Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Jul 16.
Published in final edited form as: Stem Cells. 2011 Nov;29(11):1774–1782. doi: 10.1002/stem.719

Novel hematopoietic progenitor populations revealed by direct assessment of GATA1 protein expression and cMPL signaling events

Garrett C Heffner 1, Matthew R Clutter 1, Garry P Nolan 1,2, Irving L Weissman 1,3,❖
PMCID: PMC4100980  NIHMSID: NIHMS609409  PMID: 21898686

Abstract

Hematopoietic stem cells must exhibit tight regulation of both self-renewal and differentiation in order to maintain homeostasis of the hematopoietic system, as well as to avoid aberrations in growth that may result in leukemias or other disorders. In this study, we sought to understand the molecular basis of lineage determination, with particular focus on factors that influence megakaryocyte/erythrocyte-lineage commitment, in hematopoietic stem and progenitor cells. We used intracellular flow cytometry to identify two novel hematopoietic progenitor populations within the mouse bone-marrow cKit(+) Lineage (−) Sca1(+) [KLS] Flk2 (+) compartment that differ in their protein-level expression of GATA1, a critical megakaryocyte/erythrocyte-promoting transcription factor. GATA1-high repopulating cells exhibited the cell surface phenotype KLS Flk2(+ to int), CD150(int), CD105(+), cMPL(+), and were termed ‘FSE cells’. GATA1-low progenitors were identified as KLS Flk2(+), CD150(−), cMPL(−), and were termed ‘Flk(+) CD150(−) cells’. FSE cells had increased megakaryocyte/platelet potential in culture and transplant settings and exhibited a higher clonal frequency of CFU-S activity compared to Flk(+) CD150(−) cells, suggesting functional consequences of GATA1 upregulation in promoting megakaryocyte and erythroid lineage priming. Activation of ERK and AKT signal-transduction cascades was observed by intracellular flow cytometry in long-term hematopoietic stem cells (LT-HSC) and FSE cells, but not in Flk(+) CD150(−) cells in response to stimulation with thrombopoietin (TPO), an important megakaryocyte-promoting cytokine. We provide a mechanistic rationale for megakaryocyte/erythroid bias within KLS Flk2(+) cells, and demonstrate how assessment of intracellular factors and signaling events can be used to refine our understanding of lineage commitment during early definitive hematopoiesis.

Introduction

Long-term hematopoietic stem cells (LT-HSC) are unique in their capacity to self-renew and differentiate throughout the lifespan of an organism into all the numerous subpopulations of mature cells that constitute the blood system [for review see 1]. The canonical model for hematopoietic differentiation considers the multipotent progenitor (MPP) as the last common blood-cell progenitor before a branchpoint between myeloid and lymphoid fates 1. Conflicting interpretations of results have emerged regarding whether all cells prospectively isolated as MPP can generate all mature-hematopoietic lineages. Adolfsson, et al., provided evidence that, as a population and at the single-cell level, KLS Flk2(high) cells exhibited limited potential for megakaryocytes and erythroid [Meg/E] lineages (approximately 2-3% by clonal culture assays), suggesting that the Meg/E fate may be lost in most of these cells, which were defined by the authors as lymphoid-primed MPP (LMPP) 2. Consequently, such LMPP may not be truly multipotent, but instead biased in their lineage potential for lymphoid and granulocyte/macrophage fates. Forsberg, et al., reported that, as populations, both MPP and LMPP retained mixed lineage potential in vivo in transplant settings using at least 500 donor cells, and that approximately 1-2% of LMPP cells yielded erythroid cells in CFU-S assays 3. Forsberg, et al., advanced the hypothesis that either all cells defined as LMPP exhibit low-level mixed lineage potential, or there exists heterogeneity within this subpopulation, such that some cells exhibit multipotency while other cells have lost certain fate potentials. Mansson, et al., showed by single-cell RT-PCR that most KLS Flk2(high) cells did not co-express Meg/E genes with granulocyte/macrophage and lymphoid genes 4. This observation supports the hypothesis that the limited Meg/E potential in KLS Flk2(high) cells is due to the presence of a low-frequency multipotent progenitor within this subpopulation, rather than low-level Meg/E potential in all LMPP. Recent work by Akashi and colleagues 5 has also supported the conclusion that cells lacking Meg/E potential can be prospectively identified within the KLS fraction. However, the surface immunophenotype designation of which cells have such potentials within the KLS or LMPP populations, as well as an explanation for the observed heterogeneity in lineage potential among these cells, has been lacking.

Direct roles for generating the diversity of blood lineages have been demonstrated for a number of hematopoietic growth factors, intracellular proteins, and transcription factors 6, 7. A model transcription factor known to be crucial for Meg/E lineage determination is GATA1, which was discovered in 1989 as a transcription factor that seemed very specific to erythroid cells 8. GATA1 knockout mice exhibit abnormal or deficient Meg/E development 9, 10, while overexpression of GATA1 in early hematopoietic progenitors or myeloid cell lines leads to increased Meg/E development 11, 12. GATA1 is also known to be mutated in various megakaryocyte leukemias and other hematopoietic malignancies, further underscoring the importance of proper regulation of this transcription factor in normal homeostasis of the hematopoietic system 13.

Megakaryocyte lineage commitment in the hematopoietic system is known to be influenced by signal transduction events in hematopoietic stem and progenitor cells initiated by binding of thrombopoietin to its receptor cMPL 14-16. Thrombopoietin, or TPO, was identified in 1994 by a number of groups by virtue of its ability to rescue cMPL-dependent cell lines, as well as through the observation that levels of this ligand in the blood peak immediately following irradiation 17-20. The effects of TPO have been quantified at the single-cell level in hematopoietic stem cells, where it was noticed that TPO plus a survival signal – either BCL-2 or SCF/cKit interactions – were sufficient to promote megakaryocytopoiesis 21. TPO has also recently been implicated as a major factor in promoting HSC quiescence 22, 23, and other findings suggest that TPO, used in conjunction with SCF, promotes limited HSC self-renewal in culture 24. A more rigorous analysis of which cells have the capacity to respond to TPO, and the signaling pathways activated by TPO in hematopoietic stem and progenitor cells, may serve to clarify the role of TPO in early hematopoiesis.

We reasoned that cell-intrinsic functional parameters such as TPO responsiveness and GATA1 protein levels would correlate to Meg/E developmental/differentiation potential. Several multipotent progenitor populations downstream of LT-HSC have been defined, including those with increased expression of Flk2 25. We specifically hypothesized that KLS Flk2(+) cells with elevated responsiveness to TPO and/or elevated expression of GATA1 would exhibit Meg/E potential, while cells that lacked both characteristics would lack Meg/E potential. Using a novel intracellular flow-cytometry approach, we observed a novel cell population within the KLS Flk2(+) gate that expressed higher GATA1 protein levels than other early hematopoietic progenitors. In functional assays, both in culture and in vivo, GATA1-high cells exhibited more megakaryocyte and erythroid activity than KLS Flk2(+) cells expressing lower levels of GATA1. Among prospectively identified KLS subsets, LT-HSC and GATA1-high cells responded to exogenous TPO stimulation through phosphorylation of ERK, AKT, and STAT5 proteins, while GATA1-low KLS Flk2(+) cells did not respond. Taken together, the data demonstrate that within the KLS Flk2(+) population of hematopoietic progenitors there exists a gradient of GATA1 expression and responsiveness to TPO that resolves prior discrepancies in lineage mapping, and outline an approach by which other lineage decision trees might be studied vis-à-vis linkage of surface marker expression with intracellular markers at the single cell level.

Materials and Methods

Mouse strains and animal care

Eight- to twelve-week-old beta-actin GFP C57Bl/6-Thy1.1, HZ, BA, or B6/Ka, or B6/Ly5.2 mice were used as donors, and eight- to ten-week-old congenic C57/Bl6 wild type mice were used as recipients. All mice were maintained in Stanford University’s Research Animal Facility in accordance with Stanford University guidelines.

Flow Cytometry

Staining and enrichment procedures for HSC cell sorting was performed as previously described 3, 26-28. Briefly, 8 long bones were removed per mouse (tibia, femur, humerus, hip), crushed with a standard mortar and pestle, and single cell suspensions were made by triturating cells with a pipettor before passing through a 70-micron filter. Cells were then stained with lineage antibodies (CD3, CD4, CD5, CD8, B220, Mac1, Gr1) followed by anti-rat TxRPE (Caltag). Cells were then blocked with rat IgG and then stained with cKit MACS beads (Miltenyi), and positively enriched using an AutoMACS machine (Miltenyi). Cells were then stained with cKit-APCAlexa750, –PE, or – Alexa647 (eBioscience and C. Muscat), Sca1-Alexa680 or –Alexa488 (C. Muscat), and CD150-PE or –647 (Biolegend). Biotin staining was revealed with streptavidin-PECy5 (eBioscience) or qDot605 (Invitrogen). Live-dead discrimination was achieved using propidium iodide (Sigma) for live cells, or amine-reactive Alexa dyes used as live-dead markers 29. Sorting and analysis was performed on a BDFACSAria with Diva electronics (Becton Dickinson, California). Each subpopulation was double or triple sorted to ensure maximum purity.

Intracellular GATA1 staining and amplification

Briefly, kit-enriched bone marrow was stained for extracellular epitopes as described above. Marrow was then stained with a live-dead marker (see below), washed, and resuspended in 500 uL SM (PBS/2% serum) with 2% paraformaldehyde for 10 minutes at RT. Cells were then washed and resuspended in 100 uL SM plus 900 uL ice-cold ethanol, vortexed, and incubated on ice for 10 minutes. Cells were then washed twice, resuspended in 300 uL PBS/1% BSA plus 0.1% H2O2, and incubated at RT for 30 minutes. Cells were then washed twice and resuspended in an optimized concentration of GATA1 (rabbit polyclonal, Abcam) or IgG control (Upstate) in PBS/1% BSA for 30 minutes at RT. Cells were washed twice and resuspended in an optimized concentration of anti-Rabbit HRP (Zymax, Invitrogen) in PBS/1% BSA for 30 minutes at RT. Cells were then washed three times and resuspended in an optimized concentration of tyramide-Pacific Blue reagent (see below) plus 1.5 × 10(−3)% H2O2 in PBS for 5 minutes at RT. Cells were washed twice and samples were analyzed on a BDFACSAria. A dye useful for live-dead discrimination was prepared by resuspending Alexa750 dye in DMSO at a concentration of 1 mg/mL 29. An optimal titer of dye was added to cell solution for 20 minutes on ice and then washed prior to fixation and permeabilization. Tyramide-Pacific Blue was prepared through basic chemical synthesis 30, 31.

Stimulations

Cells were stained and sorted as described above. After sorting, cells were suspended in 100 uL Xvivo15 (BioWhittaker) and equilibrated at 37 degrees for 30-40 minutes. Cells were then stimulated with 10 ng/mL SCF, TPO, and IL3 (Peprotech) for 15 minutes at 37 degrees. Cells were fixed by direct addition of paraformaldehyde (Electron Microscopy Sciences) to 2% final concentration for 10 minutes at RT, then washed and permeabilized in 90% ethanol for 10 minutes on ice. Cells were then washed and subjected to fluorescent cell barcoding 32. Briefly, cells were resuspended in 500 uL of 2:1 PBS:methanol. Amine-reactive Alexa dyes were resuspended in DMSO and added to cells as serial dilutions at the following levels. Alexa488 and Pacific Blue: 0.5 micrograms per tube, then 0.167 micrograms; 0.04 micrograms; 0.01 micrograms; 0. Pacific Orange: 0.7 micrograms, then 0.233 micrograms; 0.058 micrograms; 0. Cy7: 1 microgram, then 0.33 micrograms; 0.08 micrograms; 0.02 micrograms; 0. Cells were incubated for 15 minutes at RT, then washed twice with PBS/1% BSA, pooled, and quenched in 1% H2O2 for 30 minutes at RT. For increased yield, 1×10^6 spleen cells that had been labeled with a unique fluorescent barcode signature were added to cells of interest prior to quenching, and used as carrier to better visualize cell pellets. Cells were then washed twice and resuspended in an optimized concentration of pERK1/2, pCREB, pSTAT3, or pAKT (rabbit monoclonal, Cell Signaling Technology), pSTAT1, pSTAT3, or pSTAT5 (Alexa647 conjugates, BD Bioscience) or IgG control (Upstate) in PBS/1% BSA for 30 minutes at RT. Cells were washed twice and resuspended in optimized concentrations of anti-Rabbit HRP (Zymax, Invitrogen) in PBS/1% BSA for 30 minutes at RT. Cells were then washed three times and resuspended in an optimized concentration of tyramide-Pacific Blue reagent (see above) plus 1.5 × 10(−3)% H2O2 in PBS for 5 minutes at RT. Cells were washed twice and samples were analyzed on a BDFACSAria.

In Vitro Assays

For liquid culture to assess myeloid lineage potential, cells were clone-sorted into U-bottom 96-well plates containing DMEM/F12 (Gibco), 10% Hyclone serum, Glutamax (Gibco), penicillin/streptomycin (Gibco), beta-mercapto ethanol, and the following cytokine combinations at 10 ng/mL of each cytokine: SCF + TPO + FltL + EPO + IL3; SCF + TPO; IL3 + IL6; IL3+ IL11. Cultures were scored by microscopy and, in cases of uncertainty, verified by cytospin at Days 10-12. For cultures to assess lymphoid lineage potential, OP9 and OP9-delta cells were seeded at 10,000 cells/cm2 in flat-bottom 96-well plates and cultured overnight. Media was exchanged for media containing IMDM (Gibco), 10% Hyclone AC6, beta-mercaptoethanol, Glutamax (Gibco), penicillin/streptomycin (Gibco), non-essential amino acids (Gibco), sodium pyruvate (Gibco), and 10 ng/mL each SCF + IL7 + FltL. Cells were clone-sorted into these 96-well plates and scored by microscopy and flow cytometry at Days 12-14.

In Vivo Assays

Transplantations were performed by tail vein injection of purified cells. Recipient mice were either sublethally irradiated (platelet engraftment experiments, 475 rad) or lethally irradiated (CFU-S experiments, 950 rad, delivered in split dose 3 hr apart) using an X-ray source irradiator and given acidified antibiotic-containing water for at least 6 weeks postirradiation. Peripheral blood was obtained from tail vein bleeding and collected into PBS containing 10 mM EDTA for flow cytometry analysis. 2x volumes of PBS/2% Dextran were then added and suspensions were incubated at 37 degrees for 30-45 minutes. Supernatant was transferred to a fresh tube, spun at 1200 RPM in a Beckman GS-6KR centrifuge. Supernatant was then transferred to a fresh tube for platelet analysis, and the cell pellet was processed for peripheral blood analysis. For platelet analysis, the supernatant was then spun at 1800 RPM, followed by staining with Ter119-Pacific Blue and CD150-PE. For peripheral blood analysis, the pellet was resuspended in ACK [to lyse RBC] for 5 minutes on ice, then washed and stained for Mac1-Cy5PE, Gr1-Pacific Orange, CD3-PE, Ter119-Pacific Blue, and B220-Alexa647. CFU-S assays were performed as described and spleens were fixed in Tellyesniczky’s solution to count the nodules 3.

Gene Expression Analysis

Total RNA was isolated using Trizol reagent (Invitrogen) from equivalent numbers of cells, digested with DNaseI to remove DNA contamination, and used for reverse-transcription according to manufacturers instructions (SuperScript III kit, Invitrogen). qRT-PCR primers were previously published (GATA1, GCACTCTACCCTGCCTCAAC, GCTCTTCCCTTCCTGGTCTT, 33; beta-actin, GACGGCCAAGTCATCACTATTG, AGGAAGGCTGGAAAAGAGCC, 34). All reactions were performed in an ABI-7000 sequence detection system using SYBR Green PCR Core reagents and cDNA equivalents of ~100-300 cells per reaction. Expression of the beta-actin gene was used to normalize the amount of investigated transcript. All reactions were run in triplicate wells.

Statistics

Illustrated data is representative of at least n=3 repeats of experiments, and in the case where error bars are used, the experimental mean and standard deviation of the data are shown.

Results

Heterogeneous response to TPO stimulation amongst KLS cells

To perform a preliminary analysis of the potential for hematopoietic stem and progenitor cells to respond to megakaryocyte-promoting growth signals, we sorted KLS cells – which represent a heterogenous population of hematopoietic progenitor cells -- from adult bone marrow, stimulated these cells with thrombopoietin, and then performed intracellular FACS analysis for downstream signaling pathways. To analyze intracellular proteins and signal transduction in rare, highly refined subpopulations, we optimized the phospho-flow and tyramide signal amplification protocols developed previously 30, 32, 35-37 such that they could be robustly applied to hematopoietic stem and progenitor cells. We observed that thrombopoietin (TPO) was capable of activating STAT5 signaling in nearly 100% of KLS cells (Figure 1A). However, approximately 40-50% of KLS cells responded to TPO stimulation through phosphorylation of AKT (Figure 1B). Since it has been observed that the PI3K pathway has a role in regulating gene expression in response to TPO stimulation 38, we reasoned that this heterogeneous responsiveness to TPO stimulation through the AKT pathway might reveal cell-intrinsic heterogeneity in the capacity of subsets of KLS cells to differentiate to the megakaryocyte lineage.

Figure 1. TPO stimulation of KLS cells.

Figure 1

cKit(+) Lineage (−) Sca1(+) [KLS] cells were sorted and stimulated for 15 minutes with 100 ng/mL TPO. (A) TPO (red histogram) stimulation revealed by staining with anti-pSTAT5 monoclonal antibody. (B) TPO (red histogram) stimulation revealed by staining with anti-pAKT monoclonal antibody and tyramide signal amplification.

Identification of two novel hematopoietic progenitor populations: FSE and Flk(+) CD150(−) cells

To examine GATA1 protein expression in KLS cells, we developed techniques to correlate intracellular protein expression levels to cell surface immunophenotypes in early hematopoietic progenitor populations. Previous protocols have suggested that sequential use of paraformaldehyde (PFA) and ethanol (EtOH) for fixation and permeabilization is permissive to subsequent high-resolution staining of a wide range of intracellular epitopes 39. Additionally, permeabilization with EtOH has been shown to preserve the integrity of a number of antibody-conjugated fluorophores, in particular the phycoerythrin series, for subsequent high-fidelity analysis 40. Expanding on these previously published intracellular staining protocols, we optimized a protocol for intracellular staining in rare cell populations that involved the sequential steps of staining for surface antigens with fluorescently labeled antibodies, followed by fixation with PFA, and then permeabilization with EtOH. Our protocol, unlike previous approaches involving fixation and permeabilization prior to staining for extracellular epitopes 41, 42, preserved the gating progression and fidelity required to identify LT-HSC using a variety of common surface markers in fixed and permeabilized bone marrow (Supplemental Figure 1). Thus, although functional assays are impossible with fixed and permeabilized HSC, the high degree of surface stain similarity we observed between untreated samples vs. samples fixed and permeabilized by our protocol supports the interpretation that we are, in fact, studying bona fide hematopoietic stem and progenitor cells as defined by the cell surface immunophenotype.

As shown in Figure 2, we stained kit-enriched bone marrow with standard subpopulation defining markers (cKit, Sca1, CD150, and Flk2) before we fixed with PFA, permeabilized with EtOH, and performed intracellular staining for GATA1. Using a signal amplification system optimized for detection of intracellular epitopes by multiparameter flow cytometry to analyze the expression of GATA1 within the KLS Flk2(+) population, we prospectively identified two subpopulations of cells for further characterization.

Figure 2. Intracellular flow cytometry reveals elevated expression of GATA1 in the KLS Flk(+) CD150(int) CD105(+) [FSE] cell population.

Figure 2

cKit-enriched bone marrow was stained for surface epitopes, then fixed, permeabilized with ethanol, quenched, and stained for GATA1 using an enzymatic amplification protocol described in the materials and methods. (A) Within the cKit(+) Lineage(−) Sca1(+) [KLS] gate, GATA1 levels are shown for Flk(+) CD150(−) cells (dashed red gate and histogram), LT-HSC (dashed black gate and histogram), and Flk(+ to int) CD150(int) cells (solid green gate and histogram). A rabbit IgG primary isotype control antibody staining all KLS cells and subjected to the enzymatic amplification protocol is shown in grey. (B) Within the KLS gate, GATA1 levels are shown for Flk(+) CD105(−) cells (dashed red gate and histogram), LT-HSC (dashed black gate and histogram), and Flk(+) CD105(+) cells (solid green gate and histogram). A rabbit IgG primary isotype control antibody staining all KLS cells and subjected to the enzymatic amplification protocol is shown. (C) Within the cKit(+) Lineage(−) Sca1(−) gate, GATA1 levels are shown for CD105(+) CD150(−) late erythroid progenitors (orange gate and histogram). Results are overlayed with KLS Flk(+) CD105(−) cells (dashed red histogram), LT-HSC (dashed black histogram), and Flk(+) CD105(+) cells (solid green histogram). A rabbit IgG primary isotype control antibody staining all KLS cells and subjected to the enzymatic amplification protocol is shown. All results are representative of at least three independent experiments.

One population of cells expressed more GATA1 protein than any other population in the KLS subset, and was prospectively defined by the surface phenotype cKit (+) Lineage (−) Sca1 (+) Flk2 (+ to int) CD150 (int) CD105 (+) (Figure 2A and Figure 2B). Based on this phenotype, we refer to these cells as Flk2/SlamF1 (CD150)/Endoglin (CD105) [FSE] cells. Typical sort gates and purity of unfixed, viable cells after reanalysis of the first sort – although we always double-sort these cells – are indicated in Supplemental Figure 2. Relative to populations of common myeloid progenitors (CMP), granulocyte/macrophage progenitors (GMP), and megakaryocyte/erythroid progenitors (MEP) in the cKit (+) Lineage (−) Sca1 (−) gate 43, FSE cells expressed higher levels of GATA1 (data not shown). As compared to the refined definitions of myeloid progenitors described by Pronk, et al. 27, FSE cells expressed higher levels of GATA1 than MEP, and somewhat lower levels of GATA1 as the cKit (+) Sca1(−) CD150 (+) CD105(+) early erythroid progenitors (Figure 2C and data not shown). FSE cells also expressed GATA1 at the transcript level, as shown by quantitative RT-PCR (Supplemental Figure 3).

A second cell subpopulation contained the remainder of KLS Flk2(+) cells after FSE cells were removed by computational gating (Figure 2). Since cells within this subpopulation appeared negative for CD150 staining – indeed, the fluorescence of these cells was indistinguishable from fluorescence-minus-one staining in the fluorescence channel used for CD150 detection 44 (data not shown) – we refer to these cells as Flk(+) CD150(−) cells. Flk(+) CD150(−) cells exhibited less GATA1 expression than FSE cells, and approximately equivalent expression as LT-HSC and the Flk(−) CD150(−) cells (Figure 2 and data not shown). By quantitative RT-PCR, FSE cells expressed >30-fold more GATA1 than Flk(+) CD150(−) cells (Supplemental Figure 3). Thus, the difference in protein-level expression of GATA1 observed between FSE cells and Flk(+) CD150(−) cells is recapitulated at the mRNA level.

cMPL and signal transduction

To further characterize the FSE and Flk(+) CD150(−) cell populations, we performed flow cytometric analysis of KLS subsets with an antibody against cMPL, the receptor for TPO. Figure 3A shows the expression levels of cMPL within the KLS gate [antibody kindly provided by Drs. Wei Tong and Harvey Lodish 45]. cMPL is shown as a function of Flk2 expression. Interestingly, LT-HSC [KLS Flk2(−) cells in this plot] were nearly uniformly positive for cMPL expression (Figure 3A and similar unpublished plots depicting cMPL vs. CD150; cMPL vs. CD105; cMPL vs. CD34). After gating on KLS CD150(int) Flk(+ to int) cells (Figure 3B) and KLS Flk(+) CD150(−) cells (Figure 3C), we plotted cMPL expression as a function of CD105 expression for these cell populations. We noted that nearly 80% of FSE cells were cMPL(+) (Figure 3B). In contrast, Flk(+) CD150(−) were nearly 80% negative for cMPL expression (Figure 3C). The observed gradient of cMPL expression in KLS cells raised the possibility that megakaryocyte potential in LT-HSC, FSE cells, and Flk(+) CD150(−) cells is a function of an intact TPO/cMPL signaling axis in these cells. Therefore, we developed techniques to map clonal-level responsiveness of cells to TPO stimulation, and matched this responsiveness with lineage outcomes. As illustrated in Figure 1A, KLS cells homogeneously experienced an increase in the relative phosphorylation of STAT5 in response to exogenous stimulation with TPO for 15 minutes. A similar unimodal activation of STAT1 and STAT3 was observed (data not shown). However, we observed a bimodal response to TPO stimulation through phospho-AKT, phospho-ERK, and phospho-CREB (Figure 1B and data not shown). To uncover the signaling heterogeneity within the KLS gate, we sorted LT-HSC, FSE cells, and Flk(+) CD150 (−), and stimulated them with TPO for 15 minutes. In response to TPO stimulation, LT-HSC and FSE cells displayed strongly activated ERK and AKT pathways, while Flk(+) CD150(−) cells did not (Figures 3D and Supplemental Figure 4). Thus, we hypothesized that the ability of LT-HSC, FSE cells, and Flk(+) CD150(−) cells to respond to TPO stimulation through activation of multiple signaling pathways would be highly correlated with the megakaryocyte potential of these cells in vitro and in vivo.

Figure 3. Heterogeneous expression of cMPL and responsiveness to TPO stimulation in KLS cell subsets.

Figure 3

Marrow was stained with cKit, Lineage, Sca1, Flk2, CD105, and CD150. (A) Staining profile of Flk2 and cMPL within the KLS gate. Expression of c-MPL and CD105 are shown for FSE cells (B), and Flk(+) CD150(−) cells (C). In (D), cells were prospectively sorted as KLS Flk2 (−), CD150 (+) [LT-HSC, dashed black histogram], KLS Flk2(+) CD150(int) CD105(+) [FSE cells, green histogram], or KLS Flk2 (+), CD150 (−) [Flk(+)CD150(−) cells, dashed red histogram]. Cells were stimulated with 10 ng/mL TPO for 15 minutes, and subsequently fixed, permeabilized, and stained for pAKT. Unstimulated cells (grey histogram) were stained with pAKT as a negative control. All results are representative of at least three independent experiments.

Lineage potential of stem and progenitor cells tested in in vitro culture assays

To directly assess whether FSE cells would have increased megakaryocyte and erythroid lineage potential compared to Flk(+) CD150(−) cells, we used a clonal liquid culture assay containing a complement of cytokines known to promote multilineage myeloid readout (10 ng/mL each of Flt3L, SCF, IL-3, TPO, and EPO). We observed megakaryocyte-containing colonies derived from LT-HSC and FSE cells in 80% and 60% of the wells, respectively. We rarely observed this phenotype from Flk(+) CD150(−) cells (0-2% of the wells, Figure 4). There remained, however, the possibility that Flk(+) CD150(−) cells retain a megakaryocyte potential that is overridden in differentiation conditions that simultaneously promote granulocyte/macrophage differentiation. We addressed this possibility through clonal culture of Flk(+) CD150(−) cells in three distinct megakaryocyte-promoting liquid culture systems. In 12 day cultures containing only TPO and SCF, 23% of wells plated with FSE cells, and 70% of wells plated with LTHSC, contained megakaryocytes. In contrast, none of the wells plated with Flk2(+) CD150(−) cells contained megakaryocytes (Figure 4). Early characterizations of TPO 19 compared its ability to promote megakaryocytopoiesis to that of other cytokine cocktails, including IL3+IL6 and IL3+IL11. While FSE cells retained robust clonal megakaryocyte potential under these culture conditions, the megakaryocyte potential of Flk(+) CD150(−) cells remained severely limited if not completely absent (0-1% of wells plated, Figure 4). This implies that Flk(+) CD150(−) cells have lost megakaryocyte potential in response to both TPO-mediated and alternative stimulation.

Figure 4. FSE, but not Flk(+) CD150(−) cells, have Meg/E lineage potential in culture.

Figure 4

LT-HSC, cMPL(+) FSE cells, and cMPL(−) Flk(+) CD150(−) cells were clone-sorted into liquid culture media containing the indicated cytokines. Colonies were scored by morphology and cytospin at 12 days. Colonies noted to contain megakaryocytes or erythroid cells are scored as positive. Results are representative of at least three independent experiments.

We then determined clonal lymphoid potential of FSE cells and Flk(+) CD150(−) cells in the OP9 culture system 46 by sorting single cells into cultures containing OP9 cells and scoring wells by flow cytometry at Day 13. Wells containing cells positive for CD19, and negative for CD11c, Gr1, and Mac1 were scored as positive for B lymphocytes, demonstrating that cells plated into these wells retained lymphoid potential (Supplemental Figure 5). Using the OP9-delta culture system, it was observed that clonally sorted LT-HSC, FSE, and Flk(+) CD150(−) cells also exhibited T lineage potential (data not shown). Therefore, LT-HSC, FSE, and Flk(+) CD150(−) cells all exhibited clonal lymphoid potential in culture.

Lineage potential of stem and progenitor cells tested in in vivo transplantation assays

To determine the erythroid potential of FSE cells as compared to LT-HSC and Flk(+) CD150(−) cells in vivo, we analyzed day 12 CFU-S activity of these populations in lethally irradiated recipient mice 3. As illustrated in Figure 5A, FSE cells efficiently gave rise to CFU-S (~1 colony per 12 cells injected, similar to the MPP tested previously 47), while Flk(+) CD150(−) cells were largely deficient in CFU-S activity (1 in 600). FSE cells exceeded the clonal efficiency of LT-HSC (~1 in 30), suggesting that the upregulation of GATA1 observed in FSE cells has, to first approximation, a functional consequence to promote erythropoiesis.

Figure 5. FSE cells, but not Flk(+) CD150(−) cells, exhibit efficient CFU-S seeding and rapid platelet engraftment kinetics in vivo.

Figure 5

(A) LT-HSC, FSE, and Flk(+) CD150(−) cells were sorted and 100 cells per mouse were transplanted into lethally irradiated C57/Bl recipient mice. Spleens were harvested at day 12 and soaked in Tellesniczky’s reagent and total CFU-S were counted. (B) LT-HSC (dashed line) and FSE cells (solid line), were sorted from GFP+ donors and 50 cells per mouse were transplanted into sublethally irradiated C57/Bl recipient mice. Blood was collected from the tail vein at indicated intervals for analysis of CD150+/Ter119− platelets. Total donor-derived engraftment levels were determined at all timepoints, and data is represented as the percent of maximum engraftment. All results are representative of at least three independent experiments. Error bars indicate standard deviation of the data of 5 mice per experimental group.

To address the in vivo megakaryocyte potential and engraftment kinetics of FSE cells as compared to LT-HSC, we transplanted 50 cells derived from GFP+ transgenic donors into sublethally-irradiated GFP-negative recipients 3. Mice were bled at staged time-points after transplantation, and donor platelets were quantified as GFP(+) events in the CD150 (+), Ter119 (−), FSC/SSC (lo) gate. A representative transplant experiment is shown in Figure 5B. We observed a rapid engraftment kinetic of FSE cells as compared to LT-HSC, with FSE cells peaking in their contribution of 10% of total platelets within 14-16 days and declining to baseline within 1 to 1.5 months post-transplant. LT-HSC reached maximal platelet engraftment of ~25% of total platelets being donor-derived at approximately 3 weeks post-transplant, and retained approximately 50% of their maximal platelet engraftment over longer timepoints. In contrast, we observed that 50, and even as many as 500, transplanted Flk(+) CD150(−) cells were unable to give rise to donor-derived platelets under these experimental conditions. Of three transplant experiments with 50 Flk(+) CD150(−) cells, 14 mice out of 15 exhibited zero chimerism, and the one mouse in 15 exhibited a maximal donor-derived platelet chimerism of 0.03%, or approximately 200-fold less than contribution of FSE cells in the same experiment. Donor-derived B220(+), CD3(+), and Mac1/Gr1(+) cells were observed in mice transplanted with LT-HSC, FSE, and Flk(+) CD150(−) cells. The fraction of positive mice, and the mean level of engraftment for lymphoid lineages at 1 month and Mac1/Gr1 cells at 2 weeks, is illustrated in Supplemental Figure 5B. Thus, since Mac1/Gr1 and lymphoid engraftment by Flk(+) CD150(−) cells was never accompanied by donor-derived platelet contribution or CFU-S activity, Flk(+) CD150(−) cells were severely limited in their potential for differentiation toward the megakaryocyte and erythroid lineages. In contrast to Flk(+) CD150(−) cells and LT-HSC, FSE cells seemed enriched for Meg/E lineage potentials while retaining full hematopoietic multipotency.

Discussion and Conclusions

We report the initial characterization of two novel hematopoietic progenitor populations and demonstrate how transcription factor expression and signal transduction can correlate with megakaryocyte/erythroid lineage potentials of these cells. In our hands, KLS Flk(+) CD150(−) cells expressed low levels of GATA1 protein, lacked clonal-megakaryocyte potential in a variety of culture conditions, lacked robust CFU-S activity, lacked in vivo platelet potential, exhibited low-to-negative expression of cMPL, and lacked sustained responsiveness to TPO stimulation through a number of intracellular signaling pathways, yet retained their ability to generate lymphoid- and other myeloid-hematopoietic lineages. In contrast to Flk(+) CD150(−) cells, FSE cells expressed high levels of GATA1 protein, exhibited robust erythroid and platelet potential in vitro and in vivo with accelerated platelet engraftment kinetics than LT-HSC, expressed high levels of cMPL, and responded to TPO stimulation through activation of numerous intracellular signaling pathways, while retaining their ability to generate lymphoid and other myeloid hematopoietic lineages. The most common model of hematopoietic ontogeny suggests that the first lineage commitment decision results in cells that retain full lymphoid or full myeloid potential, embodied by the common lymphoid progenitor [CLP, 48, 49] and the common myeloid progenitor [CMP, 5, 43], although it was never claimed by us that intermediate multipotent progenitors did not also exist 43, 48. By demonstrating that the KLS Flk(+) population within adult mouse bone marrow contains prospectively identifiable cells that appear to be multipotent for all hematopoietic lineages except the Meg/E series, our results support a growing body of evidence that this canonical fate map merits reconsideration 2-4, 50, 51. Further characterization of these populations, including their placement in a physiologically relevant hematopoietic hierarchy, could help explain mechanisms of early lineage commitment during definitive hematopoiesis.

Subsequent to our initial findings, two reports were independently published that support our observations regarding prospective identification of hematopoietic progenitor cells that lack or retain Meg/E lineage potential. First, Arinobu, et al., utilized GATA1-GFP reporter mice to identify a novel population, defined by the surface phenotype of cKit(+) Lineage(−) Sca1(intermediate) Flk2(−) GATA1(+), which efficiently gives rise to cells of all myeloid lineages while exhibiting negligible lymphoid potential 5. Second, Luc, et al., subdivided the KLS Flk2(+) population and demonstrated that cMPL(+) cells retained Meg/E potential while cMPL(−) cells did not exhibit Meg/E potential 50. While a definitive comparison between these published populations and the FSE and Flk(+) CD150(−) cells described herein will be the subject of future investigation, we believe that the approaches and conclusions from the two published reports complement our findings. As described by Unwin, et al., a large fraction of genes in stem cell populations exhibit a fundamental disconnect between transcript levels and protein levels 52. For example, LT-HSC and erythroid progenitor cells express more GATA1 by RT-PCR than do FSE cells (Supplemental Figure 3), yet LT-HSC exhibited less GATA1 protein expression relative to both of these populations (Figure 2). This observation may be due to the transcript being sequestered prior to translation in these cells, greater rates of degradation of GATA1 protein in these cells, slower rates of new GATA1 transcript production in FSE cells, the involvement of micro-RNAs, or another alternative mechanism. Thus, an inherently different measurement is made when analyzing GATA1 transcript levels using a reporter mouse, as compared to GATA1 protein levels using an antibody. Consequently, depending on a researcher’s intent and experimental timeframe, it may prove more expeditious and advantageous to optimize intracellular staining protocols to identify and characterize novel cell populations, rather than generate knock-in or reporter mouse strains.

Additionally, our work serves to highlight potential paths for future research in understanding how hematopoietic stem and progenitor cells respond to extracellular cues during normal homeostasis and during times of hematopoietic stress. For example, previous work has suggested that expression of the receptor for G-CSF is low or absent in most KLS cells, including LT-HSC, and that any role for G-CSF in promoting mobilization of HSC into the bloodstream might be mediated by engagement of the GCSF receptor by another cellular intermediate, or perhaps by the sympathetic nervous system 28, 34, 36, 53. Preliminary findings over the course of the experiments described in this manuscript suggest that nearly 100% of KLS cells can respond to G-CSF stimulation through activation of a number of STAT signaling pathways, most notably STAT5 (Heffner GC, Clutter MR, Nolan GP, and Weissman IL, manuscript in preparation). Consequently, HSC activity in response to G-CSF treatment may also involve a direct stimulation of HSC by G-CSF. It shall be important to expand the number, duration, and combinatorics of exogeneous stimulations, as well as increase the number of assayed intracellular epitopes, to address cytokine involvement in hematopoietic decision making from a systems biology perspective.

Our approach utilizes the high-throughput and quantitative aspects of flow cytometry to simultaneously assay extracellular surface markers together with steady-state intracellular epitopes in HSC and other rare bone marrow-resident hematopoietic progenitor cells. In data we report elsewhere, we have determined the critical parameters and an optimized protocol for tyramide signal amplification for intracellular flow cytometry 30. Our present work brings these concepts together, and optimizes these protocols for the biological question of understanding signaling networks in primary mouse hematopoietic stem and progenitor cells in a manner that was previous inaccessible 41, 54. The application of our approach to studying developmental, immunological, and oncogenic systems should allow further refinements in our mechanistic understanding of early fate decisions made by stem cells and their progeny, both in the context of the hematopoietic system and elsewhere.

Supplementary Material

SuppFig1

Supplemental Figure 1. Gating progressions for LT-HSC are conserved through permeabilization with ethanol, but not through conventional intracellular staining protocols. (A) Whole bone marrow was stained with antibodies specific for Lineage, cKit, Sca1, CD150, Flk2, CD48, and CD34. (B) Whole bone marrow was fixed in 2% PFA, permeabilized in 90% MeOH, and then stained as in (A). (C) Whole bone marrow was stained as in (A), then fixed in 2% PFA and permeabilized in 90% MeOH. (D) Whole bone marrow as stained in (A), then fixed in 2% PFA and permeabilized in 90% EtOH.

SuppFig2

Supplemental Figure 2. Sample sort gates and reanalysis of FSE cells. Cells were prospectively sorted as KLS Flk2 (−), CD150 (+) [LT-HSC, dashed black gate], KLS Flk2(+) CD150(int) CD105(+) [FSE cells, green gate then orange gate], or KLS Flk2 (+), CD150 (−) [Flk(+) CD150(−) cells, dashed red gate]. Gates were set based on Fluorescence-minus-one analysis (CD150) or based on observed positive or negative expression thresholds within the cKit(+) Lineage(−) Sca1(−) gate (CD105). (A) shows the pre-sort kit-enriched marrow, while (B) shows the post-first sort reanalysis. Cells were always sorted a second time using the indicated gates.

SuppFig3

Supplemental Figure 3. Differential expression of GATA1 in LT-HSC, FSE cells, Flk2(+) CD150(−) cells, and erythroid progenitor cells. Cells were prospectively sorted as KLS Flk2 (−), CD150 (+) [LT-HSC], KLS Flk2(+) CD150(int) CD105(+) [FSE cells], KLS Flk2 (+), CD150 (−) [Flk(+) CD150(−) cells], or cKit(+) Lineage(−) Sca1(−) CD105(+) CD150(−) [Erythroid progenitors]. Cells were double-sorted into Trizol reagent, and RT-PCR was performed as previously described (Forsberg, et al., 2005), with reactions performed in triplicate wells per experiment. Results are normalized between cell populations to beta-actin expression, and depicted as fold expression difference relative to LT-HSC expression of GATA1. Results are representative of three independent experiments, and error bars indicate the aggregate standard deviation of three wells of beta-actin expression and three wells of GATA1 expression for each cell population.

SuppFig4

Supplemental Figure 4. Heterogeneous responsiveness to TPO stimulation in KLS cell subsets through ERK activation. Marrow was stained with cKit, Lineage, Sca1, Flk2, CD105, and CD150. Cells were prospectively sorted as KLS Flk2 (−), CD150 (+) [LT-HSC, dashed red histogram], KLS Flk2(+) CD150(int) CD105(+) [FSE cells, green histogram], or KLS Flk2 (+), CD150 (−) [Flk(+)CD150(−) cells, blue histogram]. Cells were stimulated with 10 ng/mL TPO for 15 minutes, and subsequently fixed, permeabilized, and stained for pERK1/2. Unstimulated cells (grey histogram) were stained with pERK1/2 as a negative control. All results are representative of at least three independent experiments.

SuppFig5

Supplemental Figure 5. LT-HSC, FSE cells, and Flk(+) CD150(−) cells exhibit clonal lymphoid potential in vitro, and lymphoid and Mac/Gr potential in vivo. (A) LTHSC, FSE cells, and Flk(+) CD150(−) cells were clone-sorted onto OP9 stromal cultures for 13 days. Wells were scored by morphology and flow cytometry for presence of CD 19+ [B] lymphoid cells. (B) LT-HSC, FSE cells, and Flk(+) CD150(−) cells were sorted from GFP+ donors and 50 cells per mouse were transplanted into sublethally irradiated C57/Bl recipient mice. Blood was collected from the tail vein at 2 and 4 weeks post-transplant for analysis of peripheral blood. Results illustrate the fraction of mice that exhibited donor-derived chimerism for B and T cells at 4 weeks, and Mac1/Gr1 myeloid cells at 2 weeks, as well as the mean donor-derived chimerism for each lineage. Results are representative of at least three independent experiments.

Acknowledgements

We thank D. Bryder, D. Bhattacharya, J. Seita, T. Serwold, CC Chen, M. Inlay, C. Forsberg, J. Mich, P. Krutzik, and K. Schulz for helpful discussions and technical assistance; L. Jerabek for laboratory management; C. Muscat for antibody production; A. Mosley, L. Hidalgo, D. Escoto, and J. Dollaga for animal care; D. Kalaitzidis, T. Serwold, D. Bhattacharya, C. Forsberg, and J. Seita for critical reading of the manuscript. Supported by grants 5R01CA086065 (NIH) and PO1DK53074 (NIH) (I.L.W.), N01HV28183 (NIH, NHLBI), U19AI057219 (NIH), 2P01CA034233-22A1 (NIH), 1P50CA114747 (NIH), and 7017-6 (Leukemia and Lymphoma Society) (G.P.N.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Additional thanks to M. Panganiban and graduate student peers in the Stanford Program in Immunology for support.

Footnotes

Disclosure of Potential Conflicts of Interest I.L.W. has stock in Amgen and is a cofounder of Stem Cells, Inc. The other authors have no financial interests to disclose.

Author Contributions: Garrett Heffner contributed to conception and design, provision of study material or patients, collection and/or assembly of data, data analysis and interpretation, manuscript writing, and final approval of manuscript.

Matthew Clutter contributed to conception and design, provision of study material or patients, collection and/or assembly of data, data analysis and interpretation, and final approval of manuscript.

Garry Nolan contributed to conception and design, financial support, administrative support, data analysis and interpretation, and final approval of manuscript.

Irving Weissman contributed to conception and design, financial support, administrative support, data analysis and interpretation, and final approval of manuscript.

References

  • 1.Kondo M, Wagers AJ, Manz MG, et al. Biology of hematopoietic stem cells and progenitors: implications for clinical application. Annu Rev Immunol. 2003;21:759–806. doi: 10.1146/annurev.immunol.21.120601.141007. [DOI] [PubMed] [Google Scholar]
  • 2.Adolfsson J, Mansson R, Buza-Vidas N, et al. Identification of Flt3+ lympho myeloid stem cells lacking erythro-megakaryocytic potential a revised road map for adult blood lineage commitment. Cell. 2005;121:295–306. doi: 10.1016/j.cell.2005.02.013. [DOI] [PubMed] [Google Scholar]
  • 3.Forsberg EC, Serwold T, Kogan S, et al. New evidence supporting megakaryocyte-erythrocyte potential of flk2/flt3+ multipotent hematopoietic progenitors. Cell. 2006;126:415–426. doi: 10.1016/j.cell.2006.06.037. [DOI] [PubMed] [Google Scholar]
  • 4.Mansson R, Hultquist A, Luc S, et al. Molecular evidence for hierarchical transcriptional lineage priming in fetal and adult stem cells and multipotent progenitors. Immunity. 2007;26:407–419. doi: 10.1016/j.immuni.2007.02.013. [DOI] [PubMed] [Google Scholar]
  • 5.Arinobu Y, Mizuno S, Chong Y, et al. Reciprocal activation of GATA-1 and PU.1 marks initial specification of hematopoietic stem cells into myeloerythroid and myelolymphoid lineages. Cell Stem Cell. 2007;1:416–427. doi: 10.1016/j.stem.2007.07.004. [DOI] [PubMed] [Google Scholar]
  • 6.Bottardi S, Ghiam AF, Bergeron F, et al. Lineage-specific transcription factors in multipotent hematopoietic progenitors: a little bit goes a long way. Cell Cycle. 2007;6:1035–1039. doi: 10.4161/cc.6.9.4208. [DOI] [PubMed] [Google Scholar]
  • 7.Kaushansky K. Lineage-specific hematopoietic growth factors. N Engl J Med. 2006;354:2034–2045. doi: 10.1056/NEJMra052706. [DOI] [PubMed] [Google Scholar]
  • 8.Evans T, Felsenfeld G. The erythroid-specific transcription factor Eryf1: a new finger protein. Cell. 1989;58:877–885. doi: 10.1016/0092-8674(89)90940-9. [DOI] [PubMed] [Google Scholar]
  • 9.Pevny L, Lin CS, D’Agati V, et al. Development of hematopoietic cells lacking transcription factor GATA-1. Development. 1995;121:163–172. doi: 10.1242/dev.121.1.163. [DOI] [PubMed] [Google Scholar]
  • 10.Pevny L, Simon MC, Robertson E, et al. Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1. Nature. 1991;349:257–260. doi: 10.1038/349257a0. [DOI] [PubMed] [Google Scholar]
  • 11.Yamaguchi Y, Zon LI, Ackerman SJ, et al. Forced GATA-1 expression in the murine myeloid cell line M1: induction of c-Mpl expression and megakaryocytic/erythroid differentiation. Blood. 1998;91:450–457. [PubMed] [Google Scholar]
  • 12.Visvader JE, Crossley M, Hill J, et al. The C-terminal zinc finger of GATA-1 or GATA-2 is sufficient to induce megakaryocytic differentiation of an early myeloid cell line. Mol Cell Biol. 1995;15:634–641. doi: 10.1128/mcb.15.2.634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Li Z, Godinho FJ, Klusmann JH, et al. Developmental stage-selective effect of somatically mutated leukemogenic transcription factor GATA1. Nat Genet. 2005;37:613–619. doi: 10.1038/ng1566. [DOI] [PubMed] [Google Scholar]
  • 14.Vigon I, Florindo C, Fichelson S, et al. Characterization of the murine Mpl proto oncogene, a member of the hematopoietic cytokine receptor family: molecular cloning, chromosomal location and evidence for a function in cell growth. Oncogene. 1993;8:2607–2615. [PubMed] [Google Scholar]
  • 15.Souyri M, Vigon I, Penciolelli JF, et al. A putative truncated cytokine receptor gene transduced by the myeloproliferative leukemia virus immortalizes hematopoietic progenitors. Cell. 1990;63:1137–1147. doi: 10.1016/0092-8674(90)90410-g. [DOI] [PubMed] [Google Scholar]
  • 16.Skoda RC, Seldin DC, Chiang MK, et al. Murine c-mpl: a member of the hematopoietic growth factor receptor superfamily that transduces a proliferative signal. EMBO J. 1993;12:2645–2653. doi: 10.1002/j.1460-2075.1993.tb05925.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.de Sauvage FJ, Hass PE, Spencer SD, et al. Stimulation of megakaryocytopoiesis and thrombopoiesis by the c-Mpl ligand. Nature. 1994;369:533–538. doi: 10.1038/369533a0. [DOI] [PubMed] [Google Scholar]
  • 18.Bartley TD, Bogenberger J, Hunt P, et al. Identification and cloning of a megakaryocyte growth and development factor that is a ligand for the cytokine receptor Mpl. Cell. 1994;77:1117–1124. doi: 10.1016/0092-8674(94)90450-2. [DOI] [PubMed] [Google Scholar]
  • 19.Kaushansky K, Lok S, Holly RD, et al. Promotion of megakaryocyte progenitor expansion and differentiation by the c-Mpl ligand thrombopoietin. Nature. 1994;369:568–571. doi: 10.1038/369568a0. [DOI] [PubMed] [Google Scholar]
  • 20.Lok S, Kaushansky K, Holly RD, et al. Cloning and expression of murine thrombopoietin cDNA and stimulation of platelet production in vivo. Nature. 1994;369:565–568. doi: 10.1038/369565a0. [DOI] [PubMed] [Google Scholar]
  • 21.Domen J, Weissman IL. Hematopoietic stem cells need two signals to prevent apoptosis; BCL-2 can provide one of these, Kitl/c-Kit signaling the other. J Exp Med. 2000;192:1707–1718. doi: 10.1084/jem.192.12.1707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Yoshihara H, Arai F, Hosokawa K, et al. Thrombopoietin/MPL signaling regulates hematopoietic stem cell quiescence and interaction with the osteoblastic niche. Cell Stem Cell. 2007;1:685–697. doi: 10.1016/j.stem.2007.10.020. [DOI] [PubMed] [Google Scholar]
  • 23.Qian H, Buza-Vidas N, Hyland CD, et al. Critical role of thrombopoietin in maintaining adult quiescent hematopoietic stem cells. Cell Stem Cell. 2007;1:671–684. doi: 10.1016/j.stem.2007.10.008. [DOI] [PubMed] [Google Scholar]
  • 24.Seita J, Ema H, Ooehara J, et al. Lnk negatively regulates self-renewal of hematopoietic stem cells by modifying thrombopoietin-mediated signal transduction. Proc Natl Acad Sci U S A. 2007;104:2349–2354. doi: 10.1073/pnas.0606238104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Adolfsson J, Borge OJ, Bryder D, et al. Upregulation of Flt3 expression within the bone marrow Lin(−)Sca1(+)c-kit(+) stem cell compartment is accompanied by loss of self-renewal capacity. Immunity. 2001;15:659–669. doi: 10.1016/s1074-7613(01)00220-5. [DOI] [PubMed] [Google Scholar]
  • 26.Christensen JL, Weissman IL. Flk-2 is a marker in hematopoietic stem cell differentiation: a simple method to isolate long-term stem cells. Proc Natl Acad Sci U S A. 2001;98:14541–14546. doi: 10.1073/pnas.261562798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Pronk CJ, Rossi DJ, Mansson R, et al. Elucidation of the phenotypic, functional, and molecular topography of a myeloerythroid progenitor cell hierarchy. Cell Stem Cell. 2007;1:428–442. doi: 10.1016/j.stem.2007.07.005. [DOI] [PubMed] [Google Scholar]
  • 28.Rossi DJ, Bryder D, Zahn JM, et al. Cell intrinsic alterations underlie hematopoietic stem cell aging. Proc Natl Acad Sci U S A. 2005;102:9194–9199. doi: 10.1073/pnas.0503280102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Perfetto SP, Chattopadhyay PK, Lamoreaux L, et al. Amine reactive dyes: an effective tool to discriminate live and dead cells in polychromatic flow cytometry. J Immunol Methods. 2006;313:199–208. doi: 10.1016/j.jim.2006.04.007. [DOI] [PubMed] [Google Scholar]
  • 30.Clutter MR, Heffner GC, Krutzik PO, et al. Tyramide signal amplification for analysis of kinase activity by intracellular flow cytometry. Cytometry A. 77:1020–1031. doi: 10.1002/cyto.a.20970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Hopman AH, Ramaekers FC, Speel EJ. Rapid synthesis of biotin-, digoxigenin-, trinitrophenyl-, and fluorochrome-labeled tyramides and their application for In situ hybridization using CARD amplification. J Histochem Cytochem. 1998;46:771–777. doi: 10.1177/002215549804600611. [DOI] [PubMed] [Google Scholar]
  • 32.Krutzik PO, Nolan GP. Fluorescent cell barcoding in flow cytometry allows high-throughput drug screening and signaling profiling. Nat Methods. 2006;3:361–368. doi: 10.1038/nmeth872. [DOI] [PubMed] [Google Scholar]
  • 33.Attema JL, Papathanasiou P, Forsberg EC, et al. Epigenetic characterization of hematopoietic stem cell differentiation using miniChIP and bisulfite sequencing analysis. Proc Natl Acad Sci U S A. 2007;104:12371–12376. doi: 10.1073/pnas.0704468104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Forsberg EC, Prohaska SS, Katzman S, et al. Differential expression of novel potential regulators in hematopoietic stem cells. PLoS Genet. 2005;1:e28. doi: 10.1371/journal.pgen.0010028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Perez OD, Nolan GP. Simultaneous measurement of multiple active kinase states using polychromatic flow cytometry. Nat Biotechnol. 2002;20:155–162. doi: 10.1038/nbt0202-155. [DOI] [PubMed] [Google Scholar]
  • 36.Katayama Y, Battista M, Kao WM, et al. Signals from the sympathetic nervous system regulate hematopoietic stem cell egress from bone marrow. Cell. 2006;124:407–421. doi: 10.1016/j.cell.2005.10.041. [DOI] [PubMed] [Google Scholar]
  • 37.Krutzik PO, Irish JM, Nolan GP, et al. Analysis of protein phosphorylation and cellular signaling events by flow cytometry: techniques and clinical applications. Clin Immunol. 2004;110:206–221. doi: 10.1016/j.clim.2003.11.009. [DOI] [PubMed] [Google Scholar]
  • 38.Kirito K, Fox N, Kaushansky K. Thrombopoietin induces HOXA9 nuclear transport in immature hematopoietic cells: potential mechanism by which the hormone favorably affects hematopoietic stem cells. Mol Cell Biol. 2004;24:6751–6762. doi: 10.1128/MCB.24.15.6751-6762.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Krutzik PO, Nolan GP. Intracellular phospho-protein staining techniques for flow cytometry: monitoring single cell signaling events. Cytometry A. 2003;55:61–70. doi: 10.1002/cyto.a.10072. [DOI] [PubMed] [Google Scholar]
  • 40.Rothaeusler K, Baumgarth N. Evaluation of intranuclear BrdU detection procedures for use in multicolor flow cytometry. Cytometry A. 2006;69:249–259. doi: 10.1002/cyto.a.20252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Van Meter ME, Diaz-Flores E, Archard JA, et al. K-RasG12D expression induces hyperproliferation and aberrant signaling in primary hematopoietic stem/progenitor cells. Blood. 2007;109:3945–3952. doi: 10.1182/blood-2006-09-047530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Kalaitzidis D, Neel BG. Flow-cytometric phosphoprotein analysis reveals agonist and temporal differences in responses of murine hematopoietic stem/progenitor cells. PLoS One. 2008;3:e3776. doi: 10.1371/journal.pone.0003776. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Akashi K, Traver D, Miyamoto T, et al. A clonogenic common myeloid progenitor that gives rise to all myeloid lineages. Nature. 2000;404:193–197. doi: 10.1038/35004599. [DOI] [PubMed] [Google Scholar]
  • 44.Roederer M. Spectral compensation for flow cytometry: visualization artifacts, limitations, and caveats. Cytometry. 2001;45:194–205. doi: 10.1002/1097-0320(20011101)45:3<194::aid-cyto1163>3.0.co;2-c. [DOI] [PubMed] [Google Scholar]
  • 45.Tong W, Ibarra YM, Lodish HF. Signals emanating from the membrane proximal region of the thrombopoietin receptor (mpl) support hematopoietic stem cell self-renewal. Exp Hematol. 2007;35:1447–1455. doi: 10.1016/j.exphem.2007.05.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Carlyle JR, Michie AM, Furlonger C, et al. Identification of a novel developmental stage marking lineage commitment of progenitor thymocytes. J Exp Med. 1997;186:173–182. doi: 10.1084/jem.186.2.173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Nakorn TN, Miyamoto T, Weissman IL. Characterization of mouse clonogenic megakaryocyte progenitors. Proc Natl Acad Sci U S A. 2003;100:205–210. doi: 10.1073/pnas.262655099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Kondo M, Weissman IL, Akashi K. Identification of clonogenic common lymphoid progenitors in mouse bone marrow. Cell. 1997;91:661–672. doi: 10.1016/s0092-8674(00)80453-5. [DOI] [PubMed] [Google Scholar]
  • 49.Serwold T, Ehrlich LI, Weissman IL. Reductive isolation from bone marrow and blood implicates common lymphoid progenitors as the major source of thymopoiesis. Blood. 2008 doi: 10.1182/blood-2008-08-173682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Luc S, Anderson K, Kharazi S, et al. Down-regulation of Mpl marks the transition to lymphoid-primed multipotent progenitors with gradual loss of granulocyte monocyte potential. Blood. 2008;111:3424–3434. doi: 10.1182/blood-2007-08-108324. [DOI] [PubMed] [Google Scholar]
  • 51.Yang L, Bryder D, Adolfsson J, et al. Identification of Lin(−)Sca1(+)kit(+)CD34(+)Flt3− short-term hematopoietic stem cells capable of rapidly reconstituting and rescuing myeloablated transplant recipients. Blood. 2005;105:2717–2723. doi: 10.1182/blood-2004-06-2159. [DOI] [PubMed] [Google Scholar]
  • 52.Unwin RD, Smith DL, Blinco D, et al. Quantitative proteomics reveals posttranslational control as a regulatory factor in primary hematopoietic stem cells. Blood. 2006;107:4687–4694. doi: 10.1182/blood-2005-12-4995. [DOI] [PubMed] [Google Scholar]
  • 53.Liu F, Poursine-Laurent J, Link DC. Expression of the G-CSF receptor on hematopoietic progenitor cells is not required for their mobilization by G-CSF. Blood. 2000;95:3025–3031. [PubMed] [Google Scholar]
  • 54.Krutzik PO, Clutter MR, Nolan GP. Coordinate analysis of murine immune cell surface markers and intracellular phosphoproteins by flow cytometry. J Immunol. 2005;175:2357–2365. doi: 10.4049/jimmunol.175.4.2357. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

SuppFig1

Supplemental Figure 1. Gating progressions for LT-HSC are conserved through permeabilization with ethanol, but not through conventional intracellular staining protocols. (A) Whole bone marrow was stained with antibodies specific for Lineage, cKit, Sca1, CD150, Flk2, CD48, and CD34. (B) Whole bone marrow was fixed in 2% PFA, permeabilized in 90% MeOH, and then stained as in (A). (C) Whole bone marrow was stained as in (A), then fixed in 2% PFA and permeabilized in 90% MeOH. (D) Whole bone marrow as stained in (A), then fixed in 2% PFA and permeabilized in 90% EtOH.

SuppFig2

Supplemental Figure 2. Sample sort gates and reanalysis of FSE cells. Cells were prospectively sorted as KLS Flk2 (−), CD150 (+) [LT-HSC, dashed black gate], KLS Flk2(+) CD150(int) CD105(+) [FSE cells, green gate then orange gate], or KLS Flk2 (+), CD150 (−) [Flk(+) CD150(−) cells, dashed red gate]. Gates were set based on Fluorescence-minus-one analysis (CD150) or based on observed positive or negative expression thresholds within the cKit(+) Lineage(−) Sca1(−) gate (CD105). (A) shows the pre-sort kit-enriched marrow, while (B) shows the post-first sort reanalysis. Cells were always sorted a second time using the indicated gates.

SuppFig3

Supplemental Figure 3. Differential expression of GATA1 in LT-HSC, FSE cells, Flk2(+) CD150(−) cells, and erythroid progenitor cells. Cells were prospectively sorted as KLS Flk2 (−), CD150 (+) [LT-HSC], KLS Flk2(+) CD150(int) CD105(+) [FSE cells], KLS Flk2 (+), CD150 (−) [Flk(+) CD150(−) cells], or cKit(+) Lineage(−) Sca1(−) CD105(+) CD150(−) [Erythroid progenitors]. Cells were double-sorted into Trizol reagent, and RT-PCR was performed as previously described (Forsberg, et al., 2005), with reactions performed in triplicate wells per experiment. Results are normalized between cell populations to beta-actin expression, and depicted as fold expression difference relative to LT-HSC expression of GATA1. Results are representative of three independent experiments, and error bars indicate the aggregate standard deviation of three wells of beta-actin expression and three wells of GATA1 expression for each cell population.

SuppFig4

Supplemental Figure 4. Heterogeneous responsiveness to TPO stimulation in KLS cell subsets through ERK activation. Marrow was stained with cKit, Lineage, Sca1, Flk2, CD105, and CD150. Cells were prospectively sorted as KLS Flk2 (−), CD150 (+) [LT-HSC, dashed red histogram], KLS Flk2(+) CD150(int) CD105(+) [FSE cells, green histogram], or KLS Flk2 (+), CD150 (−) [Flk(+)CD150(−) cells, blue histogram]. Cells were stimulated with 10 ng/mL TPO for 15 minutes, and subsequently fixed, permeabilized, and stained for pERK1/2. Unstimulated cells (grey histogram) were stained with pERK1/2 as a negative control. All results are representative of at least three independent experiments.

SuppFig5

Supplemental Figure 5. LT-HSC, FSE cells, and Flk(+) CD150(−) cells exhibit clonal lymphoid potential in vitro, and lymphoid and Mac/Gr potential in vivo. (A) LTHSC, FSE cells, and Flk(+) CD150(−) cells were clone-sorted onto OP9 stromal cultures for 13 days. Wells were scored by morphology and flow cytometry for presence of CD 19+ [B] lymphoid cells. (B) LT-HSC, FSE cells, and Flk(+) CD150(−) cells were sorted from GFP+ donors and 50 cells per mouse were transplanted into sublethally irradiated C57/Bl recipient mice. Blood was collected from the tail vein at 2 and 4 weeks post-transplant for analysis of peripheral blood. Results illustrate the fraction of mice that exhibited donor-derived chimerism for B and T cells at 4 weeks, and Mac1/Gr1 myeloid cells at 2 weeks, as well as the mean donor-derived chimerism for each lineage. Results are representative of at least three independent experiments.

RESOURCES