Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2014 Jul;82(7):3023–3032. doi: 10.1128/IAI.01836-14

Identification and Characterization of a Peculiar vtx2-Converting Phage Frequently Present in Verocytotoxin-Producing Escherichia coli O157 Isolated from Human Infections

Rosangela Tozzoli a,✉, Laura Grande a, Valeria Michelacci a, Rosa Fioravanti a,*, David Gally b, Xuefang Xu b,*, Roberto La Ragione c,d, Muna Anjum c, Guanghui Wu c, Alfredo Caprioli a, Stefano Morabito a
Editor: S R Blanke
PMCID: PMC4097640  PMID: 24799627

Abstract

Certain verocytotoxin-producing Escherichia coli (VTEC) O157 phage types (PTs), such as PT8 and PT2, are associated with severe human infections, while others, such as PT21, seem to be restricted to cattle. In an attempt to delve into the mechanisms underlying such a differential distribution of PTs, we performed microarray comparison of human PT8 and animal PT21 VTEC O157 isolates. The main differences observed were in the vtx2-converting phages, with the PT21 strains bearing a phage identical to that present in the reference strain EDL933, BP933W, and all the PT8 isolates displaying lack of hybridization in some regions of the phage genome. We focused on the region spanning the gam and cII genes and developed a PCR tool to investigate the presence of PT8-like phages in a panel of VTEC O157 strains belonging to different PTs and determined that a vtx2 phage reacting with the primers deployed, which we named Φ8, was more frequent in VTEC O157 strains from human disease than in bovine strains. No differences were observed in the production of the VT2 mRNA when Φ8-positive strains were compared with VTEC O157 possessing BP933W. Nevertheless, we show that the gam-cII region of phage Φ8 might carry genetic determinants downregulating the transcription of the genes encoding the components of the type III secretion system borne on the locus of enterocyte effacement pathogenicity island.

INTRODUCTION

Verocytotoxin (VT)-producing Escherichia coli (VTEC) O157 is a zoonotic pathogen causing food-borne disease outbreaks and sporadic cases of disease worldwide (1, 2). The symptoms induced upon VTEC O157 infection include a variety of clinical manifestations, such as diarrhea, hemorrhagic colitis, and the life-threatening hemolytic-uremic syndrome (HUS). VTEC O157 can be found as a component of the intestinal microflora in numerous animal species, but domestic ruminants, especially cattle, have been identified as its main reservoir (2). The presence of VTEC O157 in the intestinal content of cattle may cause the contamination of food of bovine origin at the slaughterhouse (3, 4). Moreover, healthy cattle shed VTEC O157 in their feces, contaminating the farm environment and favoring its persistence in the herd (5–7).

Although the main vehicle of infection is contaminated food of animal origin, the dispersion of VTEC O157 in the environment, caused by its elimination with ruminants' feces, also poses a risk for humans to acquire the infection. In particular, human infection can result from exposure to contaminated water, used either for drinking or for recreational purposes, as well as from consuming vegetables grown in fields irrigated with contaminated water or fertilized with animal manure not properly matured (8, 9).

The pathogenicity of VTEC O157 relies upon the expression of at least two key virulence features: the production of verocytotoxins (VTs), also termed Shiga toxins (Stxs), encoded by genes carried by temperate bacteriophages (10), and the induction of the characteristic attaching and effacing (A/E) lesion in the intestinal mucosa of the host (11), with the latter being conferred by the presence of a pathogenicity island termed the locus of enterocyte effacement (LEE) (12). The LEE harbors genes encoding several effectors involved in the pathogenesis of infections, such as an adhesin encoded by the gene eae and termed intimin; its translocated receptor, Tir; a type III secretion system (T3SS) (13); and a number of effectors delivered directly into the host cell via the T3SS and involved in the rearrangement of the enterocyte cytoskeleton.

Investigations of outbreaks caused by VTEC O157 are largely assisted by laboratory procedures aimed at subtyping the isolates, with the purposes of identifying the clusters of cases and tracing the vehicles of infection. Phage typing is one such typing technique that is able to distinguish about 80 phage types (PTs) according to the susceptibility of VTEC O157 to infection with a panel of bacteriophages (14). Although this technique was developed more than 2 decades ago, it still remains a useful approach to characterize VTEC O157 strains. Interestingly, it has been observed that while the isolates from cattle may span a wide portion of the entire PT panel (15), the strains isolated from both outbreaks and sporadic cases of human disease usually belong to a restricted number of PTs. In particular, VTEC O157 strains isolated from human infections in Europe mainly belong to PT8 and PT2 (15–18), PT21/28 (19, 20), and PT32 (16). The uneven PT distribution between the strains isolated from human disease and the strains isolated from the animal reservoir seems to indicate that a subpopulation of VTEC O157 might have evolved that is either more virulent for the human host or better adapted to survive in the food chain. The existence of a distinct subpopulation of VTEC O157 has been demonstrated by molecular techniques (21, 22), including octamer-based genome scanning (23), single nucleotide polymorphism (SNP) analysis (24), and a lineage-specific polymorphism assay (25), supporting such a hypothesis.

In order to delve into the molecular bases underpinning this assumption, we carried out the comparative genomic analysis of VTEC O157 strains belonging to PT8, frequently isolated in Italy from cases of hemorrhagic colitis and HUS, and to PT21, which are commonly isolated from cattle but have been rarely associated with human cases.

In this paper, we show that the main genomic differences between the two groups of strains fell in the sequences of the bacteriophages carrying the vtx2 genes and that the vtx2-converting phages present in most PT8 strains, whose prototype has been termed Φ8, are significantly more frequent among VTEC O157 strains from human infections than in bovine strains, regardless of their PTs. Moreover, we gathered indications that, in phage Φ8, one of these regions may carry genetic determinants downregulating the transcription of the LEE genes encoding components of the T3SS.

MATERIALS AND METHODS

Bacterial strains.

The VTEC O157 strains isolated in Italy from different sources were part of the culture collection of the Reference Laboratory for Escherichia coli at the Istituto Superiore di Sanità. All the isolates possessed the intimin-coding eae gene (26) and produced VT, as assessed by a Vero cell cytotoxicity assay and PCR amplification of vtx genes (27). Phage typing was kindly performed at the Laboratory for Enteric Pathogens at Public Health England-Colindale, London, United Kingdom. The 20 strains belonging to PT8 and PT21 used in the microarray experiments were characterized for the presence of the enterohemolysin-coding gene and the 5′ fragment of the efa1 gene by PCR amplification with primer pairs described previously (28, 29).

The VTEC O157 strains investigated for the presence of the cro-cI region of phage Φ8 included 138 Italian strains (100 of animal origin and 38 from human cases) and 30 PT21/28 bovine isolates from the culture collections held at the Roslin Institute (Edinburgh, United Kingdom).

The E. coli O157 strains EDL933 and RIMD0509952 Sakai and E. coli K-12 MG1655 were included in the study as reference strains. The E. coli K-12 strain JM109 was used in cloning experiments.

Microarray hybridizations.

Microarray hybridizations and analysis were conducted at the Animal Health and Veterinary Laboratory Agency (AHVLA) in Weybridge, Surrey, United Kingdom. For each strain, data were compiled from two hybridizations. DNAs from each of the test strains were compared simultaneously, for gene presence or absence, to the whole genomes of the two E. coli O157 reference strains (EDL933 and RIMD0509952 Sakai) and the E. coli K-12 strain MG1655 on slides prepared in house containing about 6,000 oligonucleotides covering the complete open reading frames (ORFs) for the three control strains. Ten VTEC O157 strains belonging to PT8 and 10 strains belonging to PT21 were used in the microarray experiments. All the strains were isolated in Italy in the period 1993 to 2002. Total DNA was purified from each strain by using a genomic DNA extraction kit (Gentra Systems, USA) according to the manufacturer's instructions. Two micrograms of each test DNA was labeled using the BioPrime DNA-labeling system (InVitrogen Life Technologies, Carlsbad, CA, USA) with the Cy3 fluorophore, while a mixture at an equal concentration of the three control DNAs corresponding to a total of 2 μg was labeled with Cy5. The DNA was combined with 15 μg of random octamers, heated at 95°C for 5 min, and chilled on ice. The remaining components were added as follows: 0.12 mM dATP/GTP/TTP, 0.06 mM dCTP, and 0.01 mM Cy3- or Cy5-dCTP (final concentrations; GE Healthcare, Amersham, United Kingdom) and 40 units of the Klenow fragment of E. coli polymerase. The reaction mixture was placed at 37°C for 3 h, and the labeled DNA was purified using the Qiaquick PCR purification kit (Qiagen, Chatsworth, CA, USA) and eluted in 30 μl of water. Hybridizations were carried out for 16 to 18 h under glass coverslips in a sealed wet box at 65°C. Following hybridization, the slides were washed at room temperature for 2 min in two washing solutions (wash buffer 1, 1× SSC [1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate]-0.05× SDS; wash buffer 2, 0.06× SSC) and dried by centrifugation in conical 50-ml tubes. The hybridized slides were scanned using a GenePix 4000B microarray scanner (Axon Instruments, Inc.), and the images were analyzed with BlueFuse Software (CB2 5LD; Bluegenome, Cambridge, United Kingdom). Finally, the results were analyzed with GeneSpring software (Agilent Technologies, CA, USA), which allows integration of the image data and their correlation with the list of target genes present in the reference strains.

Long and conventional PCR amplification of vtx2-converting phage regions.

Long PCR amplifications were deployed to validate the microarray data and to investigate the presence and sizes of two regions of the vtx2 bacteriophage spanning the gam-cII and roi-s genes, respectively. The primer pairs were designed on the sequence of the vtx2 phage BP933W of the E. coli O157 reference strain EDL933 (GenBank accession no. AE005174). Primer sequences, together with their positions in the reference sequence and the expected sizes of the amplicons, are listed in Table 1. All PCRs were carried out using the TripleMaster PCR System (Eppendorf AG, Hamburg, Germany) and 200 ng of template DNA under the conditions indicated by the supplier.

TABLE 1.

Primer pairs designed in this study

Name Sequence Positionsa Size (bp) (accession no.)
Gam fwd ATACCTCTGAATCAATATCAACCTG 1338126–1338150 6,106 (AE005174)
CII rev AAAAGCACACAAGACCGAAG 1344231–1344212
Roi2 fwd GACAATGAATGAGCTGATAAATAGC 1349557–1349581 7,256 (AE005174)
S rev ATATGTCAGCAGCCCAAACA 1356813–1356794
Cro-CI up AGAGCGGCTCCGCTTATTA 4685–4667 569 (KF241843)
Cro-CI low TGAGTATTCGCCAACAGGTG 4116–4135
a

The positions refer to the accession numbers of the sequences used to deploy the primers (indicated in the size column).

A primer pair amplifying a DNA sequence internal to the gam-cII region (cro-cI) specific for the vtx2 phage from the VTEC O157 PT8 strain ED257 (Table 1) was used to screen a wider collection of VTEC O157 isolates for the evaluation of the distribution of phages possessing such a region.

Determination of VTEC O157 lineages by LSPA-6 analysis.

Lineage-specific polymorphism assay 6 (LSPA-6) was conducted using primers and multiplex PCR conditions described by Yang et al. (22). The primers were labeled with 6-carboxyfluorescein (FAM) or hexachloroflorescein (Hex) and after amplification, the reactions were diluted 1:20 in distilled water. The fragments were separated by capillary electrophoresis using an Applied Biosystems 3130 Genetic Analyzer (Life Technologies, Grand Island, NY, USA) with a DS-30 matrix and carboxy-X-rhodamine (ROX)-labeled GeneFlo 625 (Chimerix, Milwaukee, WI, USA) as a size standard. Fragment sizes were assigned by using GeneMapper software v4.1 (Life Technologies, Grand Island, NY, USA), and the LSPA-6 alleles were determined on the basis of the respective reference sizes reported by Yang at al. (22). The isolates were grouped into lineages on the basis of the genotypes obtained according to the following definitions: strains possessing LSPA-6 genotype 111111 were classified as lineage I (LI) and isolates showing a 211111 profile as lineage I/II (LI/II), while all other allele combinations were classified as lineage II (LII) (30).

Cloning and sequencing of long PCR fragments.

Long PCR fragments obtained for either the gam-cII or roi-s region were purified from the agarose gel with the Wizard SV Gel and PCR Clean-Up System (Promega Corporation, Madison, WI, USA) and cloned in pGEM-T Easy (Promega Corporation, Madison, WI, USA) under the conditions described in the user's manual supplied. Plasmid DNA was purified from E. coli K-12 JM109 using the FastPlasmid minikit (Eppendorf AG, Hamburg, Germany), and 1 μg was digested overnight with 20 U of EcoRI, NotI, and PstI restriction endonucleases to test the size of the cloned fragment.

Large-scale plasmid preparation was performed by using a Qiagen plasmid midikit (Qiagen, Chatsworth, CA, USA). The sequencing reactions were outsourced to the Sequencing Service Primm s.r.l., Milan, Italy. The DNA sequences obtained were compared with those present in the NCBI GenBank using the BLAST algorithm (31).

Bacteriophage induction and vtx2 gene expression analysis.

The 20 VTEC O157 strains used in the microarray experiments were grown to the exponential phase and treated with mitomycin C (0,5 μg/ml) to induce the bacteriophages. One milliliter of each bacterial culture was collected at different times after the phage induction: 0 min (not induced), 30 min, 1 h, 2 h, 3 h, and 4 h. Total RNA was extracted from 500 μl of bacterial cultures with an RNeasy minikit (Qiagen, Chatsworth, CA, USA).

DNase treatment of the RNA samples was done with the gDNA Wipeout 7× (Qiagen, Chatsworth, CA, USA), and cDNAs were prepared with QuantiTect reverse transcription (Qiagen, Chatsworth, CA, USA) using the conditions indicated by the suppliers. Ten nanograms of cDNA was used in real-time PCR experiments.

Primers and probes targeting the vtx2 gene used in this study have been described previously (32). The lacZ gene real-time PCR amplification was conducted using primers and probes previously described (33) simultaneously with vtx2 in order to normalize the fluorescence signals.

Analysis of T3SS-secreted proteins.

Bacterial strains were cultured overnight in LB broth at 37°C with vigorous shaking. The cultures were diluted 1:100 in minimal essential medium (MEM)-HEPES (supplemented with 0.1% glucose, 25 mM sodium bicarbonate, and 0.25 μM ferric nitrate), grown to a final optical density at 600 nm (OD600) of 0.5, and centrifuged at 4,000 × g for 15 min at 4°C. The supernatants were eventually filtered through 0.45-μm low-protein-binding filters (Millipore). The secreted proteins were precipitated using 10% (vol/vol) trichloroacetic acid (TCA) (Sigma-Aldrich) in the presence of bovine serum albumin (BSA) (4 μg/ml; New England BioLabs, United Kingdom) as the coprecipitant agent overnight at 4°C. Proteins were recovered by centrifugation at 4,000 × g for 30 min at 4°C. The protein pellets were air dried and dissolved in 1.5 M Tris-HCl, pH 8.8, buffer.

The secreted proteins were analyzed through SDS-12% PAGE and visualized by Coomassie blue staining or transferred onto a Hybond ECL nitrocellulose membrane (Amersham Biosciences) for Western blotting assays. The nitrocellulose membranes were saturated with 8% (wt/vol) skim milk powder (Oxoid) in phosphate-buffered saline (PBS) at 4°C overnight and incubated with anti-EspD monoclonal antibody (kindly provided by T. Chakraborty, University of Giessen, Giessen, Germany) diluted 1:5,000 in wash buffer (1% skim milk and 0.05% [vol/vol] polyoxyethylenesorbitan monolaurate [Tween 20] [Sigma-Aldrich] in PBS) and rabbit polyclonal anti-mouse IgG horseradish peroxidase (HRP)-conjugated antibodies (Jackson ImmunoResearch) diluted 1:500. The membranes were incubated for 2 h at room temperature (RT) on a platform shaker and washed three times for 10 min in wash buffer (1% skim milk and 0.05% Tween 20 in PBS) before and after each antibody step. For enhanced chemiluminescence (ECL) detection, membranes were incubated in 2.5 ml of ECL solution 1 mixed with 2.5 ml of ECL solution 2 (Amersham Biosciences, Glattbrugg, Switzerland) for 5 min at RT. Chemiluminescence was detected on Biomax-ML film (Kodak Industrie, Chalon sur Saon, France).

Measurement of LEE1 promoter activity.

In order to evaluate the effect of the gam-cII region of Φ8 on the regulation of the genes present in the LEE1 operon, the plasmid pAJR71, containing a construct made up of a reporter gene encoding the green fluorescent protein (GFP) under the control of the LEE1 promoter, was used (34). The E. coli K-12 strain JM109 was cotransformed with the plasmids pAJR71 and pGEM-T Easy, where the 4.9-kb gam-cII region from Φ8 or the 6.1-kb region for BP933W were cloned. Control experiments were carried out, evaluating the production of GFP in the K-12 strain JM109 containing the pAJR71 plasmid, together with pGEM-T Easy without any insert. All the strains were cultured in Dulbecco's modified Eagle's medium supplemented with 15 μg/ml chloramphenicol at 37°C overnight. Subcultures were prepared by diluting (1:40) the overnight cultures in MEM-HEPES supplemented with 0.1% glucose, 25 mM sodium bicarbonate, and 0.25 μM ferric nitrate. Each subculture was grown to an OD600 of 0.5, and 200-μl aliquots were transferred into triplicate wells of a 96-well plate. The GFP produced by each subculture was assessed by reading the plate in a Victor 3 Multilabel Plate Reader (PerkinElmer, USA). The results were normalized by assessing the GFP production in at least three separate experimental sessions.

Nucleotide sequence accession number.

The 4.9-kb gam-cII PCR fragment from the VTEC O157 PT8 strain ED257 sequence was submitted to GenBank under accession no. KF241843.

RESULTS

Microarray comparison of VTEC O157 strains belonging to PT8 and PT21.

In order to investigate at the genomic level the differential distribution of PTs, we compared human VTEC O157 strains belonging to PT8 with strains belonging to PT21 of bovine origin by DNA-DNA microarray hybridization. Ten VTEC O157 strains belonging to PT8 and 10 belonging to PT21 were subjected to comparative genomics hybridization (CGH) experiments using microarray slides containing the whole complement of open reading frames from two VTEC O157 reference strains, EDL933 and RIMD0509952 Sakai, and from the E. coli K-12 strain MG1655. The main virulence traits of the investigated strains are reported in Table 2.

TABLE 2.

Virulence characteristics of VTEC O157 strains selected for CGH experiments

Strain (phage type) Source Presencea
vtx1 vtx2 eae E-hly Efa1-5′
ED497 (PT8) Human + + + + +
ED507 (PT8) Human + + + + +
ED416 (PT8) Human + + + + +
ED421 (PT8) Human + + + + +
ED499 (PT8) Human − + + + +
ED307 (PT8) Human − + + − −
ED450 (PT8) Human + + + + +
ED472 (PT8) Human + + + + +
ED257 (PT8) Human + + + + +
ED159 (PT8) Human + + + + +
ED330 (PT21) Cattle − + + − −
ED438 (PT21) Cattle + + + + +
ED321 (PT21) Cattle + + + + +
ED207 (PT21) Cattle + + + − −
ED331 (PT21) Cattle + + + − −
ED314 (PT21) Cattle + + + − −
ED350 (PT21) Cattle − + + − −
ED326 (PT21) Cattle − + + + +
ED322 (PT21) Cattle + + + + +
ED281 (PT21) Sheep + + + + +
a

+, present; −, absent.

The CGH analysis showed that the PT8 and PT21 VTEC O157 strains investigated constituted two distinct clusters, with the exception of one PT8 (ED499) and one PT21 (ED350) strain (Fig. 1A). The analysis of the hybridization profiles showed that the main differences between the two groups of strains were in the DNA sequence of the vtx2-converting bacteriophage. In particular, the PT21 strains showed a complete pattern of hybridization with the ORFs corresponding to the vtx2 bacteriophage BP933W of the reference strain EDL933, indicating the presence of a similar vtx2 phage. On the other hand, the DNAs from PT8 strains did not hybridize with the BP933W ORFs in most of the phage genes, suggesting that, in these strains, the vtx2 genes were located in a different type of bacteriophage. Moreover, when the cluster analysis was carried out considering the patterns of hybridization with the ORFs composing the vtx2 bacteriophage only, a dendrogram coincident with that produced by considering the data from the entire genome was generated (Fig. 1B), confirming that the vtx2 phage represented the major source of variability between the two groups of strains.

FIG 1.

FIG 1

CGH analysis of microarray hybridization profiles of VTEC O157 strains. (A) Clustering of the analyzed strains produced by considering the whole ORF content. (B) Clustering of the strains obtained using only the ORFs composing the vtx2-converting bacteriophage. The dendrograms were constructed on the basis of the different intensities of the hybridization signals (from blue, negative, to red, high hybridization signal) by means of Genespring software (Agilent Technologies), using the Pearson correlation.

One of the polymorphic regions identified was that between the gam and cII genes, which is responsible for the switch between the lytic and the lysogenic cycles. The other polymorphic genes included those between roi and s, the late genes activated upon induction of the lytic cycle, including vtx. A few other regions, mainly containing phage structural genes, demonstrated absence of hybridization with respect to the BP933W sequence.

Investigation of the gam-cII and roi-s regions in PT8 and PT21 VTEC O157 strains.

Two of the nonhybridizing regions of the vtx2-converting phage of PT8 VTEC O157 strains were further characterized by using a long-range PCR approach, and the results are reported in Table 3. All the PT8 strains tested in the microarray experiments produced an amplicon 4.9 kb in length when the entire gam-cII region was amplified, with the exception of strain ED307 (Table 3). Conversely, for the same region, all the PT21 strains produced a 6.1-kb amplification product, matching the predicted size of the gam-cII phage stretch present in phage BP933W. No amplification product was obtained for strain ED350 (Table 3).

TABLE 3.

Long-range PCR analysis of the gam-cII and roi-s regions of VTEC O157 strains included in the microarray experiments

Strain Amplicon size (kb)a
gam-cII roi-s
ED497 (PT8) 4.9 Neg
ED507 (PT8) 4.9 8
ED416 (PT8) 4.9 8
ED421 (PT8) 4.9 Neg
ED499 (PT8) 4.9 8
ED307 (PT8) 8 + 3 Neg
ED450 (PT8) 4.9 8
ED472 (PT8) 4.9 Neg
ED257 (PT8) 4.9 8
ED159 (PT8) 4.9 8
ED330 (PT21) 6.1 Neg
ED438 (PT21) 6.1 7.2
ED321 (PT21) 6.1 Neg
ED207 (PT21) 6.1 7.2
ED331 (PT21) 6.1 7.2
ED314 (PT21) 6.1 7.2
ED350 (PT21) Neg Neg
ED326 (PT21) 6.1 7.2
ED322 (PT21) 6.1 + 4.9 7.2
ED281 (PT21) 6.1 + 4.9 6
a

Neg, negative.

As far as the roi-s region is concerned, 6 of the 10 PT8 strains produced an 8-kb amplicon, whereas an amplification product of 7.2 kb was obtained with 6 of the 10 PT21 strains. Again, the latter matched the expected size for the same region of the BP933W vtx2 phage. Finally, in both groups, a few strains failed to yield amplification products or had varied product sizes, although different primer combinations designed on the same gene sequences were used (data not shown). This observation suggests that major polymorphisms in the sequences of the roi and s genes were also present (Table 3).

Characterization of the gam-cII region in the vtx phage of the ED257 strain.

The region between gam and cII in lambda bacteriophages encodes several factors controlling the molecular switch between the lytic and lysogenic states of the phage, as well as other factors influencing the expression of late genes, which in the vtx2-converting phages include the genes encoding the verocytotoxins. Therefore, this region represented a good candidate for further work examining how it might influence the pathogenicity of VTEC O157 by affecting the level of vtx transcription.

The 4.9-kb gam-cII PCR fragment from one of the VTEC O157 PT8 strains (ED257) was cloned and sequenced. As expected, most of the DNA sequence showed low or no homology with the corresponding region on the BP933W phage. Conversely, a search among the sequences present in GenBank returned high homology (99%) with the sequence of the same region from the vtx2-converting phage of a VTEC O157 strain isolated during an outbreak that occurred in Japan in 1996 (35). This region was also similar to the DNA fragment comprising the gam and cII genes in the vtx1-converting phage CP933V in the VTEC O157 reference strain EDL933 (GenBank accession no. AE005174). To distinguish the vtx2 phage identified in the PT8 strain ED257, which we termed Φ8, from the CP933V-like vtx1 phage, we designed a PCR primer pair able to specifically amplify the 569-bp region between the cro and cI genes in the sequence of the vtx2 phage of strain ED257. This PCR was used to assess the presence of phages possessing the cro-cI region of Φ8 in a panel of VTEC O157 strains isolated in Italy and including 38 strains from human infections and 100 strains of animal origin. The isolates belonged to different PTs and displayed different vtx gene profiles. The results of this PCR screening (Table 4) showed the presence of a Φ8-specific cro-cI region in 81.6% of the human isolates, whereas only 60% of the animal strains were positive in the assay (P < 0,001). These results suggest that the presence of Φ8-like phages is predominant among the VTEC O157 strains causing human infections, regardless of the PTs they belong to.

TABLE 4.

Identification of Φ8-like phages in Italian VTEC O157 strains belonging to different PTs and isolated from different sources by PCR amplification of the cro-cI region

Source PT No. of strains Presencea
vtx1 vtx2 cro-cI
Humanb 1 1 − + +
2 3 − + −
2 5 − + +
4 1 + + −
4 1 − + +
8 2 − + +
8 9 + + +
14 2 − + +
14 3 + + +
20 1 − + +
21 1 − + −
32 1 − + +
34 1 − + +
43 1 − + +
49 3 − + +
54 1 − + −
56 1 − + −
21/28 1 + + +
Animals and foodsuffsc 1 2 + + −
1 1 + + +
1 2 − + +
2 2 − + +
2 11 − + −
3 1 − + +
4 1 + + −
4 1 + + +
4 2 − + +
8 1 + + −
8 1 − + −
8 1 − + +
8 12 + + +
14 10 − + +
20 2 − + −
20 2 − + +
21 3 − + −
21 6 + + −
23 2 + + +
31 3 − + −
31 4 − + +
32 1 + − −
32 1 − + +
32 1 + + −
33 1 − + −
33 2 + + −
34 1 − + −
34 7 − + +
43 1 − + −
43 1 − + +
43 1 + + +
44 1 − + +
49 2 − + +
51 1 − + −
54 5 − + +
54 1 + + +
63 1 − + +
21/28 2 − + −
a

+, present; −, absent.

b

Total no. of strains, 38; no. cro-cI positive, 31 (81.6%) (P < 0.025).

c

Total no. of strains, 100; no. cro-cI positive, 60 (60%).

The Φ8-specific PCR assay was also used to analyze 30 VTEC O157 strains isolated in the United Kingdom and belonging to PT21/28, the PTs most frequently observed among the strains isolated from human infections in that country (3, 20). In agreement with the high frequency observed among the Italian human isolates, most of the PT21/28 strains investigated (28 out of 30) were positive in the cro-cI PCR. It is noteworthy that PT21/28 VTEC O157 strains have been associated with high excretion levels from cattle (20).

Characterization of LSPA-6 genotypes of the Italian VTEC O157.

The LSPA-6 analysis of 138 VTEC O157 strains isolated in Italy showed that 66 out of the 138 Italian VTEC O157 strains (47.8%) belonged to the LI/II lineage. Interestingly, this represents an intermediate rate compared with the reported frequencies for this VTEC O157 lineage: 85% for the Australian strains (30), 16% for the VTEC O157 strains isolated in the United States (30), and 90% of the isolates from Argentina (36). Similarly, the distribution of the LI lineage among the Italian isolates was 16% versus 2% reported in a similar study involving VTEC O157 strains from Australia (30), 60% reported for the United States (30), and 4% reported for Argentina (36). The LII lineage had a higher prevalence in Italy, with 36,2% of the isolates tested, while it could be assigned to 13% of Australian isolates and 25% of the VTEC O157 strains from the United States (30). As for the relative distribution of the lineages, most of the human isolates belonged to LI/II (65%), followed by LII (26%) and LI (9%). The VTEC O157 strains isolated from animal sources belonged to similar proportions of the LI/II and LII lineages (42% and 40%, respectively), with only 18% of the isolates from LI. LSPA-6 typing showed that 91% of the human isolates belonged to lineages LI/II and LII, 85% of which were also positive in the cro-cI PCR. Interestingly, only the 68% of animal VTEC O157 isolates belonging to lineages LI/II and LII possessed a vtx2 phage with the cro-cI region of Φ8.

Analysis of vtx gene transcription.

The observed association of Φ8-like phages with VTEC O157 strains from human infections prompted us to investigate further. Since in the vtx-converting bacteriophages the vtx genes are under the control of the late gene promoter (37), the possibility that the vtx2 genes carried by Φ8-like phages might produce increased levels of VT mRNA was investigated. The transcription of such genes is boosted upon induction of the lytic cycle, when the gene N, present in the gam-cII region and encoding an antiterminator, is activated, allowing the transcription to proceed through a terminator site. This event triggers the transcription of another antiterminator, the product of the gene Q, which in turn allows the transcript to run over another termination site located upstream of the vtx genes (37). Therefore, we investigated the possibility that VTEC O157 possessing Φ8-like phages produced higher levels of VT mRNA than those with a BP933W-like vtx2 phage. Four VTEC O157 PT8 strains possessing vtx2 phages with the gam-cII region of Φ8 and four PT21 strains harboring a single BP933W-like vtx2 phage were included in the experiment. The amount of vtx2A mRNA was measured by reverse transcriptase PCR at different intervals after inducing the vtx2 phage by the addition of mitomycin C. The results of the assays showed that the amounts of vtx2A mRNA increased as the induction progressed, but no significant differences between the two groups of strains were observed (Table 5), indicating that, at least under laboratory conditions, the presence of Φ8-like phages does not enhance the production of the vtx2A mRNA.

TABLE 5.

Evaluation of vtx2 gene expression after induction with mitomycin C

Strain vtx2 phage CT valuea
Time zero 0.5 h 1 h 2 h 3 h 4 h
ED220 BP933W 21 25.9 27 19.5 16.4 13.6
ED419 BP933W 24.5 20.5 20 12.7 16 9
ED250 BP933W 23 22.5 22 15.2 13.3 11.8
ED320 BP933W 22.8 20.3 18 14 10 16
ED499 Φ8-like 25 22.5 21.3 15 17 17
ED417 Φ8-like 17 21 20 13.8 15 15
ED154 Φ8-like 25 26 22 17 14.3 14.3
ED254 Φ8-like 0 28 23.8 21 19 19
a

For each strain, the CT values of the real-time PCR amplification of the vtx2 cDNA are reported at different times after induction.

Influence of the Φ8 gam-cII region on T3SS production.

Recently, it has been shown that factors encoded on prophages can influence the regulation of the LEE (38, 39), which governs the induction of A/E lesions via the production and assembly of a complete T3SS. It has also been proposed that variations in the expression of the T3SS by E. coli O157 strains could have an impact on the colonization of the host (40). These assumptions prompted us to investigate if the presence of the Φ8 phage might influence the transcription of LEE genes in VTEC O157. The expression of T3SS components was evaluated by assessing the amount of EspD protein produced and secreted. EspD is part of, and is also secreted through, the T3SS machinery, thus representing a good marker to evaluate the level of T3SS component expression. Ten strains belonging to PT8 and 10 strains belonging to PT21, possessing the Φ8-like phages or the BP933W-like phage, respectively, were examined. Western blot analyses indicated a marked difference in the relative amounts of EspD secreted in the culture supernatants, with higher levels produced by VTEC O157 strains belonging to PT21 than by those in PT8 (Fig. 2A). This finding was in agreement with the previous observation that VTEC O157 strains belonging to PT21/28, which also harbor vtx2 phages resembling Φ8 at high frequency, secreted significantly less EspD than VTEC O157 belonging to PT32, which was used as a comparative group (38).

FIG 2.

FIG 2

Analysis of T3SS protein production. (A) Western blot analysis of EspD production in VTEC O157 strains belonging to PT8 and PT21. EDL933 was included as a control. (B) GFP assay showing LEE1 promoter activity in the E. coli K-12 strain JM109 cotransformed with either pAJR71 and pGEM-gam/cII-Φ8 or pAJR71 and pGEM-gam/cII-BP933W. The first bar corresponds to the GFP levels detected in the E. coli K-12 strain JM109 cotransformed with pAJR71 and the pGEM-T Easy empty vector. The error bars indicate standard deviations.

To evaluate if the presence of the gam-cII region of phage Φ8 could directly influence the production of EspD, we studied the effect of the cloned gam-cII region of Φ8 on the expression of the GFP gene cloned under the control of the promoter regulating the transcription of the LEE1 operon on the LEE in comparison with that exerted by the same region cloned from BP933W in an E. coli K-12 background. Since the LEE1 operon encodes the structural components of the T3SS, the system can provide information about the influence of these phage regions, if any, on the T3SS regulation mechanisms through the analysis of the level of green fluorescent protein produced. Such an experimental model showed that the 4.9-kb gam-cII region from Φ8 induced dramatic repression of the LEE1 promoter (P < 0.0001; Mann-Whitney test) compared to the effect observed when the same region from BP933W was cotransformed in strain K-12 with the LEE1-GFP construct (Fig. 2B). The latter combination did not show significant differences from the same system containing the construct LEE1-GFP in the presence of the plasmid used for cloning the phage regions but containing no inserts. This result suggests that one or more factors, encoded by genes present in the gam-cII region of the Φ8 phage, may negatively influence the transcription of the genes under the control of the LEE1 promoter.

DISCUSSION

The hypothesis that different VTEC O157 clones could be characterized by higher virulence or more efficiently transmitted to the human host has been formulated by several authors, based on molecular characterization studies showing that strains isolated from cattle and from human cases of disease often belong to different clusters (21, 23, 41, 42). Accordingly, we have observed that the VTEC O157 strains isolated in Italy from human cases of infection and from animal sources are differentially distributed within the lineages identified by the LSPA-6 assay, with the majority of the human isolates belonging to the lineages LI/II and LII. Interestingly, the Italian VTEC O157 strains were positioned differently from the isolates reported from the United States (30), Australia (30), and Argentina (36), suggesting a geographically driven clonal development.

The existence of a VTEC O157 subpopulation has also been supported by the observation that VTEC O157 strains isolated from cases of human disease usually belong to a nonrandom subset of PTs (15–20). Although the phage types are related to the susceptibility of VTEC O157 to infection with a panel of phages and may not correlate with their virulence potentials, significant differences have been reported in the distribution of the PTs among VTEC O157 isolates from human and bovine sources by different authors (15–20) and can thus be considered a good epidemiological marker for the purpose of identifying VTEC O157 subpopulations. Therefore, we based our investigation on the observation that, in Italy, about half of human infections with VTEC O157 are caused by strains of PT8, while only 1 case of infection out of the 45 cases microbiologically confirmed and reported to the Italian HUS registry in the period 1988 to 2006 was caused by a VTEC O157 strain of PT21. In order to investigate the genetic differences underlying such an uneven distribution of PTs, we carried out a comparative genomic analysis of VTEC O157 strains belonging to PT8 and PT21, which, despite its low frequency in the human isolates, is common among bovine strains.

This analysis led to the identification of a region present in the vtx2-converting phages of the human PT8 strains, whose prototype has been termed Φ8 in the VTEC O157 PT8 strain ED257, that significantly differed from its homologous region in phage BP933W, the vtx2-converting phage present in the VTEC O157 reference strain EDL933 and in the bovine PT21 Italian strains. Such a region, including the genes between gam and cII (Fig. 3), regulates the switch between the lytic and lysogenic cycles.

FIG 3.

FIG 3

Alignment of the nucleotide sequences of the gam-cII region present in the vtx2 phage from the strains EDL933 (top) and ED257 (bottom) obtained with progressive MAUVE alignment software (47). Only the names of known genes are reported. All the unnamed genes (white boxes) correspond to hypothetical protein-coding genes. The regions showing sequence similarities in the two samples are colored in gray, with the height of the colored areas corresponding to the alignment score at each position.

Since the induction of prophages carrying the vtx genes is a key event in the regulation of the vtx genes and boosts production of the VT mRNA, the polymorphism detected in this region was further investigated. Sequencing of the gam-cII fragment of phage Φ8 showed similarity with the sequence of the same region of the vtx2-converting phage harbored by the VTEC O157 strain Morioka V526, which caused a large outbreak of infections in Japan during the 1990s (35). By using a primer pair specifically targeting the cro-cI region of phage Φ8, we observed that this region is present in vtx2 phages from the large majority of VTEC O157 strains from human infections isolated in Italy regardless of their PTs (Table 4), indicating that this peculiar phage region is not a marker for PT8 strains but rather identifies a vtx2 phage, or a family of vtx2 phages, segregating with VTEC O157 that causes disease in humans. We also observed that almost all (28 out of 30) of the VTEC O157 strains belonging to PT21/28 isolated in the United Kingdom and assayed in this study harbored a vtx2-converting phage possessing the cro-cI region of Φ8, while only two of them possessed a different type of phage that was negative in the cro-cI PCR. Interestingly, VTEC O157 PT21/28 strains are commonly isolated from cases of severe human disease in the United Kingdom (19) and have also been associated with the supershedding phenotype in cattle (4). Given the strong association of Φ8-like phages with strains isolated from human illness, we hypothesized that their presence might favor the induction of disease by triggering the production of larger amounts of VT2 than the vtx2 phages commonly found in VTEC O157 strains populating the animal reservoir. However, quantification of VT2 mRNA did not show differences in the levels of expression between strains harboring vtx2 phages similar to Φ8 and strains harboring BP933W-like phages. This observation suggests that the presence of a vtx2 phage possessing the cro-cI region of phage Φ8 does not influence the virulence potential of VTEC O157 by inducing augmented levels of VTs. Therefore, the observed association of this phage with strains from human disease must have a different cause.

Besides the production of VTs, the ability to colonize the intestinal mucosa by inducing a T3SS-mediated attaching and effacing lesion is considered to be pivotal to the pathophysiology of VTEC O157-induced disease (43). The T3SS is assembled from a number of components produced by genes harbored by the LEE pathogenicity island, which also includes genes encoding the adhesin intimin and its T3SS-translocated receptor, Tir (44, 45). The production and assembly of the T3SS is finely regulated by several factors encoded by genes present either in the LEE itself or on other genomic structures, such as the one encoding the prophage regulator RgdR, located on the phage-derived O island 51 in the reference strain EDL933, whose effect on the expression of the T3SS components has been highlighted (46).

In this respect, the association of Φ8-like phages with PT21/28 VTEC O157 strains described here is noteworthy. PT21/28 VTEC strains have been shown to produce levels of EspD, an effector translocated via the T3SS, lower than those produced by the VTEC O157 reference strain EDL933 (38). Accordingly, Italian Φ8-positive PT8 strains produced smaller amounts of EspD than the PT21 strains that harbored BP933W-like phages (Fig. 2A).

Given these observations, we explored the possibility that the presence of Φ8-like phages may also control T3SS expression. Since the genes encoding the T3SS components are under the control of the LEE1 promoter in the LEE pathogenicity island (46), we measured the production of GFP by an E. coli K-12 strain containing a GFP-coding gene cloned downstream of the LEE1 promoter in the presence of the gam-cII region from Φ8 or from the BP933W phages. This approach clearly showed that the presence of the DNA region from the Φ8 phage inhibited the production of GFP while the corresponding BP933W region did not have an effect on the LEE1-controlled transcription of GFP. These results suggest that the gam-cII region of phage Φ8 contains one or more regulators influencing, directly or indirectly, the transcription of the LEE1 promoter and, consequently, T3SS expression. This finding correlates with reduced production of EspD observed in PT8 strains (Fig. 2A) and PT21/28 VTEC O157 strains, as previously described (38).

EspD is part of the T3SS translocation apparatus and is required for effector delivery into host cells (46). Therefore, altered levels of EspD are likely to have an impact on epithelial cell colonization. The differences observed in EspD production and their correlation with the presence of Φ8-like phages indicate that these phages are likely to influence VTEC O157 colonization of the gastrointestinal tract of the host.

Although the biological significance of the observed effects of the Φ8 gam-cII region on LEE1 transcription still needs to be elucidated, the high frequency of vtx2 phages displaying the presence of such a region in PT21/28 VTEC O157 strains may be of help in understanding the association of Φ8-like phages with VTEC O157 isolates from human infections. In fact PT21/28 strains are frequently isolated from supershedding cattle (4), and the finding that Φ8-like phages are common in these isolates suggests that the fine tuning of T3SS expression may play a role in establishing the supershedding status. In turn, since supershedding is important for VTEC O157 to be established and maintained in the herd and is a critical risk factor for human infections (20), the regulation of the T3SS exerted by Φ8-like vtx2 phages may cause increased exposure of humans to VTEC O157 through supershedding, eventually explaining the observed overrepresentation of Φ8 in human strains.

Further studies are needed to ascertain how the presence of the Φ8 phage in VTEC O157 contributes to colonization of the gastrointestinal tract.

Footnotes

Published ahead of print 5 May 2014

REFERENCES

  • 1.Griffin PM, Tauxe RV. 1991. The epidemiology of infections caused by Escherichia coli O157:H7, other enterohemorrhagic E. coli, and the associated hemolytic uremic syndrome. Epidemiol. Rev. 13:60–98 [DOI] [PubMed] [Google Scholar]
  • 2.Armstrong GL, Hollingsworth J, Morris JG., Jr 1996. Emerging foodborne pathogens: Escherichia coli O157:H7 as a model of entry of a new pathogen into the food supply of the developed world. Epidemiol Rev. 18:29–51. 10.1093/oxfordjournals.epirev.a017914 [DOI] [PubMed] [Google Scholar]
  • 3.Chase-Topping ME, McKendrick IJ, Pearce MC, MacDonald P, Matthews L, Halliday J, Allison L, Fenlon D, Low JC, Gunn G, Woolhouse ME. 2007. Risk factors for the presence of high-level shedders of Escherichia coli O157 on Scottish farms. J. Clin. Microbiol. 45:1594–1603. 10.1128/JCM.01690-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Chase-Topping M, Gally D, Low C, Matthews L, Woolhouse M. 2008. Super-shedding and the link between human infection and livestock carriage of Escherichia coli O157. Nat. Rev. Microbiol. 6:904–912. 10.1038/nrmicro2029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Michel P, Wilson JB, Martin SW, Clarke RC, McEwen SA, Gyles CL. 1999. Temporal and geographical distributions of reported cases of Escherichia coli O157:H7 infection in Ontario. Epidemiol. Infect. 122:193–200. 10.1017/S0950268899002083 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Low JC, McKendrick IJ, McKechnie C, Fenlon D, Naylor SW, Currie C, Smith DG, Allison L, Gally DL. 2005. Rectal carriage of enterohemorrhagic Escherichia coli O157 in slaughtered cattle. Appl. Environ. Microbiol. 71:93–97. 10.1128/AEM.71.1.93-97.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Hancock DD, Besser TE, Kinsel ML, Tarr PI, Rice DH, Paros MG. 1994. The prevalence of Escherichia coli O157.H7 in dairy and beef cattle in Washington State. Epidemiol. Infect. 113:199–207. 10.1017/S0950268800051633 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.O'Brien SJ, Adak GK, Gilham C. 2001. Contact with farming environment as a major risk factor for Shiga toxin (Vero cytotoxin)-producing Escherichia coli O157 infection in humans. Emerg. Infect. Dis. 7:1049–1051. 10.3201/eid0706.010626 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Strachan NJ, Dunn GM, Locking ME, Reid TM, Ogden ID. 2006. Escherichia coli O157: burger bug or environmental pathogen? Int. J. Food Microbiol. 112:129–137. 10.1016/j.ijfoodmicro.2006.06.021 [DOI] [PubMed] [Google Scholar]
  • 10.Huang A, Friesen J, Brunton JL. 1987. Characterization of a bacteriophage that carries the genes for production of Shiga-like toxin 1 in Escherichia coli. J. Bacteriol. 169:4308–4312 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Frankel G, Phillips AD, Rosenshine I, Dougan G, Kaper JB, Knutton S. 1998. Enteropathogenic and enterohaemorrhagic Escherichia coli: more subversive elements. Mol. Microbiol. 30:911–921. 10.1046/j.1365-2958.1998.01144.x [DOI] [PubMed] [Google Scholar]
  • 12.McDaniel TK, Jarvis KG, Donnenberg MS, Kaper JB. 1995. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc. Natl. Acad. Sci. U. S. A. 92:1664–1668. 10.1073/pnas.92.5.1664 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Delahay RM, Frankel G, Knutton S. 2001. Intimate interactions of enteropathogenic Escherichia coli at the host cell surface. Curr. Opin. Infect. Dis. 14:559–565. 10.1097/00001432-200110000-00009 [DOI] [PubMed] [Google Scholar]
  • 14.Khakhria R, Duck D, Lior H. 1990. Extended phage-typing scheme for Escherichia coli O157:H7. Epidemiol. Infect. 105:511–520. 10.1017/S0950268800048135 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Mora A, Blanco M, Blanco JE, Alonso MP, Dhabi G, Thomson-Carter F, Usera MA, Bartolome R, Prats G, Blanco J. 2004. Phage types and genotypes of Shiga toxin-producing Escherichia coli O157:H7 isolates from humans and animals in Spain: identification and characterization of two predominating phage types (PT2 and PT8). J. Clin. Microbiol. 42:4007–4015. 10.1128/JCM.42.9.4007-4015.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kappeli U, Hachler H, Giezendanner N, Cheasty T, Stephan R. 2011. Shiga toxin-producing Escherichia coli O157 associated with human infections in Switzerland, 2000–2009. Epidemiol. Infect. 139:1097–1104. 10.1017/S0950268810002190 [DOI] [PubMed] [Google Scholar]
  • 17.Stirling A, McCartney G, Ahmed S, Cowden J. 2007. An outbreak of Escherichia coli O157 phage type 2 infection in Paisley, Scotland. Euro Surveill. 12:E070823.1. [DOI] [PubMed] [Google Scholar]
  • 18.Hart J, Smith G. 2009. Verocytotoxin-producing Escherichia coli O157 outbreak in Wrexham, North Wales, July 2009. Euro Surveill. 14:19300. [PubMed] [Google Scholar]
  • 19.Locking M, Allison L, Rae L, Pollock K, Hanson M. 2006. VTEC infections and livestock-related exposures in Scotland, 2004. Euro Surveill. 11:E060223.4. [DOI] [PubMed] [Google Scholar]
  • 20.Matthews L, Reeve R, Gally DL, Low JC, Woolhouse ME, McAteer SP, Locking ME, Chase-Topping ME, Haydon DT, Allison LJ, Hanson MF, Gunn GJ, Reid SW. 2013. Predicting the public health benefit of vaccinating cattle against Escherichia coli O157. Proc. Natl. Acad. Sci. U. S. A. 110:16265–16270. 10.1073/pnas.1304978110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Dowd SE, Ishizaki H. 2006. Microarray based comparison of two Escherichia coli O157:H7 lineages. BMC Microbiol. 6:30. 10.1186/1471-2180-6-30 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Yang Z, Kovar J, Kim J, Nietfeldt J, Smith DR, Moxley RA, Olson ME, Fey PD, Benson AK. 2004. Identification of common subpopulations of non-sorbitol-fermenting, beta-glucuronidase-negative Escherichia coli O157:H7 from bovine production environments and human clinical samples. Appl. Environ. Microbiol. 70:6846–6854. 10.1128/AEM.70.11.6846-6854.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kim J, Nietfeldt J, Benson AK. 1999. Octamer-based genome scanning distinguishes a unique subpopulation of Escherichia coli O157:H7 strains in cattle. Proc. Natl. Acad. Sci. U. S. A. 96:13288–13293. 10.1073/pnas.96.23.13288 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Manning SD, Motiwala AS, Springman AC, Qi W, Lacher DW, Ouellette LM, Mladonicky JM, Somsel P, Rudrik JT, Dietrich SE, Zhang W, Swaminathan B, Alland D, Whittam TS. 2008. Variation in virulence among clades of Escherichia coli O157:H7 associated with disease outbreaks. Proc. Natl. Acad. Sci. U. S. A. 105:4868–4873. 10.1073/pnas.0710834105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.van Hoek AH, Aarts HJ, Bouw E, van Overbeek WM, Franz E. 2013. The role of rpoS in Escherichia coli O157 manure-amended soil survival and distribution of allelic variations among bovine, food and clinical isolates. FEMS Microbiol. Lett. 338:18–23. 10.1111/1574-6968.12024 [DOI] [PubMed] [Google Scholar]
  • 26.Oswald E, Schmidt H, Morabito S, Karch H, Marches O, Caprioli A. 2000. Typing of intimin genes in human and animal enterohemorrhagic and enteropathogenic Escherichia coli: characterization of a new intimin variant. Infect. Immun. 68:64–71. 10.1128/IAI.68.1.64-71.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Morabito S, Karch H, Schmidt H, Minelli F, Mariani-Kurkdjian P, Allerberger F, Bettelheim KA, Caprioli A. 1999. Molecular characterisation of verocytotoxin-producing Escherichia coli of serogroup O111 from different countries. J. Med. Microbiol. 48:891–896. 10.1099/00222615-48-10-891 [DOI] [PubMed] [Google Scholar]
  • 28.Schmidt H, Beutin L, Karch H. 1995. Molecular analysis of the plasmid-encoded hemolysin of Escherichia coli O157:H7 strain EDL 933. Infect. Immun. 63:1055–1061 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Morabito S, Tozzoli R, Oswald E, Caprioli A. 2003. A mosaic pathogenicity island made up of the locus of enterocyte effacement and a pathogenicity island of Escherichia coli O157:H7 is frequently present in attaching and effacing E. coli. Infect. Immun. 71:3343–3348. 10.1128/IAI.71.6.3343-3348.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Mellor GE, Besser TE, Davis MA, Beavis B, Jung W, Smith HV, Jennison AV, Doyle CJ, Chandry PS, Gobius KS, Fegan N. 2013. Multilocus genotype analysis of Escherichia coli O157 isolates from Australia and the United States provides evidence of geographic divergence. Appl. Environ. Microbiol. 79:5050–5058. 10.1128/AEM.01525-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Karlin S, Altschul SF. 1990. Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes. Proc. Natl. Acad. Sci. U. S. A. 87:2264–2268. 10.1073/pnas.87.6.2264 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Perelle S, Dilasser F, Grout J, Fach P. 2004. Detection by 5′-nuclease PCR of Shiga-toxin producing Escherichia coli O26, O55, O91, O103, O111, O113, O145 and O157:H7, associated with the world's most frequent clinical cases. Mol. Cell. Probes 18:185–192. 10.1016/j.mcp.2003.12.004 [DOI] [PubMed] [Google Scholar]
  • 33.Ram S, Shanker R. 2005. Computing TaqMan probes for multiplex PCR detection of E. coli O157 serotypes in water. In Silico Biol. 5:499–504 [PubMed] [Google Scholar]
  • 34.Roe AJ, Yull H, Naylor SW, Woodward MJ, Smith DG, Gally DL. 2003. Heterogeneous surface expression of EspA translocon filaments by Escherichia coli O157:H7 is controlled at the posttranscriptional level. Infect. Immun. 71:5900–5909. 10.1128/IAI.71.10.5900-5909.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Watarai M, Sato T, Kobayashi M, Shimizu T, Yamasaki S, Tobe T, Sasakawa C, Takeda Y. 1998. Identification and characterization of a newly isolated Shiga toxin 2-converting phage from Shiga toxin-producing Escherichia coli. Infect. Immun. 66:4100–4107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Mellor GE, Sim EM, Barlow RS, D'Astek BA, Galli L, Chinen I, Rivas M, Gobius KS. 2012. Phylogenetically related Argentinean and Australian Escherichia coli O157 isolates are distinguished by virulence clades and alternative Shiga toxin 1 and 2 prophages. Appl. Environ. Microbiol. 78:4724–4731. 10.1128/AEM.00365-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Wagner PL, Neely MN, Zhang X, Acheson DW, Waldor MK, Friedman DI. 2001. Role for a phage promoter in Shiga toxin 2 expression from a pathogenic Escherichia coli strain. J. Bacteriol. 183:2081–2085. 10.1128/JB.183.6.2081-2085.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Xu X, McAteer SP, Tree JJ, Shaw DJ, Wolfson EB, Beatson SA, Roe AJ, Allison LJ, Chase-Topping ME, Mahajan A, Tozzoli R, Woolhouse ME, Morabito S, Gally DL. 2012. Lysogeny with Shiga toxin 2-encoding bacteriophages represses type III secretion in enterohemorrhagic Escherichia coli. PLoS Pathog. 8:e1002672. 10.1371/journal.ppat.1002672 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Tree JJ, Roe AJ, Flockhart A, McAteer SP, Xu X, Shaw D, Mahajan A, Beatson SA, Best A, Lotz S, Woodward MJ, La Ragione R, Murphy KC, Leong JM, Gally DL. 2011. Transcriptional regulators of the GAD acid stress island are carried by effector protein-encoding prophages and indirectly control type III secretion in enterohemorrhagic Escherichia coli O157:H7. Mol. Microbiol. 80:1349–1365. 10.1111/j.1365-2958.2011.07650.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Roe AJ, Naylor SW, Spears KJ, Yull HM, Dransfield TA, Oxford M, McKendrick IJ, Porter M, Woodward MJ, Smith DG, Gally DL. 2004. Co-ordinate single-cell expression of LEE4- and LEE5-encoded proteins of Escherichia coli O157:H7. Mol. Microbiol. 54:337–352. 10.1111/j.1365-2958.2004.04277.x [DOI] [PubMed] [Google Scholar]
  • 41.Besser TE, Shaikh N, Holt NJ, Tarr PI, Konkel ME, Malik-Kale P, Walsh CW, Whittam TS, Bono JL. 2007. Greater diversity of Shiga toxin-encoding bacteriophage insertion sites among Escherichia coli O157:H7 isolates from cattle than in those from humans. Appl. Environ. Microbiol. 73:671–679. 10.1128/AEM.01035-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Pradel N, Boukhors K, Bertin Y, Forestier C, Martin C, Livrelli V. 2001. Heterogeneity of Shiga toxin-producing Escherichia coli strains isolated from hemolytic-uremic syndrome patients, cattle, and food samples in central France. Appl. Environ. Microbiol. 67:2460–2468. 10.1128/AEM.67.6.2460-2468.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Nataro JP, Kaper JB. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11:142–201 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Kenny B, DeVinney R, Stein M, Reinscheid DJ, Frey EA, Finlay BB. 1997. Enteropathogenic E. coli (EPEC) transfers its receptor for intimate adherence into mammalian cells. Cell 91:511–520. 10.1016/S0092-8674(00)80437-7 [DOI] [PubMed] [Google Scholar]
  • 45.Jerse AE, Yu J, Tall BD, Kaper JB. 1990. A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proc. Natl. Acad. Sci. U. S. A. 87:7839–7843. 10.1073/pnas.87.20.7839 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Flockhart AF, Tree JJ, Xu X, Karpiyevich M, McAteer SP, Rosenblum R, Shaw DJ, Low CJ, Best A, Gannon V, Laing C, Murphy KC, Leong JM, Schneiders T, La Ragione R, Gally DL. 2012. Identification of a novel prophage regulator in Escherichia coli controlling the expression of type III secretion. Mol. Microbiol. 83:208–223. 10.1111/j.1365-2958.2011.07927.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Darling AE, Mau B, Perna NT. 2010. progressiveMauve: multiple genome alignment with gene gain, loss and rearrangement. PLoS One 5:e11147. 10.1371/journal.pone.0011147 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES