47. Jacoby AS, Busch-Nentwich E, Bryson-Richardson RJ, Hall TE, Berger J, Berger S, Sonntag C, Sachs C, Geisler R, Stemple DL, Currie PD. 2009. The zebrafish dystrophic mutant softy maintains muscle fibre viability despite basement membrane rupture and muscle detachment. Development 136:3367–3376. doi: 10.1242/dev.034561 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Jelinsky SA, Archambault J, Li L, Seeherman H. 2010. Tendon-selective genes identified from rat and human musculoskeletal tissues. Journal of Orthopaedic Research 28:289–297. doi: 10.1002/jor.20999 [DOI] [PubMed] [Google Scholar]
  49. Kanagawa M, Toda T. 2006. The genetic and molecular basis of muscular dystrophy: roles of cell-matrix linkage in the pathogenesis. Journal of Human Genetics 51:915–926. doi: 10.1007/s10038-006-0056-7 [DOI] [PubMed] [Google Scholar]
  50. Kannus P. 2000. Structure of the tendon connective tissue. Scandinavian Journal of Medicine & Science in Sports 10:312–320. doi: 10.1034/j.1600-0838.2000.010006312.x [DOI] [PubMed] [Google Scholar]
  51. Kannus P, Jozsa L, Järvinen TA, Järvinen TL, Kvist M, Natri A, Järvinen M. 1998. Location and distribution of non-collagenous matrix proteins in musculoskeletal tissues of rat. The Histochemical Journal 30:799–810. doi: 10.1023/A:1003448106673 [DOI] [PubMed] [Google Scholar]
  52. Kardon G. 1998. Muscle and tendon morphogenesis in the avian hind limb. Development 125:4019–4032 [DOI] [PubMed] [Google Scholar]
  53. Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. 1995. Stages of embryonic development of the zebrafish. Developmental Dynamics 203:253–310. doi: 10.1002/aja.1002030302 [DOI] [PubMed] [Google Scholar]
  54. Kjaer M. 2004. Role of extracellular matrix in adaptation of tendon and skeletal muscle to mechanical loading. Physiological Reviews 84:649–698. doi: 10.1152/physrev.00031.2003 [DOI] [PubMed] [Google Scholar]
  55. Kyriakides TR, Bornstein P. 2003. Matricellular proteins as modulators of wound healing and the foreign body response. Thrombosis and Haemostasis 90:986–992. doi: 10.1267/THRO03060986 [DOI] [PubMed] [Google Scholar]
  56. Kyriakides TR, Tam JW, Bornstein P. 1999. Accelerated wound healing in mice with a disruption of the Thrombospondin 2 gene. The Journal of Investigative Dermatology 113:782–787. doi: 10.1046/j.1523-1747.1999.00755.x [DOI] [PubMed] [Google Scholar]
  57. Kyriakides TR, Zhu YH, Smith LT, Bain SD, Yang Z, Lin MT, Danielson KG, Iozzo RV, LaMarca M, McKinney CE, Ginns EI, Bornstein P. 1998. Mice that lack thrombospondin 2 display connective tissue abnormalities that are associated with disordered collagen fibrillogenesis, an increased vascular density, and a bleeding diathesis. The Journal of Cell Biology 140:419–430. doi: 10.1083/jcb.140.2.419 [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Lackner S, Schwendinger-Schreck J, Jülich D, Holley SA. 2013. Segmental assembly of fibronectin matrix requires rap1b and integrin α5. Developmental Dynamics 242:122–131. doi: 10.1002/dvdy.23909 [DOI] [PubMed] [Google Scholar]
  59. Lawler J, McHenry K, Duquette M, Derick L. 1995. Characterization of human Thrombospondin-4. Journal of Biological Chemistry 270:2809–2814. doi: 10.1074/jbc.270.6.2809 [DOI] [PubMed] [Google Scholar]
  60. Lynch JM, Maillet M, Vanhoutte D, Schloemer A, Sargent MA, Blair NS, Lynch KA, Okada T, Aronow BJ, Osinska H, Prywes R, Lorenz JN, Mori K, Lawler J, Robbins J, Molkentin JD. 2012. A thrombospondin-dependent pathway for a protective ER stress response. Cell 149:1257–1268. doi: 10.1016/j.cell.2012.03.050 [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Maldonado M, Nam J. 2013. The role of changes in extracellular matrix of cartilage in the presence of inflammation on the pathology of osteoarthritis. Biomed Research International 2013:284873. doi: 10.1155/2013/284873 [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Mayer U. 2003. Integrins: redundant or important players in skeletal muscle? The Journal of Biological Chemistry 278:14587–14590. doi: 10.1074/jbc.R200022200 [DOI] [PubMed] [Google Scholar]
