Abstract
• Premise of the study: Southern barberry or calafate (Berberis microphylla) is a shrub species endemic to the Patagonian region of South America that is used for human consumption. The fruit is very rich in vitamin C and anthocyanins and has a very high antioxidant capacity. There have been only a few genetic studies of this and other closely related species.
• Methods and Results: Here we present the first 18 microsatellite markers of B. microphylla that were characterized using 66 accessions of calafate from Patagonia. On average, they had 7.6 alleles per marker, with an expected heterozygosity of 0.688. The informativeness of these markers was also evaluated in another 15 Berberis species, including most of the native and endemic Chilean species.
• Conclusions: The results confirm that these new simple sequence repeat markers are very polymorphic and potentially useful in genetic studies in any species of the genus Berberis.
Keywords: Berberidaceae, Berberis microphylla, genetic diversity, microsatellite, simple sequence repeat
The southern barberry or calafate (Berberis microphylla G. Forst.) is a shrub native to the Southern Cone of South America (Chilean and Argentinean Patagonia). It belongs to the mostly temperate family Berberidaceae, composed of 15 genera and approximately 650 species (Landrum, 1999). There are 60 described species in South America, 20 of which are found in Argentina and Chile and half of these are endemic to Chile (Landrum, 1999). Orsi (1984) recognized 17 Berberis L. species in Patagonia, while Landrum (1999) grouped a number of species into a single taxon. Such is the case of B. heterophylla Juss. ex Poir. and B. buxifolia Lam., which are recognized as synonyms of B. microphylla (Landrum, 1999). The main problems for the taxonomy of this genus are phenotypic similarity and plasticity, in addition to the hypothetical presence of hybrids exhibiting intermediate phenotypes and genotypes between different species (Bottini et al., 2007).
Calafate fruits are considered one of the richest in vitamin C and anthocyanins among native Chilean species (Ruiz et al., 2010). The genus Berberis has been reported as tolerant to low temperature, drought, and wind, and consequently B. microphylla is a candidate species for domestication and cultivation in marginal Patagonian soils. To date, there have been only a few genetic studies of this species, mainly based on amplified fragment length polymorphism–type markers and ribosomal intergenic sequences (Bottini et al., 2002, 2007). In this work, we present the development of the first microsatellite or simple sequence repeat (SSR) markers known for this species, obtained through massive sequencing of genomic DNA and enriched libraries. SSRs are powerful tools to evaluate the genetic diversity and genetic structure of populations, to identify specific genotypes (varieties), and for paternity tests. This is because they are widely dispersed in the genome, highly polymorphic, codominant, and reproducible (Kalia et al., 2011). In this context, the main interest for developing these markers is to study the genetic diversity of this and related species, to explore their reproductive and propagative form, and eventually to identify single specimens in the framework of domestication programs.
METHODS AND RESULTS
To isolate microsatellites, genomic DNA was pooled from three samples of B. microphylla (accession no. 59, 64, and 66; see Appendix 1), from Magallanes, Chile. These plants were collected from the same locations as described previously (Dominguez and Aravena, 2012) and deposited at the Herbarium of Universidad de Concepción, Concepción, Chile (CONC 948). Samples belonging to the other Berberis species were identified by comparison to specimens deposited in the same herbarium (CONC). Total DNA was extracted from young stems, green fruits, and seeds following the protocol described by Lodhi et al. (1994), scaled down to a microtube. In brief, 0.1 g of tissue was milled in an automatic grinder with steel balls plus 700 μL of extraction buffer (20 mM EDTA, 100 mM Tris-HCl, 1.4 M NaCl, 2% [w/v] cetyltrimethylammonium bromide [CTAB], 10 mg PVP 40,000, 0.2% [v/v] 2-mercaptoethanol; pH 8.0) and incubated at 60°C for 30 min, followed by extraction with chloroform : isoamyl alcohol (24:1). Total DNA was precipitated using absolute ethanol precooled at −20°C. The precipitate was washed twice with 70% ethanol, and the pellet was dissolved in 50 μL of nuclease-free water containing RNase A at 0.1 μg/mL. A final incubation at 37°C for 15 min was done before storing the DNA solution at −20°C. The purified total DNA was quantified by spectrophotometric absorbance (NanoDrop ND-1000; Thermo Fisher Scientific, Wilmington, Delaware, USA) and its quality verified by agarose gel electrophoresis.
For the isolation of microsatellite-containing DNA sequences, the pooled DNA sample from Patagonian accessions of B. microphylla (40 μL, 250 ng/μL) was sent to Ecogenics GmbH (Zürich-Schlieren, Switzerland). Size-selected fragments from genomic DNA were directly analyzed on a Roche 454 platform using the GS FLX Titanium reagents (454 Life Sciences, a Roche Company, Branford, Connecticut, USA). Forty-six out of 13,230 reads (average length of 323 bp) harbored a microsatellite insert with a tetra- or a trinucleotide of at least six repeat units or a dinucleotide of at least 10 repeat units. Suitable primer design was possible in 33 reads. In a second approach, also done at Ecogenics GmbH, size-selected fragments from mechanically sheared genomic DNA were enriched for SSR content by using magnetic streptavidin beads and biotin-labeled CT and GT repeat oligonucleotides. The SSR-enriched library was analyzed on a Roche 454 platform using the GS FLX Titanium reagents (454 Life Sciences, a Roche Company). The total of 11,238 reads had an average length of 324 bp. Of these, 413 contained a microsatellite insert with a tetra- or a trinucleotide of at least six repeat units or a dinucleotide of at least 10 repeat units. Suitable primer design was possible in 128 reads (Rozen and Skaletsky, 2000). Primers were synthesized at Integrated DNA Technologies (Coralville, Iowa, USA). Their ability to amplify and produce variably sized fragments was evaluated on three DNA samples of B. microphylla (accession no. 108, 111, and 116; Appendix 1) representative of the geographical distribution of the species. PCR contained 30 ng of DNA, 1× Colorless GoTaq Flexi Buffer (Promega Corporation, Madison, Wisconsin, USA), 2 mM MgCl2, 250 μM dNTPs, primers (5 μM each), and 0.5 U of Taq polymerase (GoTaq Flexi DNA, Promega Corporation). PCR cycling, after an initial denaturation of 3 min at 94°C, was as follows: 35 cycles of 30 s at 94°C, 30 s at 56°C, and 60 s at 72°C. Reactions were completed by incubating at 72°C for 4 min. PCR product separation and silver-staining was done as described by Narváez et al. (2001). The PCR protocol was the same for every sample considered in this study.
Of the 161 SSR-containing fragments identified, 88 were repeated twice or more. Of the remaining 73 unique sequences, 18 primer pairs generated easily scorable allelic patterns and were evaluated on 66 B. microphylla accessions collected from Chilean Patagonia (Appendix 1). Allele numbers ranged from two to 19, with an average of 7.6 alleles per marker. Table 1 summarizes the statistics for these markers, including heterozygosity (observed heterozygosity ranging from 0.164 to 1.0, with an average of 0.701; expected heterozygosity from 0.448 to 0.854, average of 0.668), repeat motifs, allele sizes, probability of confusion (i.e., the probability that two randomly chosen individuals have the same allelic pattern [Tessier et al., 1999]), and GenBank accession numbers. Finally, the markers developed in this work exhibited a very high level of interspecific transferability, evaluated with 15 other Berberis species, the majority of them from Chile (Table 2, Appendix 1). Another set of SSR markers developed in the related species Mahonia aquifolium (Pursh) Nutt. (Ross and Durka, 2006) was less informative when evaluated in B. microphylla from Chilean Patagonia (results not shown).
Table 1.
Microsatellites of Berberis microphylla characterized in 66 accessions from Chilean Patagonia.a
| Locus | Primer sequences (5′–3′) | Repeat motif | Size range (bp) | A | Ho | He | Cj | GenBank accession no. |
| BmLP-05 | F: AACACCTGGTTCAACTTGCG | (TTC)9 | 110−130 | 7 | 0.84 | 0.79 | 0.19 | JX481194 |
| R: TGCTGCTACTGACTCTTCCG | ||||||||
| BmLP-07 | F: CGAAAATCTCGGGAATGGGC | (TGA)7 | 110−140 | 7 | 0.85 | 0.67 | 0.32 | JX481196 |
| R: TGCCTGAAAAGTGTTGGCAC | ||||||||
| BmLP-09 | F: CATCCATCTCTTGGGAATTCAAC | (CAT)8 | 110−130 | 7 | 0.93 | 0.71 | 0.28 | JX481198 |
| R: CGAAAATCTCGGGAATGGGC | ||||||||
| BmLP-11 | F: GGAAGGAGAGCGAAAATCGAC | (ATC)10 | 90−120 | 6 | 0.85 | 0.73 | 0.26 | JX481200 |
| R: TGAGATGAAGGCATACATGAGC | ||||||||
| BmLP-19.2 | F: TCACTTCAACCCCCTCTTCG | (ACA)9 | 150−180 | 10 | 0.63 | 0.71 | 0.27 | JX481207 |
| R: ACAGTGGAAGGTCTGCTCTG | ||||||||
| BmLP-26 | F: TGTAAGCCTTCATGGGCTCC | (AC)12 | 120−180 | 6 | 0.57 | 0.75 | 0.23 | JX481214 |
| R: GGGGCGAACCAGATCAGC | ||||||||
| BmLP-30 | F: ACTTCTCATACCCTGACGGC | (CA)11 | 220−250 | 6 | 0.76 | 0.71 | 0.28 | JX481218 |
| R: GAGTGAACCTTGACAATAAGTTGG | ||||||||
| BmLP-36 | F: TCAAAATCTGGTGGCTCTGC | (TG)13 | 190−230 | 8 | 0.80 | 0.76 | 0.23 | JX481224 |
| R: AAAGGGCTCCCCTGAAAATG | ||||||||
| BmLP-38 | F: CGAGGAAAATGGCCTAGAAGAC | (TG)11 | 270−300 | 7 | 0.79 | 0.72 | 0.26 | JX481226 |
| R: AGCTAAGGCTGTGTAGGGTG | ||||||||
| BmLP-39 | F: GTTTGTGGGGGTGGTGAAAG | (TC)11 | 130−170 | 6 | 0.25 | 0.47 | 0.53 | JX481227 |
| R: ACTTGCAGAAGAGAATTGTGTG | ||||||||
| BmLP-46 | F: TGCCTGAATTCTTGCTCGAC | (CA)12 | 210−240 | 6 | 0.23 | 0.51 | 0.48 | JX481234 |
| R: GGCAAAGGACTCTTGTGTCTG | ||||||||
| BmLP-49 | F: TTTGTCTACGGATCCCACCC | (AC)12 | 140−180 | 6 | 0.67 | 0.71 | 0.28 | JX481238 |
| R: TGCTTAGCTCATGTGTCCTTG | ||||||||
| BmLP-53 | F: GGACAACCCTGTTTCCTCAC | (GT)13 | 230−260 | 2 | 0.16 | 0.45 | 0.43 | JX481241 |
| R: AACGACACCAAAATACCGGC | ||||||||
| BmLP-54 | F: CCAAGGCTGTCGGAAATGTG | (AGA)7 | 200−270 | 7 | 0.97 | 0.80 | 0.19 | JX481243 |
| R: GAGCTAGTCTCCTTCCGTCC | ||||||||
| BmLP-58.2 | F: AAACCCTTTAGTGGGGCGAC | (CTT)8 | 100−150 | 5 | 0.58 | 0.50 | 0.50 | JX481248 |
| R: AGGATCGCTGGTGTACTTGG | ||||||||
| BmLP-59 | F: CTAACGCATGCCATTGTTCAC | (GT)11 | 110−130 | 6 | 0.78 | 0.71 | 0.28 | JX481249 |
| R: CGATGATGACTTCTTAAATGTTCCG | ||||||||
| BmLP-65 | F: TTGCAATGAACCTGGCTCTG | (AC)12 | 200−260 | 16 | 1.00 | 0.85 | 0.14 | JX481255 |
| R: TTGGTGCAAATCAGCTCAAC | ||||||||
| BmLP-71 | F: TCGTGGTGGTAACAGAGAGG | (CA)13 | 120−160 | 19 | 0.95 | 0.85 | 0.13 | JX481261 |
| R: AAGATGCAAGTGGTGTTGTG |
Note: A = number of alleles; Cj = probability of confusion (Tessier et al., 1999); He = expected heterozygosity; Ho = observed heterozygosity.
Annealing temperature was the same for all markers (56°C).
Table 2.
Interspecific transferability of Berberis microphylla microsatellite markers.
| Species | BmLP-05 | BmLP-07 | BmLP-09 | BmLP-11 | BmLP-19.2 | BmLP-26 | BmLP-30 | BmLP-36 | BmLP-38 | BmLP-39 | BmLP-46 | BmLP-49 | BmLP-53 | BmLP-54 | BmLP-58.2 | BmLP-59 | BmLP-65 | BmLP-71 | GA- 33a | GA-04a |
| B. thunbergii DC. | + | + | + | ++ | +/− | + | + | — | ++ | + | + | ++ | + | + | ++ | + | + | + | + | + |
| B. vulgaris L. | + | + | + | ++ | — | + | + | + | ++ | + | + | + | + | + | + | + | + | + | + | — |
| B. montana Gay | + | + | + | ++ | + | ++ | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
| B. corymbosa Hook. & Arn. | — | +/− | + | +/− | — | — | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
| B. serratodentata Lechl. | — | + | + | +/− | + | — | + | — | + | — | + | + | + | + | + | + | + | + | + | — |
| B. negeriana Tischler | + | + | + | + | ++ | — | ++ | + | + | + | + | + | + | — | + | + | — | + | + | — |
| B. sp. 1b | + | ++ | + | + | ++ | + | + | + | + | + | + | — | + | + | + | + | + | + | + | + |
| B. sp. 2b | + | + | + | + | ++ | — | + | + | + | + | + | + | — | + | ++ | + | + | + | + | - |
| B. ilicifolia L. f. | + | + | + | + | + | — | + | - | + | + | + | +/− | +/− | + | + | + | + | + | + | + |
| B. litoralis Phil. | + | + | + | +/− | + | — | ++ | + | + | + | + | + | + | + | + | — | + | + | + | + |
| B. trigona Kunze ex Poepp. & Endl. | + | + | + | +/− | + | — | + | — | + | + | + | + | + | + | + | + | — | + | + | + |
| B. horrida Gay | + | + | +/− | + | + | + | + | +/− | + | + | + | + | + | + | + | + | + | + | + | + |
| B. chilensis Gillies ex Hook. & Arn. | + | + | + | + | — | + | ++ | + | ++ | + | + | + | + | + | + | + | + | + | + | + |
| B. empetrifolia Lam. | + | + | +/− | + | + | + | + | + | + | + | + | + | + | + | + | + | + | ++ | + | + |
| B. microphylla G. Forst.c | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
| B. darwinii Hook. | + | — | +/− | + | + | + | + | + | + | + | + | + | — | + | + | + | + | ++ | + | + |
Note: ++ = clear, strong PCR signal; + = fairly good PCR signal; +/− = weak PCR signal; — = no amplicon detected.
GA markers are from Mahonia aquifolium.
Unidentified species.
Sample no. 76 (laboratory code 287), see Appendix 1.
CONCLUSIONS
We have identified and characterized 18 new SSR markers from B. microphylla, all of them highly polymorphic and informative in every Berberis species tested, including most of the endemic and native Chilean species and two Old World species. This set of 18 markers appears more polymorphic than the ones recently developed for B. thunbergii DC. (Allen et al., 2012) that were evaluated with 24 accessions of that species and had an average of 4.4 alleles per marker. The markers described in this work can be used for genetic diversity and related studies among species of Berberidaceae.
Appendix
Appendix 1.
List of accessions used in this work and their region of origin and GPS location.a
| No. of sample | Laboratory code | Species | Region of collection | GPS location | Notes |
| 1 | 4 | B. microphylla | Región de Magallanes | 52°42′10.02″S, 70°55′34.77″W | |
| 2 | 12 | B. microphylla | Región de Magallanes | 52°41′58.89″S, 70°55′32.00″W | |
| 3 | 34 | B. microphylla | Región de Aysén | 45°58′31.6″S, 71°52′25.03″W | |
| 4 | 42 | B. microphylla | Región de Aysén | 45°39′59.70″S, 72°12′20.29″W | |
| 5 | 44 | B. microphylla | Región de Aysén | 45°43′14.21″S, 72°02′26.14″W | |
| 6 | 45 | B. microphylla | Región de Aysén | 45°39′59.92″S, 72°12′19.46″W | |
| 7 | 47 | B. microphylla | Región de Aysén | 45°40′00.11″S, 72°12′19.58″W | |
| 8 | 51 | B. microphylla | Región de Magallanes | 52°42′08.03″S, 70°55′15.29″W | |
| 9 | 52 | B. microphylla | Región de Magallanes | 52°42′06.90″S, 70°55′11.79″W | |
| 10 | 53 | B. microphylla | Región de Magallanes | 52°42′10.50″S, 70°55′12.36″W | |
| 11 | 54 | B. microphylla | Región de Magallanes | 52°42′11.18″S, 70°55′16.60″W | |
| 12 | 59 | B. microphylla | Región de Magallanes | 49°15′29.48″S, 74°05′51.84″W | |
| 13 | 60 | B. microphylla | Región de Magallanes | 52°04′07.45″S, 69°46′59.27″W | |
| 14 | 63 | B. microphylla | Región de Magallanes | 52°04′16.15″S, 69°47′48.63″W | |
| 15 | 64 | B. microphylla | Región de Magallanes | 52°03′46.73″S, 69°48′11.96″W | |
| 16 | 66 | B. microphylla | Región de Magallanes | 52°31′25.33″S, 69°56′20.55″W | |
| 17 | 69 | B. microphylla | Región de Magallanes | 52°49′34.08″S, 70°59′18.47″W | |
| 18 | 78 | B. microphylla | Región del Biobío | 36°54′25.78″S, 71°25′32.96″W | |
| 19 | 79 | B. microphylla | Región del Biobío | 36°55′17.32″S, 71°26′34.91″W | |
| 20 | 80 | B. microphylla | Región del Biobío | 36°35′40.46″S, 71°45′15.66″W | |
| 21 | 82 | B. microphylla | Región de Magallanes | 53°10′15.90″S, 70°23′32.47″W | |
| 22 | 84 | B. microphylla | Región de Magallanes | 53°03′01.46″S, 70°12′55.53″W | |
| 23 | 85 | B. microphylla | Región de Magallanes | 52°59′42.72″S, 70°06′56.37″W | |
| 24 | 86 | B. microphylla | Región de Magallanes | 52°54′47.08″S, 70°02′12.39″W | |
| 25 | 87 | B. microphylla | Región de Magallanes | 52°51′37.61″S, 69°55′06.05″W | |
| 26 | 88 | B. microphylla | Región de Magallanes | 52°49′38.68″S, 69°47′13.26″W | |
| 27 | 89 | B. microphylla | Región de Magallanes | 52°46′12.90″S, 69°41′26.37″W | |
| 28 | 90 | B. microphylla | Región de Magallanes | 52°41′10.26″S, 69°34′46.61″W | |
| 29 | 91 | B. microphylla | Región de Magallanes | 52°38′04.22″S, 69°30′40.60″W | |
| 30 | 92 | B. microphylla | Región de Magallanes | 52°32′04.96″S, 69°26′05.49″W | |
| 31 | 93 | B. microphylla | Región de Magallanes | 52°29′40.57″S, 69°31′28.74″W | |
| 32 | 107 | B. microphylla | Región de Aysén | 46°32′38.19″S, 71°41′28.73″W | |
| 33 | 108 | B. microphylla | Región de Aysén | 45°42′50.38″S, 72°02′49.83″W | |
| 34 | 109 | B. microphylla | Región de Aysén | 46°18′16.18″S, 71°54′21.08″W | |
| 35 | 111 | B. microphylla | Región de Aysén | 46°29′59.30″S, 71°50′55.81″W | |
| 36 | 113 | B. microphylla | Región de Aysén | 46°15′25.79″S, 71°55′47.71″W | |
| 37 | 114 | B. microphylla | Región de Aysén | 46°09′42.34″S, 72°10′33.85″W | |
| 38 | 116 | B. microphylla | Región de Magallanes | 53°39′15.25″S, 70°57′10.20″W | |
| 39 | 128 | B. microphylla | Región de Magallanes | 53°17′17.78″S, 70°56′54.25″W | |
| 40 | 131 | B. microphylla | Región de Magallanes | 53°16′12.66″S, 70°57′05.63″W | |
| 41 | 134 | B. microphylla | Región de Magallanes | 53°48′23.15″S, 71°12′31.76″W | |
| 42 | 137 | B. microphylla | Región de Magallanes | 53°24′32.57″S, 71°15′16.68″W | |
| 43 | 152 | B. microphylla | Región de Magallanes | 53°10′59.80″S, 71°01′35.85″W | |
| 44 | 156 | B. empetrifolia | Región de Magallanes | 52°42′18.35″S, 70°55′36.26″W | |
| 45 | 159 | B. microphylla | Región de Magallanes | 52°41′45.05″S, 70°54′01.37″W | |
| 46 | 163 | B. microphylla | Región de Magallanes | 52°41′42.72″S, 70°54′52.76″W | |
| 47 | 165 | B. microphylla | Región de Magallanes | 52°41′44.29″S, 70°54′42.94″W | |
| 48 | 171 | B. microphylla | Región de Magallanes | 52°57′52.03″S, 71°08′57.80″W | |
| 49 | 183 | B. microphylla | Región de Magallanes | 52°59′25.22″S, 70°52′48.97″W | |
| 50 | 184 | B. microphylla | Región de Magallanes | 52°59′22.89″S, 70°49′07.81″W | |
| 51 | 185 | B. microphylla | Región de Magallanes | 53°00′32.40″S, 70°49′17.01″W | |
| 52 | 188 | B. microphylla | Región de Magallanes | 52°54′11.28″S, 71°06′26.57″W | |
| 53 | 193 | B. microphylla | Región de Magallanes | 52°48′36.20″S, 71°12′20.15″W | |
| 54 | 237 | B. microphylla | Región de Aysén | 46°36′59.06″S, 72°40′45.57″W | |
| 55 | 239 | B. microphylla | Región de Aysén | 46°17′08.99″S, 71°56′08.26″W | |
| 56 | 241 | B. microphylla | Región de Aysén | 46°17′46.52″S, 71°54′39.26″W | |
| 57 | 243 | B. microphylla | Región de Aysén | 46°18′19.32″S, 71°53′05.28″W | |
| 58 | 245 | B. microphylla | Región de Aysén | 45°42′15.37″S, 72°04′08.60″W | |
| 59 | 247 | B. microphylla | Región de Aysén | 45°42′32.22″S, 72°04′25.87″W | |
| 60 | 249 | B. microphylla | Región de Aysén | 45°42′27.08″S, 72°04′53.02″W | |
| 61 | 251 | B. microphylla | Región de Aysén | 45°40′06.26″S, 72°11′51.46″W | |
| 62 | 253 | B. microphylla | Región de Aysén | 46°30′54.73″S, 71°51′14.25″W | |
| 63 | 255 | B. microphylla | Región de Aysén | 47°31′25.55″S, 71°51′15.01″W | |
| 64 | 257 | B. microphylla | Región de Aysén | 46°33′02.66″S, 71°41′49.37″W | |
| 65 | 259 | B. microphylla | Región de Aysén | 46°37′56.89″S, 72°40′00.44″W | |
| 66 | 266 | B. microphylla | Región de Magallanes | 53°49′11.64″S, 70°10′24.27″W | |
| 67 | 39 | B. darwinii | Región de Aysén | 45°46′55.35″S, 72°11′00.37″W | |
| 68 | 72 | B. vulgaris | Región del Biobío | 36°49′40.79″S, 73°02′13.11″W | European origin, collected at the gardens of Universidad de Concepción, Concepción, Chile |
| 69 | 155 | B. ilicifolia | Región de Magallanes | 53°09′30.03″S, 71°01′18.23″W | |
| 70 | 262 | B. thunbergii | Región Metropolitana | 33°34′09.05″S, 70°37′52.97″W | European origin, obtained from the Plant Nursery of the Agronomy Faculty, Universidad de Chile, Santiago, Chile |
| 71 | 271 | B. sp. 1 | Región Metropolitana | 33°26′07.98″S, 70°30′40.77″W | |
| 72 | 273 | B. litoralis | Región de Antofagasta | 23°40′30.06″S, 70°18′15.42″W | |
| 73 | 278 | B. sp. 2 | Región Metropolitana | 33°26′06.69″S, 70°30′04.96″W | |
| 74 | 284 | B. chilensis | Región del Maule | 35°36′56.84″S, 71°00′41.56″W | |
| 75 | 286 | B. microphylla | Región de Magallanes | 52°46′38.40″S, 71°51′26.91″W | |
| 76 | 287 | B. microphylla | Región de Aysén | 46°36′29.93″S, 72°40′53.23″W | |
| 77 | 288 | B. microphylla | Región de los Lagos | 42°16′34.36″S, 73°42′58.81″W | |
| 78 | 289 | B. microphylla | Región del Biobío | 36°54′32.39″S, 71°24′33.51″W | |
| 79 | 318 | B. trigona | Región de la Araucanía | 39°24′52.59″S, 72°02′50.34″W | |
| 80 | 323 | B. serratodentata | Región de la Araucanía | 39°24′14.07″S, 72°03′32.76″W | |
| 81 | 367 | B. negeriana | Región del Biobío | 36°52′16.12″S, 72°59′36.10″W | |
| 82 | 386 | B. montana | Región del Biobío | 36°54′45.32″S, 71°24′41.48″W | |
| 83 | 400 | B. horrida | Región Metropolitana | 33°29′33.30″S, 70°28′22.82″W | |
| 84 | 406 | B. corymbosa | Juan Fernández Archipelago, Robinson Crusoe Island | 33°38′48.45″S, 78°50′16.88″W | Preserved and collected from the Jardín Botanico Nacional, Viña del Mar, Chile |
Samples 1–66 are B. microphylla accessions used in the isolation and characterization of the markers described in this work. Samples 67–84 are the accessions used to evaluate the interspecific transferability of these markers, plus the three accessions of B. microphylla (no. 286, 288, and 289) used for the preliminary evaluation of microsatellite informativeness.
LITERATURE CITED
- Allen J. M., Obae S. G., Brand M. H., Silander J. A., Jones K. L., Nunziata S. O., Lance S. L. 2012. Development and characterization of microsatellite markers for Berberis thunbergii (Berberidaceae). American Journal of Botany 99: e220–e222 [DOI] [PubMed] [Google Scholar]
- Bottini M. C. J., De Bustos A., Jouve N., Poggio L. 2002. AFLP characterization of natural populations of Berberis (Berberidaceae) in Patagonia, Argentina. Plant Systematics and Evolution 231: 133–142 [Google Scholar]
- Bottini M. C. J., De Bustos A., Sanso A. M., Jouve N., Poggio L. 2007. Relationships in Patagonian species of Berberis (Berberidaceae) based on the characterization of rDNA internal transcribed spacer sequences. Botanical Journal of the Linnean Society 153: 321–328 [Google Scholar]
- Dominguez E., Aravena J. C. 2012. Estudio florístico del Area Marina Costera Protegida Francisco Coloane, Región de Magallanes, Chile [Floristic study of the Francisco Coloane Coastal Marine Protected Area, Región de Magallanes, Chile]. Gayana Botánica 69: 167–183 [Google Scholar]
- Kalia R., Rai M., Kalia S., Singh R., Dhawan A. 2011. Microsatellite markers: An overview of the recent progress in plants. Euphytica 177: 309–334 [Google Scholar]
- Landrum L. R. 1999. Revision of Berberis (Berberidaceae) in Chile and adjacent southern Argentina. Annals of the Missouri Botanical Garden 86: 793–834 [Google Scholar]
- Lodhi M. A., Ye G.-N., Weeden N. F., Reisch B. I. 1994. A simple and efficient method for DNA extraction from grapevine cultivars and Vitis species. Plant Molecular Biology Reporter 12: 6–13 [Google Scholar]
- Narváez H. C., Castro P. M. H., Valenzuela B. J., Hinrichsen R P. 2001. Patrones genéticos de los cultivares de vides de vinificación más comúnmente usados en Chile basados en marcadores de microsatellites [Fingerprinting of wine grape cultivars most commonly grown in Chile based on microsatellite markers]. Agricultura Técnica (Chile) 61: 249−261 [Google Scholar]
- Orsi M. C. 1984. Berberidaceae. In M. N. Correa [ed.], Flora Patagónica, Secc. 4, 325–348. Editorial INTA, Buenos Aires, Argentina. [Google Scholar]
- Ross C., Durka W. 2006. Isolation and characterization of microsatellite markers in the invasive shrub Mahonia aquifolium (Berberidaceae) and their applicability in related species. Molecular Ecology Notes 6: 948–950 [Google Scholar]
- Rozen S., Skaletsky H. 2000. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
- Ruiz A., Hermosín-Gutiérrez I., Mardones C., Vergara C., Herlitz E., Vega M., Dorau C., et al. 2010. Polyphenols and antioxidant activity of calafate (Berberis microphylla) fruits and other native berries from southern Chile. Journal of Agricultural and Food Chemistry 58: 6081–6089 [DOI] [PubMed] [Google Scholar]
- Tessier C., David J., This P., Boursiquot J.-M., Charrier A. 1999. Optimization of the choice of molecular markers for varietal identification in Vitis vinifera L. Theoretical and Applied Genetics 98: 171–177 [Google Scholar]
