Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2014 Jul;52(7):2674–2676. doi: 10.1128/JCM.00935-14

Real-Time Detection of HIV-2 by Reverse Transcription–Loop-Mediated Isothermal Amplification

Kelly A Curtis 1,✉, Philip L Niedzwiedz 1, Ae S Youngpairoj 1, Donna L Rudolph 1, S Michele Owen 1
Editor: A M Caliendo
PMCID: PMC4097747  PMID: 24789187

Abstract

Currently, there are no FDA-approved nucleic acid amplification tests (NAATs) for the detection or confirmation of HIV-2 infection. Here, we describe the development of a real-time assay for the detection of HIV-2 DNA and RNA using reverse transcription–loop-mediated isothermal amplification (RT-LAMP) and the ESEQuant tube scanner, a portable isothermal amplification/detection device.

TEXT

Two genetically related yet distinct viruses, human immunodeficiency virus 1 (HIV-1) and HIV-2, are the etiological agents responsible for the AIDS pandemic. In terms of HIV research, the spotlight has remained on HIV-1, since it accounts for the majority of HIV infections worldwide, and HIV-2 exhibits restricted geographic distribution and pathogenicity (1, 2). An accurate diagnosis, however, is crucial for appropriate clinical care because HIV-2 is intrinsically resistant to some nonnucleoside reverse transcriptase inhibitors and protease inhibitors used to treat HIV-1 infection (1, 3). To improve the accurate and timely diagnosis of HIV-1 and HIV-2, a new laboratory testing algorithm has been proposed by the Centers for Disease Control and Prevention (4). In the proposed algorithm, the use of a nucleic acid amplification test (NAAT) is recommended for confirming the presence of HIV nucleic acid in the case of discordant or indeterminate immunoassay test results. Presently, there are no FDA-approved nucleic acid-based tests for the detection of HIV-2.

Isothermal amplification techniques, such as loop-mediated isothermal amplification (LAMP), are promising as potential alternatives to PCR/reverse transcription–PCR (RT-PCR) because they can be performed at a single reaction temperature and enable rapid amplification of a target sequence with relatively high sensitivity and specificity (5). For RNA targets, reverse transcriptase is added to the LAMP reaction without an additional heat step (reverse transcription–loop-mediated isothermal amplification [RT-LAMP]). RT-LAMP also allows for versatility in sample type, since DNA and RNA targets can be amplified in the same single-step reaction. In the present study, we demonstrate a real-time RT-LAMP assay for the detection of DNA and RNA from groups A, B, and A/B HIV-2 using the ESEQuant tube scanner (Qiagen, Valencia, CA), a portable isothermal amplification/detection device.

To address the large degree of sequence diversity between the two major circulating groups, A and B (2), two separate sets of HIV-2 integrase-specific RT-LAMP primers (listed in Table 1) were designed using the PrimerExplorer V4 software (see http://primerexplorer.jp/e/). The HIV-2 ROD sequence (GenBank accession number M15390) was used as a reference for generating an initial primer set, and nucleotide modifications were made based on the consensus sequences for groups A and B (see http://www.hiv.lanl.gov/content/index). For endpoint detection of target-specific amplicons, a fluorescent label (hexachlorofluorescein [HEX]) was added to the 5′ end of the Loop B primer, and a quencher probe, complementary to the Loop B primer sequence, was designed with a black hole quencher (BHQ) molecule on the 3′ end, as described previously (6).

TABLE 1.

HIV-2 RT-LAMP primer sequences

Group Primer name Primer sequence (5′ to 3′)
A F3 CCTTACAATCCACAAAGCCAA
B3 ATTGTATTTCTTGTTCTGTGGTG
FIP CTGTATTTGCCTGYTCTCTAATTCTTTTTTAGTAGAAGCAATGAATCACC
BIP AGTACTAATGGCAGTTCATTGCATGTTTTGTCTTTCTGCTGGGGTCAT
Loop F ACTTATCTGATTTTTTAG
Loop B HEX-AATTTTAAAAGAAGGGGAGGA
B F3 CCCTATAACCCACAAAGTCAGa
B3 ATTGTATTTCTTGTTCTGTGGTT
FIP TTGATACTGCCTGRTCTCTGATTCTTTTTTAGTAGAAGCAATGAACCATC
BIP TGTACTAATGGCAGCTCACTGCATGTTTTGTCTTTCTGCAGGGGTCAT
Loop F GTCTATTTGATTTTTTAG
Loop B HEX-AATTTTAAAAGAAGGGGAGGA
Quencher CCTTCTTTTAAAATT-BHQ
a

Letters in bold type indicate nucleotide differences in group B primers compared to those in group A.

Ten HIV-2 primary virus isolates, characterized previously (7, 8), were used to evaluate the performance of the HIV-2 RT-LAMP assay (Table 2). Primary HIV-1 isolates of diverse group M subtypes (9, 10) were tested to determine assay specificity (Table 2). RNA extractions were performed on all virus stocks using a QIAamp viral RNA minikit according to the manufacturer's instructions.

TABLE 2.

Detection of RNA from HIV clinical isolates

HIV-2 isolate Group RT-PCR RT-LAMPa HIV-1 isolate Subtype RT-PCR RT-LAMPb
A2270 A + 15 92US657 B + −
A2267 A + 18.3 92US727 B + −
77618 A + 18.8 92US714 B + −
A1958 A + 20 93US151 B + −
GB87 A + 13.8 92RW026 A + −
GB122 A + 15.5 93MW959 C + −
60415K A + 16.3 92UG001 D + −
310072 B + 15.3 CMU02 AE + −
310319 B + 27.3 93BR029 F + −
7312A A/B + 15.8 HIV-1 G3 G + −
Median 17.3
a

Average time (minutes) to positive result of 2 separate RT-LAMP runs.

b

+, positive test result; −, negative test result.

The RT-LAMP reaction was performed using a total reaction volume of 25 μl containing 0.2 μM each F3 and B3 primers, 1.6 μM each FIP and BIP primers, 0.8 μM each Loop F and Loop B primers, 0.8 M betaine (Sigma-Aldrich, St. Louis, MO), 10 mM MgSO4, 1.4 mM deoxynucleoside triphosphates (dNTPs), 1× ThermoPol reaction buffer (New England BioLabs), 12 U Bst DNA polymerase (New England BioLabs), and 2 U avian myeloblastosis virus (AMV) reverse transcriptase (Life Technologies). The primer concentration reflected the total amount of each type of primer added, as the primer stocks were made up of a 1:1 ratio of the group A- and B-specific primers. Each reaction mixture contained 15 μl of reaction mix and 10 μl of extracted nucleic acid. For real-time detection, 1 μl of PicoGreen (Life Technologies), diluted 1:100 in TE buffer (200 mM Tris-HCl, 20 mM EDTA), was added to each reaction tube, along with 15 μl of mineral oil. The amplification reaction was carried out in an ESEQuant tube scanner for 70 min at 60°C.

Sample positivity was determined by the slope validation criteria of the instrument, where the amplification curve needed to exceed a rate of 20 mV/min for a minimum of two readings to be deemed positive. Target-specific amplification was confirmed by endpoint fluorescence of the reaction tube, as described previously (6), and by gel electrophoresis on a 3% agarose gel.

For comparison, the HIV-1/2 virus isolates were also tested by RT-PCR using primers that were designed within the HIV-2 integrase gene and cross-react with HIV-1 and simian immunodeficiency virus (SIV) sequences (8). The RT-PCR reagents and reaction conditions were described previously (11). PCR amplification of DNA from the primary HIV-2 isolates has been demonstrated (8).

All 10 primary HIV-2 isolates of groups A, B, and A/B were positive by RT-PCR and RT-LAMP (Table 2). For the real-time RT-LAMP assay, all isolates were amplified in <30 min, with a median time to positive result of 17.3 min. All HIV-1 isolates were RT-LAMP negative and RT-PCR positive (Table 2).

Given the lack of available commercial HIV-2 DNA quantitative standards, HIV-2 Pol clones were generated from the HIV-2 primary virus isolates. Amplification of the entire Pol gene from the extracted RNA and subsequent cloning of the Pol insert into TOPO TA cloning vectors (Life Technologies, Grand Island, NY) was performed as described previously (12). The resulting DNA clones were linearized with a restriction enzyme (SacI, NotI, or NcoI; New England BioLabs, Ipswich, MA) that recognizes a single restriction site within the vector and no sites within the inset. The linearized constructs were quantified using a Quant-iT PicoGreen double-stranded DNA (dsDNA) assay kit (Life Technologies), and the DNA copy numbers/ml were calculated using the formula (concentration in ng/ml × 6.022 × 1023)/(length of template in base pairs × 109 × 650). A DNA linearity panel of 106 to 102 DNA copies/ml was created by diluting each clone in RNase-free water to the specified concentrations.

All clones were detected by the real-time RT-LAMP assay at 104 DNA copies/ml, 7/10 (70%) clones were positive at 103 copies/ml, and 3/10 (30%) were positive at 102 copies/ml. The median times to a positive result for all clones ranged from 22.8 to 43.5 min, from 106 to 103 copies/ml (Table 3).

TABLE 3.

HIV-2 Pol DNA clones

Isolate Subtype RT-LAMP result at indicated number of DNA copies/mla
106 105 104 103 102
A2270 A 25.8 21.8 26.3 35 34.5b
A2267 A 31.3 36.5 54.5 — —
77618 A 22 36.8 56.3 — —
A1958 A 30 34.3 48.8 59.8 69.5
GB87 A 19.75 24 31.3 44.5 —
GB122 A 22 26 32.8 — —
60415K A 25.5 31.3 45.5 60.5 —
310072 B 20.3 22.8 26 42 31.5b
310319 B 20.8 23.3 33 42 —
7312A A/B 22.8 27.3 49.8 43.5 —
Median 22.8 27.3 39.3 43.5 34.5
a

Average time (minutes) to positive result of two separate runs. —, negative test result.

b

Only one of two replicates was positive.

We report here the detection of groups A, B, and A/B HIV-2 using a multiplexed real-time RT-LAMP assay. The low-cost portable-tube-scanner RT-LAMP assay can be applicable for NAAT testing in laboratory settings or at the point of care. As demonstrated here, the tube scanner can be used for real-time detection or, in the absence of a computer, can provide an endpoint positive or negative result to eliminate the user bias that can occur with naked-eye visual detection.

ACKNOWLEDGMENT

The findings and conclusions in this report are ours and do not necessarily represent the views of the Centers for Disease Control and Prevention.

Footnotes

Published ahead of print 30 April 2014

REFERENCES

  • 1.Campbell-Yesufu OT, Gandhi RT. 2011. Update on human immunodeficiency virus (HIV)-2 infection. Clin. Infect. Dis. 52:780–787. 10.1093/cid/ciq248 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Kannangai R, David S, Sridharan G. 2012. Human immunodeficiency virus type-2—a milder, kinder virus: an update. Indian J. Med. Microbiol. 30:6–15. 10.4103/0255-0857.93014 [DOI] [PubMed] [Google Scholar]
  • 3.Camacho RJ. 2012. Special aspects of the treatment of HIV-2-infected patients. Intervirology 55:179–183. 10.1159/000332025 [DOI] [PubMed] [Google Scholar]
  • 4.Branson BM, Stekler JD. 2012. Detection of acute HIV infection: we can't close the window. J. Infect. Dis. 205:521–524. 10.1093/infdis/jir793 [DOI] [PubMed] [Google Scholar]
  • 5.Chang CC, Chen CC, Wei SC, Lu HH, Liang YH, Lin CW. 2012. Diagnostic devices for isothermal nucleic acid amplification. Sensors (Basel) 12:8319–8337. 10.3390/s120608319 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Curtis KA, Rudolph DL, Owen SM. 2009. Sequence-specific detection method for reverse transcription, loop-mediated isothermal amplification of HIV-1. J. Med. Virol. 81:966–972. 10.1002/jmv.21490 [DOI] [PubMed] [Google Scholar]
  • 7.Owen SM, Ellenberger D, Rayfield M, Wiktor S, Michel P, Grieco MH, Gao F, Hahn BH, Lal RB. 1998. Genetically divergent strains of human immunodeficiency virus type 2 use multiple coreceptors for viral entry. J. Virol. 72:5425–5432 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Masciotra S, Yang C, Pieniazek D, Thomas C, Owen SM, McClure HM, Lal RB. 2002. Detection of simian immunodeficiency virus in diverse species and of human immunodeficiency virus type 2 by using consensus primers within the pol region. J. Clin. Microbiol. 40:3167–3171. 10.1128/JCM.40.9.3167-3171.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Pau CP, Wells SK, Rudolph DL, Owen SM, Granade TC. 2010. A rapid real-time PCR assay for the detection of HIV-1 proviral DNA using double-stranded primer. J. Virol. Methods 164:55–62. 10.1016/j.jviromet.2009.11.027 [DOI] [PubMed] [Google Scholar]
  • 10.Gao F, Robertson DL, Carruthers CD, Morrison SG, Jian B, Chen Y, Barre-Sinoussi F, Girard M, Srinivasan A, Abimiku AG, Shaw GM, Sharp PM, Hahn BH. 1998. A comprehensive panel of near-full-length clones and reference sequences for non-subtype B isolates of human immunodeficiency virus type 1. J. Virol. 72:5680–5698 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Curtis KA, Rudolph DL, Owen SM. 2008. Rapid detection of HIV-1 by reverse-transcription, loop-mediated isothermal amplification (RT-LAMP). J. Virol. Methods 151:264–270. 10.1016/j.jviromet.2008.04.011 [DOI] [PubMed] [Google Scholar]
  • 12.Youngpairoj A, Curtis K, Wells S, Pau C-P, Granade T, Owen SM. 2012. A reference panel of cloned HIV-2 plasmid DNA for nucleic acid assay development, evaluation and quality monitoring. Poster, 2012 HIV Diagnostic Conference, Atlanta, GA [DOI] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES