Abstract
• Premise of the study: Firmiana consists of 12–16 species, many of which are narrow endemics. Expressed sequence tag (EST)–simple sequence repeat (SSR) markers were developed and characterized for size polymorphism in four Firmiana species.
• Methods and Results: A total of 102 EST-SSR primer pairs were designed based on the transcriptome sequences of F. danxiaensis; these were then characterized in four Firmiana species—F. danxiaensis, F. kwangsiensis, F. hainanensis, and F. simplex. In these four species, 17 primer pairs were successfully amplified, and 14 were polymorphic in at least one species. The number of alleles ranged from one to 13, and the observed and expected heterozygosities ranged from 0 to 1 and 0 to 0.925, respectively. The lowest level of polymorphism was observed in F. danxiaensis.
• Conclusions: These polymorphic EST-SSR markers are valuable for conservation genetics studies in the endangered Firmiana species.
Keywords: Firmiana danxiaensis, Malvaceae, microsatellites, transcriptome, transferability
Firmiana Marsili (Malvaceae sensu lato [s.l.]) is distributed in the Asiatic continent, Malaysia, and the Pacific Islands (Kostermans, 1957). This genus consists of 12–16 species, many of which are narrow endemics (Mabberley, 1997; Tang et al., 2007). Some species of Firmiana are cultivated as ornamental plants for their graceful shape and beautiful flowers. The wood of F. simplex W. Wight has been used by the Chinese to make high-quality traditional Asian musical instruments for thousands of years. This genus could be divided into two groups, i.e., Firmiana and Erythropsis, based on morphological and molecular data (Fan et al., unpublished data). There are five Firmiana species endemic to China. Among them, F. danxiaensis H. H. Hsue & H. S. Kiu is distributed only in Mount Danxia, Guangdong Province; F. kwangsiensis H. H. Hsue occurs only in Jingxi County, Guangxi Province; F. hainanensis Kosterm. and F. pulcherrima H. H. Hsue are confined in the central-south mountains of Hainan Province; and F. major (W. W. Sm.) Hand.-Mazz. is restricted to Yunnan Province and southwestern Sichuan Province (Tang et al., 2007). All of these species are listed as threatened in the China Species Red List (Wang and Xie, 2004).
Because of the lack of efficient molecular markers, there have been no studies on genetic diversity analyses and conservation genetics of Firmiana species. The transcriptome of F. danxiaensis was recently sequenced using the Illumina platform, and sequences for tens of thousands of transcripts were obtained by de novo assembly (Chen et al., unpublished data). Based on these sequences, 17 novel polymorphic expressed sequence tag (EST)–simple sequence repeat (SSR) markers were developed and characterized for size polymorphism among four Firmiana species: F. danxiaensis, F. kwangsiensis, F. hainanensis, and F. simplex. Of these species, F. kwangsiensis belongs to the Erythropsis group, while the other species belong to the Firmiana group of the genus Firmiana.
METHODS AND RESULTS
One seedling of F. danxiaensis was collected from Danxia Mountain, Guangdong Province, China, and planted in the greenhouse of Sun Yat-sen University. One year later, fresh leaves of the seedling were collected for RNA extraction, and the subsequent protocols for the transcriptome sequencing followed Chen et al. (2011). A total of 26.95 million 90-nucleotide paired-end reads were obtained and de novo assembled into 33,522 contigs using Trinity (Grabherr et al., 2011) with a minimal length of 300 bp and an average length of 834 bp. Functional annotation for these contigs was performed using the automatic annotation tool Blast2GO (Conesa and Gotz, 2008). Using MISA (http://pgrc.ipk-gatersleben.de/misa), we detected 2069 SSRs in 1897 contigs. Among them, trinucleotide repeats (58.1%) were the most common, followed by dinucleotide (36.1%), tetranucleotide (3.3%), hexanucleotide (1.6%), and pentanucleotide repeats (0.9%). Using Primer3 (Rozen and Skaletsky, 2000; http://frodo.wi.mit.edu/primer3), 102 pairs of primers were designed from contigs containing at least nine repeats for dinucleotide and trinucleotide motifs, or seven repeats for tetranucleotide motifs. Contigs containing these 102 SSR loci were deposited in GenBank (Appendix S1 (162.5KB, doc) , Table 1).
Table 1.
Characteristics of 17 EST-SSR markers developed in Firmiana danxiaensis.
| Locus | Primer sequences (5′–3′) | Repeat motifa | Ta (°C) | Expected allele size (bp) | A (Allele size range [bp])b | GenBank accession no. | Putative functionc |
| Fir_SSR2d | F: TCCAATGTCATGCTCTCCT | (CCA)5…(CAC)5 | 50 | 248 | 9 (216–246) | KF048040 | no hit |
| R: GTGGCGGTTCTGGTTATG | |||||||
| Fir_SSR5e | F: TGTGATGCTGACGAGGAG | (CCT)5…(TTG)5 | 50 | 166 | 1 (166) | KF048041 | flowering time control protein FCA-like |
| R: ATGAACCGCTATAACGACAA | |||||||
| Fir_SSR9d | F: AACAAGTGCGTTGAGAGG | (GGA)6…(TC)7 | 50 | 169 | 8 (164–184) | KF048042 | no hit |
| R: GAGCGAAGTGAAAGAGAAAG | |||||||
| Fir_SSR12d | F: TCATCACCATCAACAACAAC | (CAG)5…(CAT)6 | 50 | 197 | 7 (189–217) | KF048043 | B3 domain-containing transcription factor NGA1-like |
| R: GCACTGAATCAATCACCATT | |||||||
| Fir_SSR16e | F: GTTCCAGTTACAGCCTCAG | (GCA)8…(ACA)5…(ACA)8 | 57 | 164 | 1 (164) | KF048044 | bZIP transcription factor bZIP28 |
| R: CAGCAGGGTGATGATGAATA | |||||||
| Fir_SSR25d | F: CCGTTGACATCTGTAATATCTC | (TTC)6…(TC)6 | 57 | 156 | 8 (145–177) | KF048045 | nudix hydrolase chloroplastic-like |
| R: GCTGGACATGGTGGTTAG | |||||||
| Fir_SSR28d | F: TGGCATCTTCAAGGCATTA | (ACC)6…(CAG)6 | 55 | 149 | 7 (133–166) | KF048046 | probable calcium-binding protein CML48-like |
| R: GCTGTGACTAGGAGGAGA | |||||||
| Fir_SSR32e | F: CGTGGAGAGTCATCTTGG | (TC)7…(CA)6 | 50 | 204 | 5 (202–210) | KF048047 | exostosin-like protein |
| R: GGTAGTTCTACTTGATCGGATA | |||||||
| Fir_SSR59d | F: CAATTACTCTACTCAGCATC | (CT)10 | 50 | 181 | 11 (172–202) | KF048048 | ubiquitin-conjugating enzyme E2-18 |
| R: GTGTGGAGGTTATGACTAA | |||||||
| Fir_SSR63e | F: GAAACTCGTGAAACAGGAAA | (AG)10 | 50 | 214 | 9 (199–223) | KF048049 | scarecrow-like protein 14-like |
| R: TGGAAGAACAGTGAAGAAGA | |||||||
| Fir_SSR80e | F: CTTGGCTGCTTCAGAGTG | (AG)9 | 50 | 214 | 8 (212–226) | KF048050 | orange protein |
| R: TTGGAGTAGTATATGTGGTGAG | |||||||
| Fir_SSR81d | F: CTGTCAATCAAATCCCTTCA | (AG)9 | 50 | 167 | 5 (159–173) | KF048051 | SWIB/MDM2 domain-containing protein |
| R: ATTCCTTCCACTGTGTCTT | |||||||
| Fir_SSR83e | F: TACACGATTAGCAGCAGAA | (AG)9 | 50 | 216 | 10 (211–239) | KF048052 | probable lactoylglutathione lyase, chloroplast-like |
| R: AGCAGAGAAGGAGAGGAG | |||||||
| Fir_SSR85e | F: CTACTGTTCGGCTACTCAA | (TC)9 | 50 | 189 | 1 (189) | KF048053 | disease resistance protein RPS2 |
| R: AGATAGAGAAGAAGGCTGAC | |||||||
| Fir_SSR93e | F: GCAGTCAACATGAACTTACT | (TG)9 | 50 | 115 | 13 (107–159) | KF313464 | no hit |
| R: CTTGCCATCTCCATACCAT | |||||||
| Fir_SSR98d | F: TCGGAATTGGTTGTTCAGA | (CA)9 | 50 | 250 | 3 (238–256) | KF048055 | virion binding |
| R: GAGGTGCAAGCTCAGATT | |||||||
| Fir_SSR101e | F: CGGTTACAGGTGTTGAGTT | (CT)9 | 57 | 181 | 6 (179–195) | KF313465 | mitochondrial carrier |
| R: TTACGGCGAGGCAGATAA |
Note: F = forward primer; R = reverse primer; Ta = annealing temperature.
Ellipses in repeat motifs signify intervening non-repeat sequence (≤100 bp) between two microsatellite repeats.
Values from F. danxiaensis, F. kwangsiensis, F. hainanensis, and F. simplex.
Annotation of putative homology acquired by searching the National Center for Biotechnology Information (NCBI) nonredundant database with BLASTX with the expected value <10−10.
Primers labeled with the fluorescent tag 6-FAM.
Primers labeled with the fluorescent tag HEX.
Polymorphisms of these primer sets were assessed in four Firmania species. Among them, F. danxiaensis was collected from Mt. Danxia, Guangdong Province (25°01′Ν, 113°44′Ε); F. hainanensis was collected from Jianfengling and Bawangling, Hainan Province (18°45′Ν, 108°53′Ε; 19°07′Ν, 109°07′Ε); F. kwangsiensis was collected from Jingxi County, Guangxi Province (23°00′Ν, 106°40′Ε); and F. simplex was collected from Taroko National Park, Taiwan (24°10′Ν, 121°31′Ε), Mt. Malan, Shenzhen (22°37′Ν, 114°19′Ε), and Daye, Hubei Province (30°04′Ν, 114°56′Ε). Voucher specimens for the four species were deposited at the Herbarium of Sun Yat-sen University (Appendix 1). We extracted the genomic DNA for all individuals from silica-dried leaves using a modified cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle, 1987). For the 102 primer pairs, we first selected three individuals of each species to screen universal primers for all four Firmiana species. PCR amplifications were performed in 20-μL reaction volumes, containing 25 ng of genomic DNA, 2 μL 10× buffer (with Mg2+), 0.25 mM of dNTPs, 0.2 μM of each primer, and 1 U of Easy-Taq DNA polymerase (TransGen Biotech Co. Ltd., Beijing, China). The PCR reactions were conducted with the following conditions: initial denaturing at 94°C for 2 min; followed by 35 cycles of 94°C for 30 s, appropriate annealing temperature (Table 1) for 30 s, and 72°C for 40 s; and a final extension at 72°C for 5 min. The PCR products were first electrophoresed on a 10% polyacrylamide denaturing gel and visualized by silver nitrate staining. The band size was estimated by comparison with a 25-bp DNA ladder (Fermentas, Vilnius, Lithuania). Of the 102 primer sets, 17 were successfully amplified in the four Firmiana species (Table 1).
The above 17 primer sets were then labeled with fluorescent dye, and PCR amplifications were carried out for the 32 individuals of the four Firmiana species (eight for each species). Their PCR products were analyzed on an Applied Biosystems 3730xL DNA Analyzer (Applied Biosystems, Foster City, California, USA), and the allele size was estimated using Peak Scanner Software version 1.0 (Applied Biosystems). The genetic diversity indices, including the number of alleles (A), observed heterozygosity (Ho), and expected heterozygosity (He), were calculated using the software POPGENE (Yeh and Boyle, 1997). The results showed 14 of these 17 primer sets were polymorphic in at least one Firmiana species. A ranged from one to three in F. danxiaensis, from one to seven in F. kwangsiensis, from one to eight in F. hainanensis, and from one to nine in F. simplex. Ho and He ranged from 0 to 0.500 and 0 to 0.592 in F. danxiaensis, from 0 to 1 and 0 to 0.833 in F. kwangsiensis, from 0 to 0.875 and 0 to 0.883 in F. hainanensis, and from 0 to 0.750 and 0 to 0.925 in F. simplex, respectively (Table 2).
Table 2.
Results of initial primer screening in four Firmiana species.
| F. danxiaensis (N = 8) | F. kwangsiensis (N = 8) | F. hainanensis (N = 8) | F. simplex (N = 8) | |||||||||
| Locus | A | Ho | He | A | Ho | He | A | Ho | He | A | Ho | He |
| Fir_SSR2 | 2 | 0.250 | 0.233 | 3 | 1.000 | 0.633 | 2 | 0.250 | 0.233 | 5 | 0.500 | 0.800 |
| Fir_SSR5 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 |
| Fir_SSR9 | 2 | 0.125 | 0.125 | 7 | 0.875 | 0.833 | 4 | 0.875 | 0.692 | 3 | 0.375 | 0.592 |
| Fir_SSR12 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 4 | 0.750 | 0.650 | 5 | 0.625 | 0.808 |
| Fir_SSR16 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 |
| Fir_SSR25 | 2 | 0.125 | 0.125 | 2 | 1.000 | 0.533 | 5 | 0.875 | 0.825 | 5 | 0.375 | 0.608 |
| Fir_SSR28 | 3 | 0.250 | 0.342 | 1 | 0.000 | 0.000 | 3 | 0.250 | 0.425 | 4 | 0.375 | 0.692 |
| Fir_SSR32 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 3 | 0.250 | 0.433 | 4 | 0.125 | 0.725 |
| Fir_SSR59 | 3 | 0.500 | 0.433 | 4 | 0.375 | 0.642 | 4 | 0.250 | 0.517 | 5 | 0.250 | 0.758 |
| Fir_SSR63 | 3 | 0.250 | 0.567 | 5 | 0.875 | 0.758 | 2 | 0.375 | 0.525 | 6 | 0.250 | 0.783 |
| Fir_SSR80 | 2 | 0.125 | 0.125 | 1 | 0.000 | 0.000 | 5 | 0.500 | 0.708 | 5 | 0.125 | 0.758 |
| Fir_SSR81 | 2 | 0.125 | 0.125 | 3 | 0.000 | 0.700 | 3 | 0.125 | 0.242 | 4 | 0.375 | 0.675 |
| Fir_SSR83 | 2 | 0.125 | 0.125 | 3 | 0.375 | 0.342 | 4 | 0.750 | 0.742 | 9 | 0.750 | 0.925 |
| Fir_SSR85 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 |
| Fir_SSR93 | 3 | 0.250 | 0.242 | 4 | 0.500 | 0.675 | 8 | 0.750 | 0.883 | 4 | 0.375 | 0.642 |
| Fir_SSR98 | 3 | 1.000 | 0.592 | 2 | 0.625 | 0.525 | 2 | 0.625 | 0.458 | 1 | 0.000 | 0.000 |
| Fir_SSR101 | 2 | 0.125 | 0.125 | 3 | 1.000 | 0.633 | 2 | 0.375 | 0.458 | 6 | 0.625 | 0.733 |
Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity.
CONCLUSIONS
In our study, 17 EST-SSRs were identified from the transcriptome of F. danxiaensis and were amplified in three other Firmiana species. Because the four species of Firmiana belong to different clades, these 17 SSR markers show good transferability in the genus. These polymorphic markers are valuable for conservation genetic studies in these endangered Firmiana species.
Supplementary Material
Appendix
Appendix 1.
Voucher specimen information for taxa used in this study. Specimens are deposited at the Herbarium of Sun Yat-sen University (SYSU), China.
| Species | Voucher specimen collection no. | Collection locale |
| F. danxiaensis | Q. Fan 9610 | Guangdong |
| F. kwangsiensis | Q. Fan 11295 | Guangxi |
| F. hainanensis | Q. Fan 11310 | Hainan |
| Q. Fan 11325 | Hainan | |
| F. simplex | Fan and Chen 1209 | Guangdong |
| Fan and Sun 1210 | Guangdong | |
| Fan and Shi 0502 | Taiwan |
LITERATURE CITED
- Chen S. F., Zhou R. C., Huang Y. L., Yang G. L., Zhong C. R., Shi S. H. 2011. Transcriptome sequencing of a highly salt tolerant mangrove species Sonneratia alba using Illumina platform. Marine Genomics 4: 129–136 [DOI] [PubMed] [Google Scholar]
- Conesa A., Gotz S. 2008. Blast2GO: A comprehensive suite for functional analysis in plant genomics. International Journal of Plant Genomics 2008: 1–12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Doyle J. J., Doyle J. L. 1987. A rapid DNA isolation procedure from small quantities of fresh leaf tissues. Phytochemical Bulletin 19: 11–15 [Google Scholar]
- Grabherr M. G., Haas B. J., Yassour M., Levin J. Z., Thompson D. A., Amit I., Adiconis X., et al. 2011. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nature Biotechnology 29: 644–652 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kostermans A. J. G. H. 1957. The genus Firmiana Marsili (Sterculiaceae). Reinwardtia 4: 281–310 [Google Scholar]
- Mabberley D. J. 1997. The plant-book: A portable dictionary of the vascular plants, 2nd ed. Cambridge University Press, New York, New York, USA [Google Scholar]
- Rozen S., Skaletsky H. 2000. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
- Tang Y., Michael G. G., Laurence J. D. 2007. Sterculiaceae. In C. Y. Wu, P. H. Raven, and D. Y. Hong [eds.], Flora of China, vol. 12. Science Press, Beijing, China, and Missouri Botanical Garden Press, St. Louis, Missouri, USA. [Google Scholar]
- Wang S., Xie Y. 2004. China Species Red List, vol. 1. Higher Education Press, Beijing, China [Google Scholar]
- Yeh F. C., Boyle T. J. B. 1997. Population genetic analysis of codominant and dominant markers and quantitative traits. Belgian Journal of Botany 129: 157 [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