  63. McKenzie P, Chadalavada SC, Bohrer J, Adams JC. 2006. Phylogenomic analysis of vertebrate thrombospondins reveals fish-specific paralogues, ancestral gene relationships and a tetrapod innovation. BMC Evolutionary Biology 6:33. doi: 10.1186/1471-2148-6-33 [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Narouz-Ott L, Maurer P, Nitsche DP, Smyth N, Paulsson M. 2000. Thrombospondin-4 binds specifically to both collagenous and non-collagenous extracellular matrix proteins via its C-terminal domains. The Journal of Biological Chemistry 275:37110–37117. doi: 10.1074/jbc.M007223200 [DOI] [PubMed] [Google Scholar]
  65. Pan T-C, Zhang RZ, Markova D, Arita M, Zhang Y, Bogdanovich S, Khurana TS, Bönnemann CG, Birk DE, Chu ML. 2013. COL6A3 protein deficiency in mice leads to muscle and tendon defects similar to human collagen VI congenital muscular dystrophy. The Journal of Biological Chemistry 288:14320–14331. doi: 10.1074/jbc.M112.433078 [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Parsons MJ, Pollard SM, Saúde L, Feldman B, Coutinho P, Hirst EM, Stemple DL. 2002. Zebrafish mutants identify an essential role for laminins in notochord formation. Development 129:3137–3146 [DOI] [PubMed] [Google Scholar]
  67. Peterson MT, Henry CA. 2010. Hedgehog signaling and laminin play unique and synergistic roles in muscle development. Developmental Dynamics 239:905–913. doi: 10.1002/dvdy.22204 [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Postel R, Vakeel P, Topczewski J, Knöll R, Bakkers J. 2008. Zebrafish integrin-linked kinase is required in skeletal muscles for strengthening the integrin-ECM adhesion complex. Developmental Biology 318:92–101. doi: 10.1016/j.ydbio.2008.03.024 [DOI] [PubMed] [Google Scholar]
  69. Ring C, Ogata S, Meek L, Song J, Ohta T, Miyazono K, Cho KW. 2002. The role of a Williams-Beuren syndrome-associated helix-loop-helix domain-containing transcription factor in activin/nodal signaling. Genes & Development 16:820–835. doi: 10.1101/gad.963802 [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Rooney JE, Knapp JR, Hodges BL, Wuebbles RD, Burkin DJ. 2012. Laminin-111 protein therapy reduces muscle pathology and improves viability of a mouse model of merosin-deficient congenital muscular dystrophy. The American Journal of Pathology 180:1593–1602. doi: 10.1016/j.ajpath.2011.12.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Ros MA, Rivero FB, Hinchliffe JR, Hurle JM. 1995. Immunohistological and ultrastructural study of the developing tendons of the avian foot. Anatomy and Embryology 192:483–496. doi: 10.1007/BF00187179 [DOI] [PubMed] [Google Scholar]
  72. Ruoslahti E. 1996. RGD and other recognition sequences for integrins. Annual Review of Cell and Developmental Biology 12:697–715. doi: 10.1146/annurev.cellbio.12.1.697 [DOI] [PubMed] [Google Scholar]
  73. Schilling TF, Kimmel CB. 1997. Musculoskeletal patterning in the pharyngeal segments of the zebrafish embryo. Development 124:2945–2960 [DOI] [PubMed] [Google Scholar]
  74. Schweitzer R, Zelzer E, Volk T. 2010. Connecting muscles to tendons: tendons and musculoskeletal development in flies and vertebrates. Development 137:2807–2817. doi: 10.1242/dev.047498 [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Sen S, Tewari M, Zajac A, Barton E, Sweeney HL, Discher DE. 2011. Up-regulation of paxillin and focal adhesion signaling follows dystroglycan complex deletions and promotes a hypertensive state of differentiation. European Journal of Cell Biology 90:249–260. doi: 10.1016/j.ejcb.2010.06.005.Up-regulation [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Shukunami C, Takimoto A, Oro M, Hiraki Y. 2006. Scleraxis positively regulates the expression of tenomodulin, a differentiation marker of tenocytes. Developmental Biology 298:234–247. doi: 10.1016/j.ydbio.2006.06.036 [DOI] [PubMed] [Google Scholar]
  77. Sid B, Sartelet H, Bellon G, El Btaouri H, Rath G, Delorme N, Haye B, Martiny L. 2004. Thrombospondin 1: a multifunctional protein implicated in the regulation of tumor growth. Critical Reviews in Oncology/Hematology 49:245–258. doi: 10.1016/j.critrevonc.2003.09.009 [DOI] [PubMed] [Google Scholar]
  78. Snow CJ, Henry CA. 2009. Dynamic formation of microenvironments at the myotendinous junction correlates with muscle fiber morphogenesis in zebrafish. Gene Expression Patterns 9:37–42. doi: 10.1016/j.gep.2008.08.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Snow CJ, Peterson MT, Khalil A, Henry CA. 2008. Muscle development is disrupted in zebrafish embryos deficient for fibronectin. Developmental Dynamics 237:2542–2553. doi: 10.1002/dvdy.21670 [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Södersten F, Ekman S, Niehoff A, Zaucke F, Heinegård D, Hultenby K. 2007. Ultrastructural immunolocalization of cartilage oligomeric matrix protein, thrombospondin-4, and collagen fibril size in rodent achilles tendon in relation to exercise. Connective Tissue Research 48:254–262. doi: 10.1080/03008200701587505 [DOI] [PubMed] [Google Scholar]
  81. Södersten F, Ekman S, Schmitz M, Paulsson M, Zaucke F. 2006. Thrombospondin-4 and cartilage oligomeric matrix protein form heterooligomers in equine tendon. Connective Tissue Research 47:85–91. doi: 10.1080/03008200600584124 [DOI] [PubMed] [Google Scholar]
  82. Subramanian A, Wayburn B, Bunch T, Volk T. 2007. Thrombospondin-mediated adhesion is essential for the formation of the myotendinous junction in Drosophila. Development 134:1269–1278. doi: 10.1242/dev.000406 [DOI] [PubMed] [Google Scholar]
  83. Takahashi S, Leiss M, Moser M, Ohashi T, Kitao T, Heckmann D, Pfeifer A, Kessler H, Takagi J, Erickson HP, Fässler R. 2007. The RGD motif in fibronectin is essential for development but dispensable for fibril assembly. The Journal of Cell Biology 178:167–178. doi: 10.1083/jcb.200703021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Tan K, Lawler J. 2009. The interaction of Thrombospondins with extracellular matrix proteins. Journal of Cell Communication and Signaling 3:177–187. doi: 10.1007/s12079-009-0074-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  85. Thisse C, Thisse B. 2008. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nature Protocols 3:59–69. doi: 10.1038/nprot.2007.514 [DOI] [PubMed] [Google Scholar]
  86. Thorpe CT, Birch HL, Clegg PD, Screen HR. 2013. The role of the non-collagenous matrix in tendon function. International Journal of Experimental Pathology 94:248–259. doi: 10.1111/iep.12027 [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. Thorsteinsdóttir S, Deries M, Cachaço AS, Bajanca F. 2011. The extracellular matrix dimension of skeletal muscle development. Developmental Biology 354:191–207. doi: 10.1016/j.ydbio.2011.03.015 [DOI] [PubMed] [Google Scholar]
  88. Timmons JA, Jansson E, Fischer H, Gustafsson T, Greenhaff PL, Ridden J, Rachman J, Sundberg CJ. 2005. Modulation of extracellular matrix genes reflects the magnitude of physiological adaptation to aerobic exercise training in humans. BMC Biology 3:19. doi: 10.1186/1741-7007-3-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  89. Tome FM, Evangelista T, Leclerc A, Sunada Y, Manole E, Estournet B, Barois A, Campbell KP, Fardeau M. 1994. Congenital muscular dystrophy with merosin deficiency. Comptes rendus de l’Académie des sciences Série III, Sciences de la vie, 317:351–357 [PubMed] [Google Scholar]
  90. Tucker RP, Adams JC, Lawler J. 1995. Thrombospondin-4 is expressed by early osteogenic tissues in the chick embryo. Developmental Dynamics 203:477–490. doi: 10.1002/aja.1002030410 [DOI] [PubMed] [Google Scholar]
  91. Westerfield M. 2007. The Zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio) 5th edition. Eugene, Oregon: University of Oregon Press [Google Scholar]
eLife. 2014 Jun 18;3:e02372. doi: 10.7554/eLife.02372.024

Decision letter

Editor: Tanya T Whitfield1

eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.

Thank you for sending y“our work entitled “Thrombospondin-4 controls matrix assembly during development and repair of vertebrate myotendinous junctions.” for consideration at eLife. Your article has been favorably evaluated by a Senior editor and 3 reviewers, one of whom is a member of our Board of Reviewing Editors.

The Reviewing editor and the other reviewers discussed their comments before we reached this decision, and the Reviewing editor has assembled the following comments to help you prepare a revised submission.

This is an interesting study providing convincing evidence for a role of Thrombospondin 4b in muscle attachment in the zebrafish embryo. As in Drosophila, Thrombospondin is required for stable muscle attachments in vertebrates. Human tsp4b RNA rescues zebrafish tsp4b morphants suggesting conservation of function. Elegant mosaic analysis shows regional rescue of muscle around Tsp4b-expressing cells. Also demonstrated clearly are effects through Tsbp4 on other integrin mediated events both inside and the cell (FAK phosphorylation and paxillin localisation) and outside the cell, laminin organisation. The manuscript has the potential to be stunning and impactful, adding to our understanding of muscle and tendon development and function in the zebrafish model, and has relevance and implications for the study of human muscle/tendon disease and injury.

In general, the work is careful and thorough, the figures are clear, and the conclusions are well supported by the data shown. However, the citation of others' work could be improved and the statistical analyses need attention before publication.

Specific comments:

1) The authors assume that Tsp4b only interacts with laminin and/or collagen binding integrins. Why is this assumption made given interactions between thrombospondins and Fibronectin? The tools exist for the authors to investigate which Integrins interact with Tsp4b. Determining mechanisms would expand the scope. If authors have a sound argument for not investigating Fn this needs to be presented in a coherent fashion.

2) There are two different phenotypes shown. One phenotype is muscle detachment. The conclusion is that “Our results suggest that Tsp4b is required to strengthen and maintain both types of attachments, but not for tenocyte formation or initial MTJ formation”. The other phenotype contradicts the above statement - there are discontinuous MTJs early in muscle development (20-24hpf). Tsp4b could play roles in both events - development of MTJ and strengthening/maintenance of attachment - but the data presented need to be clearly interpreted.

2a) Discontinuous MTJs: The authors show that Paxillin does not localize to MTJs at 20hpf, there is patchy laminin expression, and Fak phosphorylation is disrupted. The Time Axis needs to be considered. Are the initial somite boundaries forming but not being maintained? Are they not forming? Why are some muscle cells longer than others? And why is this phenotype not reflected in images shown in the beginning? This is a fundamental issue as the phenotype and conclusions drawn change throughout the manuscript. Does a lower dose lead to muscle detachment upon electrostimulation and a higher dose lead to developmental defects?

3) Lack of integration with the literature: “While the organization of the ECM at myotendinous junctions has been descripted, the developmental processes underlying its establishment and maintenance are poorly studied.” If the purpose of the manuscript is to further understand ECM establishment and maintenance at the zebrafish MTJ a logical approach would be to cogently describe what is known in the fish model. This would include that somites form, what is known about integrin signaling and matrix changes as MTJs form, what ECM proteins are known to be at the fish MTJ, phenotypes when these proteins are disrupted, and pathways that regulate their expression. While the authors are completely correct that MTJ development is not well understood, they should at least establish what is known in the field and how their results contribute. This is also true in the Discussion - multiple labs investigate ECM at these boundaries and have clearly laid out a time course and some cellular and molecular mechanisms of Fn and laminin deposition at these boundaries. Where does tsp4b fit into these pathways?

4) The conclusion that pentamerisation of Tsp4 is required for muscle-specific Itg signalling is not well supported (see comments for Figure 7 below) and this should either be toned down or strengthened by further experiment.

5) Can the authors explain their choice of mutation from KGD to KGE? Given that KGD appears to substitute for RGD, it is perhaps surprising that KGE fails to substitute for KGD, given that D and E amino acids are closely related.

6) Figures

Figure 1–figure supplement 2:The description here refers to “isolated cells”, but they look like groups of cells in the figure. Please clarify.

Figure 5 and Figure 6: It would be helpful to have the fluorescent images of the MO+RNA-injected embryos, in addition to the controls and the MO only-injected embryos (panels 5I and 6I) and to support the data in panel 5J.

Figure 7 legend: The legend for panel B should indicate that these embryos have undergone stimulation, as stated in the text.

Figure 7C is not convincing. Data for MO-only injected embryos should be shown (as for Figure 5I), and rescue should be measured against these embryos rather than uninjected controls. Significance values between the experimental and control samples on this graph are weak, indicating that, in fact, the SQAS RNA can effect a pretty reasonable rescue of both FAK and Laminin levels.

Figure 8E-H: Are these panels showing stimulated muscles, as indicated in the legend, and if so, using what voltage?

eLife. 2014 Jun 18;3:e02372. doi: 10.7554/eLife.02372.025

Author response


1) The authors assume that Tsp4b only interacts with laminin and/or collagen binding integrins. Why is this assumption made given interactions between thrombospondins and Fibronectin? The tools exist for the authors to investigate which Integrins interact with Tsp4b. Determining mechanisms would expand the scope. If authors have a sound argument for not investigating Fn this needs to be presented in a coherent fashion.

We do not intend to state that Tsp4b interacts with only laminin or collagen. Tsp interactions with different matrix proteins have been well studied. We have tried to examine Fn localization in Tsp4b deficient zebrafish embryos, using different fixation conditions (4% PFA, acid-methanol, TCA) but we have had trouble in getting available antibodies to work. We tried anti-Fibronectin (MP Biomedicals LLC, Cat No. 55066), anti-Fibronectin H300 (Santa Cruz biotechnology Cat No. SC-9068), and anti-Fibronectin (Sigma Aldrich Cat No. F3648), but all three failed to show any specific signal at the somite boundaries in wt embryos (Garavito-Aguilar et al., 2010). Previous studies have shown that rat Tsp4 interacts with laminin (Lam), fibronectin (Fn), collagens (Col), and matrillin in vitro (Narouz-Ott et al., 2000). Zebrafish somite boundaries contain Lam, Fn and Cols, which become highly localized to the boundaries in larvae older than 3 dpf.

Availability of suitable antibodies has also hampered our ability to study integrins (Itgs) in zebrafish. Among three antibodies against focal adhesion kinase (FAK) – Anti-FAK (pY397) (Cat No: 44-625G), Anti-FAK (pY576) (Cat No: 44-652G), Anti-FAK (pY861) (Cat No: 44-626G) from Invitrogen - Anti-FAK (pY861) showed specific localization to basal ends of muscle fibers at MTJs. This demonstrated that activated Itg signaling requires Tsp4b signaling (Figure 4).

In our attempt to identify Itg receptors for Tsp4b we have now examined expression and localization of two likely candidates, Itga5 and Itga6, both expressed in embryonic mesoderm (Goody et al., 2012; Lackner et al., 2013). We obtained Tg(Itga5-rfp) (gift from S Holley) and with live confocal imaging found that Itga5 localizes to the basal ends of muscles as they attach. itga5-rfp expression was modestly reduced at the membrane of Tsp4b-deficient embryos, consistent with a function as a Tsp4b receptor (Figure 4–figure supplement 2A,B). We also prepared a fusion construct of itga6-gfp from a full length cDNA clone of itga6 and injected in vitro-synthesized mRNA into wt embryos. We found that itga6-GFP localized along the entire length of muscle fibers, not just at their ends as we might imagine for a Tsp4b receptor. Itga6-GFP localization was also slightly reduced in Tsp4b-deficient embryos (Figure 4–figure supplement 2C,D). These results have been added to the manuscript. From these results, we can postulate that similar to its interactions with Lam, itga5 is a good candidate for a Tsp4b receptor.

2) There are two different phenotypes shown. One phenotype is muscle detachment. The conclusion is that “Our results suggest that Tsp4b is required to strengthen and maintain both types of attachments, but not for tenocyte formation or initial MTJ formation”. The other phenotype contradicts the above statement - there are discontinuous MTJs early in muscle development (20-24hpf). Tsp4b could play roles in both events - development of MTJ and strengthening/maintenance of attachment - but the data presented need to be clearly interpreted.

Previous studies on early development of somites have shown that the ECM at the somite boundary and MTJ undergoes dynamic changes with changing levels of Fn and increased deposition of Laminins and Collagens (Devoto et al., 1996; Henry et al., 2005). Tsp4b interacts with all these ECM components in the MTJ and as a scaffold enables organization of these ECM components enabling muscle attachment at both early and later stages of somite development. The slow muscle fibers, which develop first, initially attach through predominantly integrin dependent interactions with Fn and later as Fn levels decrease, integrin-laminin and integrin-collagen interactions play an important role in attachment. At later stages, dystrophin-dystroglycan adhesion complexes also interact with matrix components of the MTJ (Jacoby et al., 2009). Hence, the nature of muscle attachment at the MTJ varies depending on the development stage of muscle fibers and the predominant matrix component involved in the attachment. Tsp4b, as a scaffolding protein and integrin ligand is expressed from early somitogenesis through adult life and modulates the organization of the ECM at the MTJ during every stage of development from somitogenesis.

Hence, the variation in the phenotype between early and later stages of development is probably not due to a change in Tsp4b function but due to the temporal changes in ECM composition at the MTJ. We have emphasized the later role in maintenance because generally muscle attachments form normally in Tsp4b-deficient embryos, but the variable defects we see in muscle attachments and Lam localization at 24-26 hpf could indicate an earlier role. Hence, we have changed our conclusions to state that Tsp4b has a role in both muscle attachment and strengthening/maintenance of ECM at the MTJ.

2a) Discontinuous MTJs: The authors show that Paxillin does not localize to MTJs at 20hpf, there is patchy laminin expression, and Fak phosphorylation is disrupted. The Time Axis needs to be considered. Are the initial somite boundaries forming but not being maintained? Are they not forming? Why are some muscle cells longer than others? And why is this phenotype not reflected in images shown in the beginning? This is a fundamental issue as the phenotype and conclusions drawn change throughout the manuscript. Does a lower dose lead to muscle detachment upon electrostimulation and a higher dose lead to developmental defects?

Initial boundaries form and are maintained for the most part in Tsp4b-deficient embryos – an embryo lacking early Lam or Pxn localization shows a fairly normal somite boundary. Part of the problem in presentation is that MHC staining does not label the entire mediolateral extent of the somites – so not all muscle cells are shown in figures like Figure1. Similarly, mutations in Itga5 and integrin linked kinase (ilk) do not affect the formation of all somite boundaries and loc (ilk-/-) mutants muscles also form attachments initially (Koshida et al., 2005; Postel et al., 2008; Lackner et al., 2013). Apparently, the early defects we see in Lam and Pxn localization do not prevent muscles from forming attachments other than the occasional mislocalized attachment and an ectopic somite boundary. We have altered the text to clarify that Tsp4b could play roles in both MTJ development and strengthening/maintenance of attachments.

Muscle fibers that are longer than others occur at spots along the somite boundary where they extend across an entire additional somite to form an attachment with the next somite boundary. These could be at locations that lack Lam, in which case individual fibers have to either find the next boundary or form ectopic attachments with neighboring fibers as we sometimes see in Tsp4b-deficient embryos.

We performed our Tsp4b-MO injections as well as our electrostimulation assay in a dose-wise manner to determine optimal voltage (Figure 2–figure supplement 1A), and optimal concentrations of MO (Figure 2–figure supplement 1B). These chosen conditions have been used in all experiments unless stated otherwise.

3) Lack of integration with the literature: “While the organization of the ECM at myotendinous junctions has been descripted, the developmental processes underlying its establishment and maintenance are poorly studied.” If the purpose of the manuscript is to further understand ECM establishment and maintenance at the zebrafish MTJ a logical approach would be to cogently describe what is known in the fish model. This would include that somites form, what is known about integrin signaling and matrix changes as MTJs form, what ECM proteins are known to be at the fish MTJ, phenotypes when these proteins are disrupted, and pathways that regulate their expression. While the authors are completely correct that MTJ development is not well understood, they should at least establish what is known in the field and how their results contribute. This is also true in the Discussion - multiple labs investigate ECM at these boundaries and have clearly laid out a time course and some cellular and molecular mechanisms of Fn and laminin deposition at these boundaries. Where does tsp4b fit into these pathways?

We have expanded the Introduction and Discussion to add detail regarding the proteins and pathways involved in somite boundary formation and muscle attachment.

4) The conclusion that pentamerisation of Tsp4 is required for muscle-specific Itg signalling is not well supported (see comments for Figure 7 below) and this should either be toned down or strengthened by further experiment.

We have performed experiments to verify the effect of the SQAS mutation on Tsp4b structure and function. We have presented the results of this study in Figures1-3 above. A Western blot performed on protein extract from SQAS-gfp injected embryos and tsp4b-FLAG/tsp4b-gfp injected embryos conclusively shows that loss of the cysteine residues prevents Tsp4b to form pentamers. We stained Tsp4b MO-injected embryos injected with SQAS full-length mRNA with anti-Tsp4b and detected no protein at somite boundaries in contrast to Tsp4b-deficient embryos injected with full length wt tsp4b mRNA. In order to verify synthesis and secretion of the mutant protein, we made GFP fusions of wt and SQAS mRNAs. Full length tsp4b-gfp or SQAS-gfp mRNAs were co-injected with Tsp4b-MO and imaged live on a confocal microscope at several stages. Both constructs were expressed at early stages of development (tail bud) while by 36 hpf the SQAS-GFP was not localized to somite boundary – there was weak fluorescence throughout the embryo – in contrast to Tsp4b-GFP. SQAS-GFP also disrupted the localization of Tsp4b-FLAG at somite boundaries when co-injected into Tsp4b-deficient embryos. These results conclusively show that CQAC motif in the CCD is required for pentamerization of the protein, which is required for proper localization and function at the somite boundary. We have added the result as Figure 6C, Figure 6–figure supplement 1, Figure 6–figure supplement 2, Figure 6–figure supplement 3 and describe the result.

5) Can the authors explain their choice of mutation from KGD to KGE? Given that KGD appears to substitute for RGD, it is perhaps surprising that KGE fails to substitute for KGD, given that D and E amino acids are closely related.

Previous studies of RGDs in Fn and other Itg ligands have shown that mutating RGD to RGE abolishes their ability to interact with Itg and promote downstream signaling. Itg interactions with RGD but not RGE are sufficient to promote mTOR activation and S6 protein phosphorylation, which are key steps for adhesion of fibroblasts with Itg ligands (Balasubramanian and Kuppuswamy, 2003). Mutation of RGD to RGE in the P2Y2R receptor inhibits its association with Itgs (Erb et al., 2001). FNRGE/RGE mice show a phenotype similar to that of Itga5/Itgb1-deficient mice (Takahashi et al., 2007).

6) Figures

Figure 1–figure supplement 2: The description here refers to “isolated cells”, but they look like groups of cells in the figure. Please clarify.

We have replaced “isolated cells” with “groups of cells” in the figure legend.

Figure 5 and Figure 6: It would be helpful to have the fluorescent images of the MO+RNA-injected embryos, in addition to the controls and the MO only-injected embryos (panels 5I and 6I) and to support the data in panel 5J.

We have added MO+RNA images to Figure 4 and Figure 5 panels and updated the text and annotations in the legend and main text accordingly.

Figure 7 legend: The legend for panel B should indicate that these embryos have undergone stimulation, as stated in the text.

We have added the clause “upon stimulation” in the legend for Figure 7.

Figure 7C is not convincing. Data for MO-only injected embryos should be shown (as for Figure 5I), and rescue should be measured against these embryos rather than uninjected controls. Significance values between the experimental and control samples on this graph are weak, indicating that, in fact, the SQAS RNA can effect a pretty reasonable rescue of both FAK and Laminin levels.

We have included control + tsp4b-MO injected data in Figure 4N and have provided significance P-value by comparing % of detached muscles with ilk+tsp4b-MO (Figure 4N). After consulting with a statistician, we realized that our experimental outcome would require the t-tests to be conducted as “one-tailed” and on making this change to the t-test for the data in Figure 6–figure supplement 3, we obtained a significant P-value <0.05. We have made changes to the figure legend accordingly. In our analyses of Tsp4b-deficient embryos on FAK and Lam localization and subsequent rescue with full length tsp4b mRNA, we have found that the partially rescued FAK and Lam levels were not significantly different from the wt levels. In Figure 6–figure supplement 3, the rescue of Tsp4b-deficient embryos with SQAS full length RNA showed significant change in FAK and Lam levels, suggesting that the rescue was not successful.

Figure 8E-H: Are these panels showing stimulated muscles, as indicated in the legend, and if so, using what voltage?

Panels E-H in Figure 7 are embryos that have not been stimulated. Panel I shows the percentage of embryos with detachment upon stimulation. We have changed the legend to clarify these points.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Supplementary file 1.

    List of primer sequences used for qRT-PCR, cloning of mRNA and probe synthesis.

    DOI: http://dx.doi.org/10.7554/eLife.02372.023

    elife02372s001.docx (17.3KB, docx)
    DOI: 10.7554/eLife.02372.023

    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES