Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2014 Jul;196(14):2578–2586. doi: 10.1128/JB.01613-14

NtrBC and Nac Contribute to Efficient Shigella flexneri Intracellular Replication

Chelsea D Waddell a, Thomas J Walter b, Sophia A Pacheco a, Georgiana E Purdy a,✉, Laura J Runyen-Janecky b,✉
PMCID: PMC4097594  PMID: 24794563

Abstract

Shigella flexneri two-component regulatory systems (TCRS) are responsible for sensing changes in environmental conditions and regulating gene expression accordingly. We examined 12 TCRS that were previously uncharacterized for potential roles in S. flexneri growth within the eukaryotic intracellular environment. We demonstrate that the TCRS EvgSA, NtrBC, and RstBA systems are required for wild-type plaque formation in cultured epithelial cells. The phenotype of the NtrBC mutant depended in part on the Nac transcriptional regulator. Microarray analysis was performed to identify S. flexneri genes differentially regulated by the NtrBC system or Nac in the intracellular environment. This study contributes to our understanding of the transcriptional regulation necessary for Shigella to effectively adapt to the mammalian host cell.

INTRODUCTION

Shigella flexneri is a Gram-negative, facultative intracellular bacterial pathogen responsible for shigellosis or acute bacillary dysentery (1). Shigella infections are acquired via ingestion of contaminated food or water (1). After traversing the small intestine, Shigella enters the colon and penetrates the colonic epithelium via M cells associated with the colonic mucosa (2). Although Shigella is taken up by macrophage cells that underlie the M cell, the bacteria resist destruction by the macrophage and cause macrophage apoptosis (3). After gaining access to the basolateral surface, Shigella attaches to colonic epithelial cells and induces its own uptake via phagocytosis (2). Subsequently, the bacterium lyses the phagocytic vesicle and is released into the cytoplasm, where it multiplies (2). Shigella remains inside eukaryotic cells for much of its life cycle, spreading from cell to cell via actin-based motility without being exposed to the extracellular environment (2).

Careful regulation of gene expression throughout the course of an infection is necessary for bacteria to adapt successfully to the host environment and cause disease within the host. When Shigella is within the cytoplasm of the epithelial or macrophage cell, a specific subset of genes, including genes involved in nonspecific heat shock, oxidative stress, and nutrient acquisition, are upregulated (4, 5). These data suggest that Shigella is exposed to numerous stimuli within the cytoplasm of eukaryotic cells, and that the bacterium regulates its gene expression to adapt accordingly. Other studies have also shown that expression of some of these genes, such as those involved in iron and phosphate acquisition, are important for Shigella to survive, multiply, and spread normally in the intracellular environment (6–8).

To appropriately modulate gene expression in a particular environment, Shigella senses changes in environmental conditions. This process can be mediated by two-component regulatory systems (TCRS). TCRS usually consist of a membrane-located sensor kinase and a cytoplasmic transcriptional regulator (9). However, there are TCRS that have a cytoplasmic sensor kinase, such as NtrB, the sensor kinase of the NtrBC system (10). In response to an environmental signal the autophosphorylation activity of the sensor kinase changes, resulting in the transfer of a phosphoryl group to an aspartic acid residue in the transcriptional regulator, which causes a conformational change of the transcriptional regulator. This activated transcriptional regulator then binds to DNA targets and alters gene expression as a direct result of the environmental signal (9).

Several TCRS are already implicated in the regulation of virulence genes in Shigella. Deletion of the EnvZ/OmpR TCRS reduced the ability of S. flexneri to invade and survive intracellularly (11). The phenotype of this mutant was attributed to dysregulation of the chromosomally encoded porin OmpC that is required for intercellular spread and the virulence plasmid genes that are required for both invasion and intercellular spread of S. flexneri (11, 12). The TCRS CpxAR regulates expression of the Shigella virulence plasmid-encoded master regulator, VirF, in response to pH signals (13, 14). S. flexneri mutants lacking an intact PhoPQ system are more susceptible to the bactericidal capacity of polymorphonuclear leukocytes (PMNs) and antimicrobial molecules, indicating that PhoPQ also plays an important role in Shigella virulence (15).

The current study was designed to determine whether a previously unexamined set of Shigella TCRS contribute to adaptation of Shigella to the intracellular environment. Specifically, S. flexneri mutants were constructed that lacked the BaeSR, CreBC, EvgSA, NtrBC, QseCB, DcuSR, HydHG, NarLX, RcsCB, RstBA, DctR (YhiF), or YfhKA TCRS. The chosen TCRS include those implicated in resistance to environmental stresses and metabolic adaptation. BaeSR responds to bacterial cell wall envelope stress and regulates a number of genes, including those required for resistance to antibiotics and heavy metals (16–18). The zinc-responsive TCRS HydHG (or ZraSR) also plays a role in the extracytoplasmic stress response, is required for zinc tolerance in Escherichia coli, and contributes to resistance to polymyxin B in Salmonella (19, 20). EvgSA activates genes required for acid resistance and osmotic adaptation in E. coli (17). The acid response of EvgSA is mediated in part via the LuxR family regulator GadE, which coregulates the glutamate-dependent acid regulon as a heterodimer with the response regulator RcsB (21). RcsCB also responds to cell membrane stress and regulates virulence genes in Salmonella (22, 23). The QseCB TCRS is activated in response to host and bacterial signals and is required for full virulence of E. coli, Salmonella, and Francisella tularensis through regulation of virulence factors as well as metabolic genes (24–28). CreBC, DcuSR, NtrBC, NarLX, and DctR contribute to metabolic adaptations (29–31). The function of the remaining TCRS are not as clear. To determine whether these TCRS are important for Shigella adaptation to the intracellular environment, S. flexneri mutants were tested for their ability to invade and spread from cell to cell using an in vitro tissue culture model.

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth conditions.

Bacterial strains and plasmids used are listed in Table 1. E. coli strains were grown in LB broth or on L agar (Becton, Dickinson and Company) at 37°C. S. flexneri strains were grown in LB broth or on Trypticase soy broth agar (Becton, Dickinson and Company) plus 0.1% (wt/vol) Congo red dye at 37°C. For growth curves, Shigella was grown in M9 minimal medium (42 mM Na2HPO4, 24 mM KH2PO4, 9 mM NaCl, 19 mM NH4Cl, 2 mM MgSO4, 0.1 mM CaCl2) containing 0.2% (wt/vol) glucose, 2 μg/ml nicotinic acid, and 40 μM iron sulfate. Antibiotics were used at the following concentrations: 10 μg/ml chloramphenicol and 125 μg/ml carbenicillin.

TABLE 1.

Bacterial strains and plasmids

Strain or plasmid Description Source or reference
E. coli
    DH5α endA1 hsdR17 supE44 thi-1 recA1 gyrA relA1 Δ(lacZYA-argF)U169 deoR Φ80dlacΔ(lacZ)M15 35
S. flexneri
    SA100 Wild-type serotype 2a 67
    SA101 SA100 Crb−, lacks intact virulence plasmid 52
    SM100 SA100 Strr S. Seliger
    UR33 SM100 ΔbaeSR::cam This study
    UR34 SM100 ΔcreBC::cam This study
    SM1140 SM100 ΔdcuR::kan This study
    UR35 SM100 ΔevgSA::cam This study
    SM1148 SM100 ΔgadE::cam (yhiE) This study
    SM1141 SM100 ΔhydHG::cam (zraR) This study
    UR42 SM100 Δnac::cam This study
    SM1142 SM100 ΔnarXL::cam This study
    UR36 SM100 ΔntrBC::cam This study
    SM1143 SM100 ΔqseBC::cam This study
    SM1145 SM100 ΔrstA::kan This study
    SM1146 SM100 ΔyfhKA::cam This study
    SM1147 SM100 ΔyhiF::cam This study
    SM1144 SM100 ΔyojNrcsCB::cam This study
Plasmids
    pKD3 Contains chloramphenicol resistance gene 68
    pKM208 Phage lambda Red recombinase genes under the control of an inducible promoter on temp-sensitive plasmid 33
    pWKS30 Low-copy-no. cloning vector 32
    pJW1 pWKS30 carrying S. flexneri ntrBC This study
    pJW4 pWKS30 carrying dnaY promoter-nac fusion This study

Recombinant DNA and PCR methods.

Isolation and purification of DNA was performed using a DNeasy tissue kit, QIAprep spin miniprep kit, and QIAquick gel extraction kit (Qiagen, Valencia, CA), each according to the manufacturer's instructions. PCRs were done with GoTaq (Promega Corp., Madison, WI) or PfuTurbo for cloning (Stratagene, Santa Clara, CA) as indicated below.

To clone the S. flexneri ntrBC genes, a 3.2-kb ntrBC product was amplified from S. flexneri SM100 using Pfu Turbo and primers UR224 (5′ CCCCGGATCCCATCCGGTAGAGT 3′) and UR225 (5′ CCCCAAGCTTGCACTTCGCTGATAACTTTGC 3′). The ntrBC PCR product and the plasmid pWKS30 (32) were digested with the restriction enzymes BamHI and HindIII and then ligated together to produce pJW1.

To create a constitutively expressed nac gene, the S. flexneri nac gene was fused to the dnaY promoter. PCR primers UR275 (5′ CCCCGGATCCGCCATTGACTCAGCAAGGGTTGACCGTATAATTCACGCGATTGGGCCGATTCTTAAAAACCGGAGGCAAC 3′), which contained the 45-bp dnaY promoter sequence overhang and the beginning of the nac coding sequence, and UR264 (5′ CCCCAAGCTTTCGAACAAATATTTCGATGCC 3′) were used to amplify a dnaY-nac fragment from S. flexneri SM100 chromosomal DNA. Both the dnaY::nac PCR product and pWKS30 were digested with BamHI and HindIII and then ligated to produce pJW4.

Construction of mutant S. flexneri strains.

Shigella TCRS mutants were constructed using either a phage recombinase-mediated allelic exchange protocol (63) or P1 transduction. The products for allelic exchange were amplified via PCR using pKD3 as a template with primers that contained the 5′ or 3′ end of the TCRS gene as overhangs and 20 bp that corresponded to the chloramphenicol resistance gene (cam) on pKD3. Each PCR yielded a product (TCRS::cam) that contained approximately 50 bp of the beginning of the TCRS gene, a chloramphenicol resistance gene, and approximately 50 bp of the end of the TCRS gene. The TCRS::cam PCR fragment was electroporated into S. flexneri SM100 containing the temperature-sensitive plasmid pKM208 (33), which harbors the phage lambda Red recombinase genes under the control of an isopropyl β-d-1-thiogalactopyranoside (IPTG)-inducible promoter, as described previously (34). Transformants were selected on Congo red agar containing 5 to 10 μg/ml chloramphenicol. Growth of the cultures at 42°C eliminated pKM208. Mutants were verified via PCR using primers flanking the allelic exchange site. P1 transduction was used to generate rstA::kan and dcuR::kan mutants using standard methodology (35). P1 was amplified on E. coli strains JW1600-1 and JW4085-3, respectively, from the Keio collection (36) to generate a P1 stock.

Henle cell invasion and plaque assays.

Henle cells (intestine 407 cells; American Type Culture Collection, Manassas, VA) were maintained in Henle medium (minimum essential medium supplemented with 1× nonessential amino acid solution and 10% [vol/vol] fetal bovine serum [all from Invitrogen, Carlsbad, CA]) in a 5% CO2 atmosphere at 37°C. For invasion assays, confluent Henle cells were split 1:8 into 10-cm2 wells and allowed to grow for 2 days. The Henle cell invasion assays were performed essentially as described by Hale and Formal (37), with the addition of gentamicin 45 min postinvasion. To visualize the number of infected Henle cells, the cells were washed two times with phosphate-buffered saline (PBS), fixed with 3 ml of methanol for 3 min, stained with Giemsa-Wright for 30 s, and washed twice with water. The percent invasion was calculated by dividing the number of Henle cells containing bacteria by the number of Henle cells counted and multiplying by 100. At least 100 cells were enumerated for each independent experiment. Plaque assays on Henle cells were performed as described previously (38) using the modifications described by Hong et al. (39). After 3 days, plaque assays were fixed, stained, and imaged. Plaque diameter was measured using Image J software (40).

For intracellular growth assays, invasion assays were done as described above with the following modifications. Henle cells were inoculated with 1 × 108 bacteria for 30 min before gentamicin was added. At each time point after the 30-min invasion (0 and 3 days), the samples were washed 4 times with PBS, trypsinized, and resuspended in 500 μl saline. An aliquot of Henle cells was removed and stained with trypan blue in order to determine the number of Henle cells per ml. The remaining Henle cells were lysed in 0.5% (wt/vol) sodium deoxycholate (DOC), serially diluted, and plated on Congo red plates. After incubation overnight at 37°C, the number of CFU per ml was determined. A parallel set of invasion assays, using Giemsa staining as described above, was done to verify that both mutants invaded Henle cells at the wild-type rate.

RNA isolation and microarray analysis.

S. flexneri RNA was isolated from infected Henle cells using a modification of the methods described by Eriksson et al. (41). Briefly, infected Henle cells were lysed on ice for 30 min in 0.1% SDS, 1% acidic phenol, 19% ethanol in water to stabilize bacterial RNA. Cellular lysates were centrifuged, and bacterial pellets were frozen at −80°C. RNA was subsequently isolated using RNeasy columns (Qiagen). RNA was eluted in 35 μl RNase-free water and then treated with DNase (Ambion) to ensure adequate removal of genomic DNA contamination. cDNA was synthesized from RNA using the Invitrogen SuperScript double-stranded cDNA synthesis kit. Commercial E. coli microarrays were obtained from NimbleGen. cDNA labeling, array hybridization, and scanning were performed at the Institute for Bioinformatics and Evolutionary Studies, Genomic Resources Laboratory, University of Idaho, Moscow, ID, USA (http://www.ibest.uidaho.edu/cores), by following their standard operating procedures. Briefly, cDNA labeling with Cy-5 was performed using the NimbleGen labeling kit. Hybridization and washes used NimbleGen reagents and hardware before scanning with a Roche NimbleGen MS200 scanner in accordance with the protocols provided by NimbleGen.

NimbleScan software (NimbleGen, Madison, WI) was used to align a chip-specific grid to control features and extract raw intensity data for each probe and each array. Chip images were then visually checked for each array and verified not to contain any significant spatial artifacts. Raw intensity data were then read into the R statistical computing environment and checked for quality. Further, chip intensity distributions, boxplots, and hierarchical clusters were compared and checked for any unusual global patterns. Each array was then background corrected and normalized using the quantile normalization procedure, and finally each probe set was summarized using the median polish procedure as described for the robust multichip average (RMA) procedure (42–44). The median polish procedure is a robust method for summarizing all probes contained within each probe set to a single expression value for each gene that takes into account individual probe effects. Probe sets with low levels of expression variation across all samples (interquartile range [IQR] of <0.5) were removed from further analysis, reducing the overall number of statistical tests to be performed. Differential expression was then assessed using a linear model with an empirical Bayesian adjustment to the variances (45), and comparisons of interest were extracted using contrasts. The Benjamini and Hochberg (BH) method was used to control for the expected false discovery rate given multiple tests (46). Probe sets were considered statistically differentially expressed with a BH-adjusted P value of <0.05.

qRT-PCR analysis.

cDNA was prepared from 500 ng of RNA using the QuantiTect system (Qiagen) according to the manufacturer's protocol. cDNA quality and concentration were measured on a Nanodrop ND-1000 spectrophotometer and an Agilent Bioanalyzer. Quantitative reverse transcription-PCR (qRT-PCR) was performed using the SYBR premix Ex Taq II kit (TaKaRa) with 100 ng of cDNA according to the manufacturer's protocol. Samples were run in triplicate, and DNase-treated RNA was used as a negative control. Plates were sealed with ThermalSeal RT optically transparent sealing film (EXCEL Scientific). qRT-PCR was performed on a StepOnePlus instrument (Applied Biosystems) using the following protocol: initial denaturation of 95°C for 1 min; shuttle PCR (2-step PCR) of 95°C for 5 s and 60°C for 30 s for 40 cycles; and a dissociation stage of 95°C for 15 s, 60°C for 1 min, and 95°C for 15 s. Data were analyzed using StepOne software, v2.1. The fold change was calculated using the comparative threshold cycle (CT) method (47), where fold change is 2−ΔΔCT. Gene expression was normalized to the expression of the housekeeping gene rrsA. Primers for qRT-PCR are the following: rrsAF (5′ CACGATTACTAGCGATTCCGACTT 3′), rrsAR (5′ CGTCGTAGTCCGGATTGGA 3′), nacF (5′ ACAACTCTTTCACTGCCTGT 3′), nacR (5′ GAGTCTATTGCCACGCTTAC 3′), ipaBF (5′ GCCAAAATATTGACTTCCAC 3′), and ipaBR (5′ TTAGTTGGGAACTTGCATTT 3′). To determine if differences in expression were significant, Student's t test was performed on the ΔCT values from three independent experiments.

Statistical analyses.

Invasion assay and plaque assay data were statistically analyzed by Student's t test using GraphPad Prism software or analysis of variance (ANOVA) using Microsoft Excel. Differences between strains were considered significant at P < 0.05.

Microarray data accession number.

The microarray data have been deposited in the GEO database (accession number GSE49939).

RESULTS

Role of previously uncharacterized TCRS for Shigella within eukaryotic cells.

Two-component regulatory systems (TCRS) directly link environmental signals, such as those sensed by Shigella within eukaryotic cells, and gene regulation. To identify Shigella TCRS that might contribute to intracellular growth, we used the DBD transcription factor database (48), the conserved domains feature of NCBI Entrez (49), and the E. coli TCRS literature (9). Thirty-three potential TCRS were identified in S. flexneri 2457 (Table 2). Since Shigella species contain a large number of pseudogenes (50), we determined which of these potential TCRS genes were intact in all four species of Shigella using ShiBase (51). Intact TCRS contained no insertion sequences, frameshift mutations, or nonsense mutations. Our rationale for this approach was that TCRS that are conserved in all four species are more likely to be important for intracellular growth and survival of Shigella. Seventeen of the 33 potential TCRS were conserved among all four Shigella species and contained both the histidine kinase and the response regulator (Table 2). Of these seventeen, six were already studied in Shigella. We constructed 12 S. flexneri mutants for further characterization of TCRS that have not previously been examined in Shigella: BaeSR, CreBC, DcuSR, EvgSA, HydHS, NarLX, NtrBC, QseBC, RcsCB, RstBA, and YfhKA. Additionally, an S. flexneri mutant lacking YhiF (DctR) was also constructed, although the cognate sensor kinase for this response regulator is unknown. Mutants were constructed using the red recombinase system to delete the sensor kinase and the response regulator when possible. In the case of the rstA and the dcuR mutants, we were unable to obtain allelic exchange mutants using this technique. Instead, we transduced a kanamycin-marked allele of the response regulator from the respective Keio collection E. coli mutant into wild-type S. flexneri using the P1 phage.

TABLE 2.

Putative TCRS in Shigella

System Role in Shigella virulence or referenced
Intacta
    ArcB/ArcA 69
    BaeS/BaeR This study
    BarA/UvrY 70
    CpxA/CpxR 13, 14
    CreC/CreB This study
    DcuS/DcuR This study
    EnvZ/OmpR 11, 12
    EvgS/EvgA This study
    HydH/HydG (ZraS/ZraR) This study
    NarX/NarL This study
    NtrB/NtrC This study
    PhoQ/PhoP 15
    QseC/QseB This study
    RcsC, YojN/RcsBb This study
    RstB/RstA This study
    UhpB/UhpA 5
    YfhK/YfhA This study
    ?/YhiFc This study
Nonintact
    BasS/BasR basR pseudogene in Sd
    CheA/CheB Absent from Sb and Sd
    CheA/CheY Absent from Sb and Sd
    CusS/CusR Absent from Sb and Sd
    NarQ/NarP narQ pseudogene in Sf
    PhoR/PhoB Absent from Sd (8)
    TorS/TorR torS pseudogene in Sd
    YedV/YedW Absent from Sd
    ?/YhjB Absent from Sd
    ?/BglJ Pseudogene in Sd and Sb
    ?/CsgD Pseudogene in Sd and Ss
    ?/RcsA Absent from Sd
    ?/SdiA Pseudogene in Sd
    S4836/S4837 Absent from Sb, Sd, and Ss
    ?/S3212 Absent from Sb, Sd, and Ss
a

TCRS are listed as sensor kinase/response regulator. Systems are considered intact if they lack insertion sequences, frameshift mutations, and nonsense mutations in all four species of Shigella per ShiBase.

b

The gene encoding the RcsB response regulator is flanked by genes encoding the sensor kinase RcsC and a phosphorelay intermediate protein, YojN.

c

The cognate sensor kinase is unknown.

d

Abbreviations: Sb, S. boydii; Sd, S. dysenteriae; Sf, S. flexneri; Ss, S. sonnei.

To determine whether the selected TCRS-regulated genes are required for invasion, Henle invasion assays were performed with Shigella TCRS mutants and compared to the isogenic wild-type strain SM100. The invasion of Henle cells by all of the mutants was similar to the behavior of the parent strain SM100 (Table 3). As a negative control, invasion assays were performed with the avirulent strain SA101. Consistent with published reports (52), this strain did not invade Henle cells (data not shown). Since the Shigella TCRS may regulate genes important in steps after the initial cell invasion, we examined the mutants for their ability to form plaques on Henle cell monolayers. Only plaques formed by the ntrBC, evgSA, and rstA mutants were significantly smaller than those formed by SM100 (Table 3 and Fig. 1). Since EvgA regulates acid response genes in part through GadE and RcsB, we constructed an S. flexneri mutant in gadE (yhiE). Plaques formed by the gadE mutant (and yojN rcsCB mutant) were not statistically different in size from those formed by wild-type S. flexneri (Table 3).

TABLE 3.

Phenotype of S. flexneri transcriptional regulator mutants in tissue culture assays of virulence

Strain % Invasiona (means ± SD) Plaque sized (mm) (means ± SD)
SM100 (WT) 90 ± 12 0.94 ± 0.17b
baeSR 97 ± 10 0.93 ± 0.10
creBC 94 ± 7 0.83 ± 0.06
dcuR 93 ± 6 1.00 ± 0.26
evgSA 97 ± 10 0.66 ± 0.03**
hydHG (zraSR) 96 ± 5 0.92 ± 0.19
narXL 93 ± 2 0.89 ± 0.28
ntrBC 91 ± 6 0.61 ± 0.13**
qseCB 98 ± 4 1.01 ± 0.03
yojNrcsCB 93 ± 2 0.86 ± 0.16
rstA 90 ± 2 0.71 ± 0.09*
yfhKA 96 ± 4 0.87 ± 0.26
yhiF 91 ± 11 0.77 ± 0.08
gadE (yhiE) 86 ± 9 0.86 ± 0.26
nac 93 ± 4 0.80 ± 0.17*
WT + Epic 100 ± 0 0.97 ± 0.06
qseCB + Epi 96 ± 1 1.00 ± 0.09
a

Percent invasion is the percentage of Henle cells that had at least three intracellular bacteria 30 min postinfection.

b

This result reflects the cumulative data over the entire study. For statistical analysis, the plaque sizes of mutants were compared to those of the wild type in at least three independent experiments using the Student's paired t test.

c

Epi, epinephrine was added to the plaque assay at 50 μM final concentration.

d

*, The difference in plaque size between the wild-type and mutant strains was significant (P < 0.05 by Student's paired t test). **, The difference in plaque size between the wild-type and mutant strains was significant (P < 0.01 by Student's paired t test).

FIG 1.

FIG 1

S. flexneri mutants lacking ntrBC, rstA, and evgSA form small plaques in Henle cell monolayers. Confluent monolayers of Henle cells were infected with 103 bacteria per well, and the plaques were imaged after 3 days. The assay was repeated three times, and a representative image is shown.

The QseBC system responds to bacterial and host signals, such as epinephrine/norepinephrine, to regulate E. coli and Salmonella gene expression and virulence (53). We did not observe a difference in plaque diameter in the presence or absence of 50 μM epinephrine; however, the S. flexneri qseBC mutant formed 30% fewer plaques than the wild type in the presence or absence of epinephrine (Table 3 and data not shown).

NtrBC and Nac are required for wild-type replication and/or spread of Shigella within Henle cells.

Since the ntrBC mutant had the strongest phenotype in tissue culture assays for virulence, we proceeded to focus our study and characterize the ntrBC mutant further. In E. coli, NtrBC, in conjunction with sigma-54, activates transcription of the transcriptional regulator Nac (30). Thus, it is possible that in Shigella the effect of NtrBC on plaque formation could be mediated partially through Nac. To determine whether Nac is important for the survival, multiplication, or spreading of Shigella within intestinal epithelial cells, an S. flexneri Δnac mutant was constructed and plaque assays performed. The plaques formed by the Δnac mutant were significantly smaller than those formed by the wild type (Table 3). These data suggest that Nac is also required for optimal intracellular replication and/or intercellular spread.

The phenotype of the ntrBC mutant was complemented by the pJW1 plasmid carrying ntrBC under the control of its native promoter (P < 0.05 by ANOVA) (Fig. 2). To further examine the contribution of Nac to the ntrBC mutant phenotype, we constructed the plasmid pJW4, in which Nac is expressed via the constitutively active dnaY promoter. Strains containing pJW4 have Nac expression that is independent of NtrBC regulation, allowing us to uncouple the effects of NtrBC and Nac on plaque formation. Our model predicts that if any of the effects of NtrBC on plaque formation are mediated through Nac, then restoration of nac expression via pJW4 in the ntrBC mutant would increase plaque size of the mutant. The plaques formed by ntrBC/pJW4 were significantly larger than those formed by ntrBC/pWKS30, the mutant carrying the empty vector (P < 0.05 by ANOVA) (Fig. 2). Taken together, these data suggest that Nac-dependent genes are important for plaque formation.

FIG 2.

FIG 2

Plaque formation defect of the ntrBC mutant in Henle cell monolayers is due in part to Nac. Confluent Henle cell monolayers were infected with 104 bacteria per 35-mm-diameter plate. After 3 days, plates were fixed and stained, and the plaque diameter was measured. UR36 is the ntrBC mutant, pJW1 has the Shigella ntrBC genes cloned into pWKS30, and pJW4 has the Shigella nac gene cloned under the control of the constitutive dnaY promoter on pWKS30. The data presented are the means ± standard deviations from at least three experiments. Letters (a and b) denote statistically significant differences: a, UR36/pWKS30 and UR36/pJW1 are statistically different (P < 0.05 by ANOVA); b, UR36/pWKS30 and UR36/pJW4 are statistically different (P < 0.05 by ANOVA). An asterisk indicates that by using qRT-PCR, we confirmed that nac expression levels in the S. flexneri ntrBC mutant were reduced. The fold change expression of nac in the wild type versus the ntrBC mutant was 2.1 ± 0.3 (means and standard deviations from three independent experiments). Differences in expression between strains was significant (P = 0.04 by Student's t test).

NtrBC and Nac are important for wild-type growth in the intracellular environment.

There are multiple mechanisms by which the lack of ntrBC could reduce the size of the plaques formed by Shigella. The ntrBC mutant invaded epithelial cells like the wild type, suggesting that the expression of virulence plasmid genes necessary for host cell invasion and intercellular spread was not affected. To confirm that the expression of these genes was not significantly altered once the mutant established intracellular replication, we quantified the expression of a representative virulence plasmid gene, ipaB, using qRT-PCR. The fold change of ipaB expression was 1.37 ± 0.16 in the ntrBC strain relative to the wild type during Henle cell infection. Therefore, it is unlikely that the plaque size defect resulted from altered virulence gene expression. Instead, small-plaque formation could result from a metabolic defect of the ntrBC mutant. To determine whether the small plaques formed by the ntrBC mutant were caused by a growth defect, both extra- and intracellular growth assays were performed. There were no significant differences in the growth rate of wild-type SM100, the ntrBC mutant, or the nac mutant in rich LB or M9 minimal media (Fig. 3A). For intracellular growth assays, we performed plaque assays, harvested the monolayer 3 days postinfection, and plated serial dilutions (Fig. 3B). The number of intracellular ntrBC mutant bacteria increased 51-fold over the 3-day time course of the assay, whereas the number of intracellular wild-type S. flexneri cells increased 243-fold. Similarly, the nac mutant appeared to replicate slower than the wild type, increasing only 81-fold over the 3-day time course. Student's t test indicated that the replication of the ntrBC and nac mutants was significantly different from that of wild-type S. flexneri (P = 0.0001 and P = 0.002, respectively). Therefore, we propose that the ntrBC and nac mutants have a growth defect in the intracellular environment, unlike the wild-type bacteria, that reduces the size of plaque formation.

FIG 3.

FIG 3

Extra- and intracellular growth of the ntrBC and nac mutants. (A) Growth of SM100 (diamonds), the ntrBC mutant UR36 (squares), and the nac mutant UR42 (triangles) in M9 minimal media and LB broth at 37°C were measured via optical density at 650 nm (OD650). Averages and standard deviations from three independent assays are shown. (B) Confluent monolayers of Henle cells were infected with 103 bacteria per well, and the plaques were harvested 3 days after infection. The number of bacteria relative to the initial time point is shown. The assay was repeated three times, and the graph represents the means ± standard deviations from four independent assays. P = 0.002 (**) and P = 0.001 (***) by Student's t test.

Identification of the S. flexneri ntrBC and nac regulon via microarray expression analysis.

To begin to define NtrBC- and Nac-regulated genes that may be important for S. flexneri adaptation to and growth in the intracellular environment, we performed gene expression analysis on intracellular bacteria via microarrays. RNA was harvested from intracellular wild-type and ntrBC and nac mutants of S. flexneri. There were no statistically significant differences between the expression profiles of the wild-type strain and the ntrBC mutant. However, nine genes exhibited significantly different expression in the nac mutant relative to the wild type (Table 4) and included genes involved in cellular metabolism and genes whose expression was previously shown to be upregulated in intracellular S. flexneri relative to broth culture (4).

TABLE 4.

S. flexneri genes regulated by Naca

Geneb Annotationc Fold change expression in the nac mutant relative to WT P value
b1380 Fermentative d-lactate dehydrogenase, NAD dependent 0.04 6.15E−07
b1407 Predicted protein potentially involved in detoxification of methylglyoxal 0.12 0.0007
b1418 Cytochrome b561 0.16 0.0052
b1422 Putative LysR-type transcriptional regulator 0.26 0.0308
b1446 Predicted protein 0.11 0.0007
b1447 Predicted inner membrane protein 0.24 0.0371
b1450 McbR GntR-type transcriptional regulator 0.17 0.0050
b1847 Predicted protein 0.15 0.0038
b4217 Conserved protein 8.63 0.0060
a

Genes regulated >2-fold in 3 of 3 biological replicates with a P value of <0.05, sorted by locus.

b

E. coli gene designation from EcoCyc.

c

Functional annotations for the E. coli genome were obtained from EcoCyc.

DISCUSSION

TCRS allow bacteria to sense changes in environmental conditions and regulate their gene expression accordingly. Given that Shigella encounters numerous different environments during an infection, it is reasonable that TCRS are important for adapting to these different environments, and it is important to identify which TCRS warrant further study. Indeed, the Shigella CpxAR, EnvZ/PmpR, and PhoPQ TCRS have demonstrated roles in virulence (11, 13, 15). We have examined the importance of 12 previously uncharacterized TCRS in Shigella intracellular growth using tissue culture models for invasion, intracellular survival, and intercellular spread. Our results indicate that while none of the examined TCRS are absolutely essential for invading Henle epithelial cells, mutants lacking the EvgSA, NtrBC, and RstBA TCRS formed significantly smaller plaques than the wild type in Henle cell monolayers. Therefore, our data suggest that the EvgSA, NtrBC, and RstBA TCRS contribute to adaptation to the intracellular environment.

The results of this study show that the S. flexneri ntrBC mutant grows slower than the wild-type Shigella strain within Henle cells, suggesting that the NtrBC system is important for the adaptation of Shigella to the conditions present in the epithelial cell. Numerous genes that encode proteins that involved nitrogen transport, assimilation, and metabolism have been identified as regulated by NtrBC in conjunction with sigma-54 in E. coli, including glnHPQ (encoding glutamate ABC transporter) and glnA (encoding glutamine synthetase) (30). Thus, our initial working model was that the lower growth rate in cultured epithelial cells of the S. flexneri ntrBC mutant was due in part to reduced levels of these nitrogen-related functions. To define genes that were regulated by NtrBC in S. flexneri, we performed microarray analysis. Surprisingly, we did not see significant changes in gene expression between wild-type Shigella and the ntrBC mutant. The discrepancy between our microarray analysis and the published report on E. coli likely results from differences in experimental design: our study compared expression profiles of an ntrBC mutant to wild-type S. flexneri, whereas Zimmer et al. compared the expression profiles of an NtrC-overexpressing strain to an NtrC mutant (30). Since our microarray analysis indicated that there were not large, statistically significant changes in gene expression in the S. flexneri ntrBC mutant, the phenotypic defect of the ntrBC mutant is likely to be due to numerous, very small differences in gene expression that were not picked up by the array analysis but that collectively do influence intracellular growth. Furthermore, we only examined one time point for this work, so we are unable to exclude the possibility that greater differences in gene expression occur at other time points postinfection.

Our data also demonstrate that Nac contributes to intracellular survival and multiplication of Shigella organisms. The S. flexneri nac mutant formed significantly smaller plaques on Henle cells than those formed by wild-type Shigella. Furthermore, restoration of nac expression in the Shigella mutant lacking ntrBC increased the plaque size of the ntrBC mutant. In our microarray analysis, we saw significant changes in gene expression between wild-type Shigella and the nac mutant, including the genes involved in cellular respiration, such as ldhA (b1380), which encodes the NAD-dependent lactate dehydrogenase, and cybB (b1418), which encodes cytochrome b561. In E. coli, ldhA expression occurs during aerobic growth but is induced further when bacteria are grown under anaerobic conditions at acidic pH (54). Lactate dehydrogenase is expressed during S. dysenteriae in vivo infections (55), and ldhA gene expression is upregulated in S. flexneri growing in cultured epithelial cells or macrophages compared to LB controls (4). Proper expression of ldhA may be required for efficient intracellular replication, even though our experiments were not performed under anaerobic conditions. Of the remaining genes that are activated by Nac, b1407, b1447, and b1847 are also notable because their expression was upregulated 14-fold, 4-fold, and 13-fold, respectively, in intracellular S. flexneri relative to broth culture (4); thus, one potential explanation for the small-plaque phenotype of the nac mutant is that these genes are not appropriately upregulated and expressed at optimal levels. Only one gene, b4217 or ytfK, was overexpressed in the nac mutant relative to the wild type. ytfK encodes a conserved protein, and expression of this gene is activated by PhoB in E. coli (56).

The importance of NtrBC in Shigella adaptation to the intracellular environment is consistent with studies of other pathogens. Deletion of ntrC in Brucella suis reduced replication of the bacteria in spleen tissue in a mouse model of infection (57). Furthermore, NtrBC positively regulates glnA, the gene encoding glutamine synthetase. Mycobacterium tuberculosis and Salmonella enterica mutants lacking glutamine synthetase showed reduced intracellular growth (58, 59), and glnA is upregulated by Listeria monocytogenes in the intracellular environment (60). Therefore, the effects of ntrBC deletion may be mediated at least partially through decreased glnA expression.

We focused our efforts on the ntrBC TCRS, since it had the strongest phenotype, but small-plaque formation by other S. flexneri mutants may give insight into the environment encountered by the bacterium and the genes required for optimal intracellular replication and spread, and these insights may generate testable hypotheses for future studies. The S. flexneri evgSA mutant formed smaller plaques than the wild type. In E. coli, EvgA activates acid resistance response genes, including the glutamate-dependent and -independent systems (17, 61, 62). Our data suggest that EvgSA responds to something in the intracellular environment and activates one or more downstream genes that are important for efficient intercellular spread. EvgSA regulates the glutamate-dependent acid response genes gadABCXW in part through the GadE regulator (62). RcsB and GadE form a heterodimer to activate gadA transcription (21). We investigated the potential role of the RcsB/GadE heterodimer in plaque formation; however, plaques formed by the gadE mutant and the yojN rcsCB mutant were not statistically different in size from those formed by wild-type S. flexneri. These results suggest that the smaller plaques formed by the evgA mutant result from dysregulation of other genes. In the context of a natural infection, it is also possible that EvgSA contributes to Shigella virulence via the PhoPQ system. Although PhoP was dispensable for early stages of infection, including invasion and intercellular spread, the S. flexneri phoP mutant was more rapidly killed by the host immune response (15). The E. coli EvgSA and PhoPQ systems are linked through the small inner membrane protein SafA (63, 64). S. flexneri possesses a homologue of SafA, but further work is required to define the targets of EvgSA that are required for intercellular spread and to determine if activated EvgA contributes to S. flexneri virulence through PhoPQ.

The RstBA TCRS is regulated by the PhoPQ system in E. coli (65). In Salmonella, RstA is required for wild-type expression of a number of iron-responsive genes, including those that encode the Fhu, Sit, Fep, and Feo transporter systems (66). Shigella species encode multiple iron acquisition systems to counteract the iron-restricted environment of the host; specifically, S. flexneri encodes the genes for biosynthesis and transport of the siderophore aerobactin, the fhu genes encoding a ferrichrome transporter, and genes encoding the Feo and Sit transporters of ferrous iron (6). Knockout of single iron acquisition systems does not impair plaque formation, but a sit feo iuc mutant cannot grow in the absence of exogenously supplied siderophore or form plaques in epithelial cell monolayers (6). If the RstBA TCRS also activates expression of iron acquisition systems in Shigella, we postulate that the rstA mutant forms smaller plaques, because it is unable to adequately upregulate iron acquisition systems and is nutrient restricted.

We have characterized 12 TCRS and the transcriptional activators Nac and GadE for their importance to S. flexneri intracellular adaptation. None of these mutants were impaired entirely for virulence assessed as the ability to invade the host cell, replicate, and spread to adjacent cells. However, our data suggest that NtrBC, EvgSA, RstBA, and Nac play a role in metabolic adaptation of S. flexneri to the intracellular environment, since mutants lacking these systems formed small plaques in cultured Henle cell monolayers. In a natural infection, mutants lacking these systems may not be able to shift their physiology as rapidly as the wild type and would exhibit reduced fitness. The regulatory circuitry of bacteria is complex, and the interconnected levels of regulation likely are necessary for Shigella to adapt metabolically to the host cell environment.

ACKNOWLEDGMENTS

This work was supported in part by Public Health Service grant AI075330 awarded to L.R.-J. and by funding from the University of Richmond School of Arts and Sciences Gottwald Summer Fellowship to T.J.W. The Institute for Bioinformatics and Evolutionary Studies, Genomic Resources Laboratory at the University of Idaho, was supported by grants from the National Center for Research Resources (P20RR016448-10) and the National Institute of General Medical Sciences (P20GM103397-10) from the National Institutes of Health.

We thank Jay Mellies for the generous gift of P1vir phage stock.

Footnotes

Published ahead of print 2 May 2014

REFERENCES

  • 1.Niyogi SK. 2005. Shigellosis. J. Microbiol. 43:133–143 [PubMed] [Google Scholar]
  • 2.Sansonetti PJ, Egile C, Wenneras C. 2001. Shigellosis: from disease symptoms to molecular and cellular pathogenesis, p 335–385 In Groisman EA. (ed), Principles of bacterial pathogenesis. Academic Press, New York, NY [Google Scholar]
  • 3.Zychlinsky A, Prevost MC, Sansonetti PJ. 1992. Shigella flexneri induces apoptosis in infected macrophages. Nature 358:167–169. 10.1038/358167a0 [DOI] [PubMed] [Google Scholar]
  • 4.Lucchini S, Liu H, Jin Q, Hinton JCD, Yu J. 2005. Transcriptional adaptation of Shigella flexneri during infection of macrophages and epithelial cells: insights into the strategies of a cytosolic bacterial pathogen. Infect. Immun. 73:88–102. 10.1128/IAI.73.1.88-102.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Runyen-Janecky LJ, Payne SM. 2002. Identification of chromosomal Shigella flexneri genes induced by the eukaryotic intracellular environment. Infect. Immun. 70:4379–4388. 10.1128/IAI.70.8.4379-4388.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Runyen-Janecky LJ, Reeves SA, Gonzales EG, Payne SM. 2003. Contribution of the Shigella flexneri Sit, Iuc, and Feo iron acquisition systems to iron acquisition in vitro and in cultured cells. Infect. Immun. 71:1919–1928. 10.1128/IAI.71.4.1919-1928.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Runyen-Janecky L, Dazenski E, Hawkins S, Warner L. 2006. Role and regulation of the Shigella flexneri Sit and MntH systems. Infect. Immun. 74:4666–4672. 10.1128/IAI.00562-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Runyen-Janecky LJ, Boyle AM, Kizzee A, Liefer L, Payne SM. 2005. Role of the Pst system in plaque formation by the intracellular pathogen Shigella flexneri. Infect. Immun. 73:1404–1410. 10.1128/IAI.73.3.1404-1410.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Beier D, Gross R. 2006. Regulation of bacterial virulence by two-component systems. Curr. Opin. Microbiol. 9:143–152. 10.1016/j.mib.2006.01.005 [DOI] [PubMed] [Google Scholar]
  • 10.Nixon BT, Ronson CW, Ausubel FM. 1986. Two-component regulatory systems responsive to environmental stimuli share strongly conserved domains with the nitrogen assimilation regulatory genes ntrB and ntrC. Proc. Natl. Acad. Sci. U. S. A. 83:7850–7854. 10.1073/pnas.83.20.7850 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Bernardini ML, Fontaine A, Sansonetti PJ. 1990. The two-component regulatory system ompR-envZ controls the virulence of Shigella flexneri. J. Bacteriol. 172:6274–6281 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Bernardini ML, Sanna MG, Fontaine A, Sansonetti PJ. 1993. OmpC is involved in invasion of epithelial cells by Shigella flexneri. Infect. Immun. 61:3625–3635 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Nakayama SI, Watanabe H. 1998. Identification of cpxR as a positive regulator essential for expression of the Shigella sonnei virF gene. J. Bacteriol. 180:3522–3528 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Nakayama S, Watanabe H. 1995. Involvement of cpxA, a sensor of a two-component regulatory system, in the pH-dependent regulation of expression of Shigella sonnei virF gene. J. Bacteriol. 177:5062–5069 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Moss JE, Fisher PE, Vick B, Groisman EA, Zychlinsky A. 2000. The regulatory protein PhoP controls susceptibility to the host inflammatory response in Shigella flexneri. Cell. Microbiol. 2:443–452. 10.1046/j.1462-5822.2000.00065.x [DOI] [PubMed] [Google Scholar]
  • 16.Nagakubo S, Nishino K, Hirata T, Yamaguchi A. 2002. The putative response regulator BaeR stimulates multidrug resistance of Escherichia coli via a novel multidrug exporter system, MdtABC. J. Bacteriol. 184:4161–4167. 10.1128/JB.184.15.4161-4167.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Nishino K, Inazumi Y, Yamaguchi A. 2003. Global analysis of genes regulated by EvgA of the two-component regulatory system in Escherichia coli. J. Bacteriol. 185:2667–2672. 10.1128/JB.185.8.2667-2672.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Leblanc SKD, Oates CW, Raivio TL. 2011. Characterization of the induction and cellular role of the BaeSR two-component envelope stress response of Escherichia coli. J. Bacteriol. 193:3367–3375. 10.1128/JB.01534-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Appia-Ayme C, Hall A, Patrick E, Rajadurai S, Clarke TA, Rowley G. 2012. ZraP is a periplasmic molecular chaperone and a repressor of the zinc-responsive two-component regulator ZraSR. Biochem. J. 442:85–93. 10.1042/BJ20111639 [DOI] [PubMed] [Google Scholar]
  • 20.Leonhartsberger S, Huber A, Lottspeich F, Böck A. 2001. The hydH/G Genes from Escherichia coli code for a zinc and lead responsive two-component regulatory system. J. Mol. Biol. 307:93–105. 10.1006/jmbi.2000.4451 [DOI] [PubMed] [Google Scholar]
  • 21.Castanié-Cornet M-P, Cam K, Bastiat B, Cros A, Bordes P, Gutierrez C. 2010. Acid stress response in Escherichia coli: mechanism of regulation of gadA transcription by RcsB and GadE. Nucleic Acids Res. 38:3546–3554. 10.1093/nar/gkq097 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Arricau N, Hermant D, Waxin H, Ecobichon C, Duffey PS, Popoff MY. 1998. The RcsB-RcsC regulatory system of Salmonella typhi differentially modulates the expression of invasion proteins, flagellin and Vi antigen in response to osmolarity. Mol. Microbiol. 29:835–850. 10.1046/j.1365-2958.1998.00976.x [DOI] [PubMed] [Google Scholar]
  • 23.Conter A, Sturny R, Gutierrez C, Cam K. 2002. The RcsCB His-Asp phosphorelay system is essential to overcome chlorpromazine-induced stress in Escherichia coli. J. Bacteriol. 184:2850–2853. 10.1128/JB.184.10.2850-2853.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Sperandio V, Torres AG, Kaper JB. 2002. Quorum sensing Escherichia coli regulators B and C (QseBC): a novel two-component regulatory system involved in the regulation of flagella and motility by quorum sensing in E. coli. Mol. Microbiol. 43:809–821. 10.1046/j.1365-2958.2002.02803.x [DOI] [PubMed] [Google Scholar]
  • 25.Bearson BL, Bearson SMD. 2008. The role of the QseC quorum-sensing sensor kinase in colonization and norepinephrine-enhanced motility of Salmonella enterica serovar Typhimurium. Microb. Pathog. 44:271–278. 10.1016/j.micpath.2007.10.001 [DOI] [PubMed] [Google Scholar]
  • 26.Rasko DA, Moreira CG, Li DR, Reading NC, Ritchie JM, Waldor MK, Williams N, Taussig R, Wei S, Roth M, Hughes DT, Huntley JF, Fina MW, Falck JR, Sperandio V. 2008. Targeting QseC signaling and virulence for antibiotic development. Science 321:1078–1080. 10.1126/science.1160354 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Kostakioti M, Hadjifrangiskou M, Pinkner JS, Hultgren SJ. 2009. QseC-mediated dephosphorylation of QseB is required for expression of genes associated with virulence in uropathogenic Escherichia coli. Mol. Microbiol. 73:1020–1031. 10.1111/j.1365-2958.2009.06826.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Hadjifrangiskou M, Kostakioti M, Chen SL, Henderson JP, Greene SE, Hultgren SJ. 2011. A central metabolic circuit controlled by QseC in pathogenic Escherichia coli. Mol. Microbiol. 80:1516–1529. 10.1111/j.1365-2958.2011.07660.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Avison MB. 2001. Escherichia coli CreBC is a global regulator of gene expression that responds to growth in minimal media. J. Biol. Chem. 276:26955–26961. 10.1074/jbc.M011186200 [DOI] [PubMed] [Google Scholar]
  • 30.Zimmer DP, Soupene E, Lee HL, Wendisch VF, Khodursky AB, Peter BJ, Bender RA, Kustu S. 2000. Nitrogen regulatory protein C-controlled genes of Escherichia coli: scavenging as a defense against nitrogen limitation. Proc. Natl. Acad. Sci. U. S. A. 97:14674–14679. 10.1073/pnas.97.26.14674 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Hamblin MJ, Shaw JG, Kelly DJ. 1993. Sequence analysis and interposon mutagenesis of a sensor-kinase (DctS) and response-regulator (DctR) controlling synthesis of the high-affinity C4-dicarboxylate transport system in Rhodobacter capsulatus. Mol. Gen. Genet. 237:215–224 [DOI] [PubMed] [Google Scholar]
  • 32.Wang RF, Kushner SR. 1991. Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene 100:195–199. 10.1016/0378-1119(91)90366-J [DOI] [PubMed] [Google Scholar]
  • 33.Murphy KC, Campellone KG. 2003. Lambda Red-mediated recombinogenic engineering of enterohemorrhagic and enteropathogenic E. coli. BMC Mol. Biol. 4:11. 10.1186/1471-2199-4-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Runyen-Janecky L, Daugherty A, Lloyd B, Wellington C, Eskandarian H, Sagransky M. 2008. Role and regulation of iron-sulfur cluster biosynthesis genes in Shigella flexneri virulence. Infect. Immun. 76:1083–1092. 10.1128/IAI.01211-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Press, Cold Spring Harbor, NY [Google Scholar]
  • 36.Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL, Mori H. 2006. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2:2006.0008. 10.1038/msb4100050 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hale TL, Formal SB. 1981. Protein synthesis in HeLa or Henle 407 cells infected with Shigella dysenteriae 1, Shigella flexneri 2a, or Salmonella typhimurium W118. Infect. Immun. 32:137–144 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Oaks EV, Wingfield ME, Formal SB. 1985. Plaque formation by virulent Shigella flexneri. Infect. Immun. 48:124–129 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Hong M, Gleason Y, Wyckoff EE, Payne SM. 1998. Identification of two Shigella flexneri chromosomal loci involved in intercellular spreading. Infect. Immun. 66:4700–4710 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Schneider CA, Rasband WS, Eliceiri KW. 2012. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 9:671–675. 10.1038/nmeth.2089 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Eriksson S, Lucchini S, Thompson A, Rhen M, Hinton JCD. 2003. Unravelling the biology of macrophage infection by gene expression profiling of intracellular Salmonella enterica. Mol. Microbiol. 47:103–118. 10.1046/j.1365-2958.2003.03313.x [DOI] [PubMed] [Google Scholar]
  • 42.Irizarry RA, Bolstad BM, Collin F, Cope LM, Hobbs B, Speed TP. 2003. Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res. 31:e15. 10.1093/nar/gng015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Bolstad BM, Irizarry RA, Astrand M, Speed TP. 2003. A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 19:185–193. 10.1093/bioinformatics/19.2.185 [DOI] [PubMed] [Google Scholar]
  • 44.Irizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ, Scherf U, Speed TP. 2003. Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics 4:249–264. 10.1093/biostatistics/4.2.249 [DOI] [PubMed] [Google Scholar]
  • 45.Smyth GK. 2005. Limma: linear models for microarray data, p 397–420 In Bioinformatics and computational biology solutions using R and Bioconductor. Springer, New York, NY [Google Scholar]
  • 46.Benjamini Y, Hochberg Y. 1995. Controlling the false discovery rate–a practical and powerful approach to multiple testing. J. R. Stat. Soc. Ser. B Methodol. 57:289–300 [Google Scholar]
  • 47.Schmittgen TD, Livak KJ. 2008. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 3:1101–1108. 10.1038/nprot.2008.73 [DOI] [PubMed] [Google Scholar]
  • 48.Kummerfeld SK, Teichmann SA. 2006. DBD: a transcription factor prediction database. Nucleic Acids Res. 34:D74–D81. 10.1093/nar/gkj131 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Marchler-Bauer A, Anderson JB, Cherukuri PF, DeWeese-Scott C, Geer LY, Gwadz M, He S, Hurwitz DI, Jackson JD, Ke Z, Lanczycki CJ, Liebert CA, Liu C, Lu F, Marchler GH, Mullokandov M, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Yamashita RA, Yin JJ, Zhang D, Bryant SH. 2005. CDD: a Conserved Domain Database for protein classification. Nucleic Acids Res. 33:D192–D196 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Wei J, Goldberg MB, Burland V, Venkatesan MM, Deng W, Fournier G, Mayhew GF, Plunkett G, Rose DJ, Darling A, Mau B, Perna NT, Payne SM, Runyen-Janecky LJ, Zhou S, Schwartz DC, Blattner FR. 2003. Complete genome sequence and comparative genomics of Shigella flexneri serotype 2a strain 2457T. Infect. Immun. 71:2775–2786. 10.1128/IAI.71.5.2775-2786.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Yang J, Chen L, Yu J, Sun L, Jin Q. 2006. ShiBASE: an integrated database for comparative genomics of Shigella. Nucleic Acids Res. 34:D398–D401. 10.1093/nar/gkj033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Lawlor KM, Daskaleros PA, Robinson RE, Payne SM. 1987. Virulence of iron transport mutants of Shigella flexneri and utilization of host iron compounds. Infect. Immun. 55:594–599 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Kaper JB, Sperandio V. 2005. Bacterial cell-to-cell signaling in the gastrointestinal tract. Infect. Immun. 73:3197–3209. 10.1128/IAI.73.6.3197-3209.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Mat-Jan F, Alam KY, Clark DP. 1989. Mutants of Escherichia coli deficient in the fermentative lactate dehydrogenase. J. Bacteriol. 171:342–348 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Kuntumalla S, Zhang Q, Braisted JC, Fleischmann RD, Peterson SN, Donohue-Rolfe A, Tzipori S, Pieper R. 2011. In vivo versus in vitro protein abundance analysis of Shigella dysenteriae type 1 reveals changes in the expression of proteins involved in virulence, stress and energy metabolism. BMC Microbiol. 11:147. 10.1186/1471-2180-11-147 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Baek JH, Lee SY. 2006. Novel gene members in the Pho regulon of Escherichia coli. FEMS Microbiology Lett. 264:104–109. 10.1111/j.1574-6968.2006.00440.x [DOI] [PubMed] [Google Scholar]
  • 57.Dorrell N, Guigue-Talet P, Spencer S, Foulonge V, Callaghan OD, Wren BW. 1999. Investigation into the role of the response regulator NtrC in the metabolism and virulence of Brucella suis. Microb. Pathog. 27:1–11. 10.1006/mpat.1999.0278 [DOI] [PubMed] [Google Scholar]
  • 58.Tullius MV, Harth G, Horwitz MA. 2003. Glutamine synthetase GlnA1 is essential for growth of Mycobacterium tuberculosis in human THP-1 macrophages and guinea pigs. Infect. Immun. 71:3927–3936. 10.1128/IAI.71.7.3927-3936.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Klose KE, Mekalanos JJ. 1997. Simultaneous prevention of glutamine synthesis and high-affinity transport attenuates Salmonella typhimurium virulence. Infect. Immun. 65:587–596 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Joseph B, Przybilla K, Stuhler C, Schauer K, Slaghuis J, Fuchs TM, Goebel W. 2006. Identification of Listeria monocytogenes genes contributing to intracellular replication by expression profiling and mutant screening. J. Bacteriol. 188:556–568. 10.1128/JB.188.2.556-568.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Masuda N, Church GM. 2003. Regulatory network of acid resistance genes in Escherichia coli. Mol. Microbiol. 48:699–712. 10.1046/j.1365-2958.2003.03477.x [DOI] [PubMed] [Google Scholar]
  • 62.Ma Z, Masuda N, Foster JW. 2004. Characterization of EvgAS-YdeO-GadE branched regulatory circuit governing glutamate-dependent acid resistance in Escherichia coli. J. Bacteriol. 186:7378–7389. 10.1128/JB.186.21.7378-7389.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Eguchi Y, Itou J, Yamane M, Demizu R, Yamato F, Okada A, Mori H, Kato A, Utsumi R. 2007. B1500, a small membrane protein, connects the two-component systems EvgS/EvgA and PhoQ/PhoP in Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 104:18712–18717. 10.1073/pnas.0705768104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Eguchi Y, Ishii E, Hata K, Utsumi R. 2011. Regulation of acid resistance by connectors of two-component signal transduction systems in Escherichia coli. J. Bacteriol. 193:1222–1228. 10.1128/JB.01124-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Minagawa S, Ogasawara H, Kato A, Yamamoto K, Eguchi Y, Oshima T, Mori H, Ishihama A, Utsumi R. 2003. Identification and molecular characterization of the Mg2+ stimulon of Escherichia coli. J. Bacteriol. 185:3696–3702. 10.1128/JB.185.13.3696-3702.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Jeon J, Kim H, Yun J, Ryu S, Groisman EA, Shin D. 2008. RstA-promoted expression of the ferrous iron transporter FeoB under iron-replete conditions enhances Fur activity in Salmonella enterica. J. Bacteriol. 190:7326–7334. 10.1128/JB.00903-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Payne SM, Niesel DW, Peixotto SS, Lawlor KM. 1983. Expression of hydroxamate and phenolate siderophores by Shigella flexneri. J. Bacteriol. 155:949–955 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97:6640–6645. 10.1073/pnas.120163297 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Boulette ML, Payne SM. 2007. Anaerobic regulation of Shigella flexneri virulence: ArcA regulates Fur and iron acquisition genes. J. Bacteriol. 189:6957–6967. 10.1128/JB.00621-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Gore AL, Payne SM. 2010. CsrA and Cra influence Shigella flexneri pathogenesis. Infect. Immun. 78:4674–4682. 10.1128/IAI.00589-10 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES