Skip to main content
NCBI home page
Applications in Plant Sciences logoLink to Applications in Plant Sciences
. 2013 Jun 21;1(7):apps.1200423. doi: 10.3732/apps.1200423

Development of microsatellite loci in Artocarpus altilis (Moraceae) and cross-amplification in congeneric species1

Colby Witherup 2,3, Diane Ragone 4, Tyr Wiesner-Hanks 3, Brian Irish 5, Brian Scheffler 6, Sheron Simpson 6, Francis Zee 7, M Iqbal Zuberi 8, Nyree J C Zerega 2,3,9
PMCID: PMC4103128  PMID: 25202565

Abstract

• Premise of the study: Microsatellite loci were isolated and characterized from enriched genomic libraries of Artocarpus altilis (breadfruit) and tested in four Artocarpus species and one hybrid. The microsatellite markers provide new tools for further studies in Artocarpus.

• Methods and Results: A total of 25 microsatellite loci were evaluated across four Artocarpus species and one hybrid. Twenty-one microsatellite loci were evaluated on A. altilis (241), A. camansi (34), A. mariannensis (15), and A. altilis × mariannensis (64) samples. Nine of those loci plus four additional loci were evaluated on A. heterophyllus (jackfruit, 426) samples. All loci are polymorphic for at least one species. The average number of alleles ranges from two to nine within taxa.

• Conclusions: These microsatellite primers will facilitate further studies on the genetic structure and evolutionary and domestication history of Artocarpus species. They will aid in cultivar identification and establishing germplasm conservation strategies for breadfruit and jackfruit.

Keywords: Artocarpus altilis, Artocarpus camansi, Artocarpus heterophyllus, Artocarpus mariannensis, breadfruit, jackfruit, Moraceae

The genus Artocarpus J. R. Forst. & G. Forst. (Moraceae) contains several agriculturally significant species, breadfruit (A. altilis (Parkinson) Fosberg) and jackfruit (A. heteropyhllus Lam.) being the most widely cultivated (Zerega et al., 2010). Breadfruit is a traditional staple in Oceania, and its progenitor species are A. camansi Blanco and A. mariannensis Trécul; hybrids also exist (Zerega et al., 2004). The origin of jackfruit is unclear, but it is likely native to the Indian subcontinent (Jarrett, 1959). Even with morphological descriptors, accurate breadfruit cultivar identification remains difficult (Jones et al., 2013), and little is known about jackfruit genetic diversity (Shyamalamma et al., 2008). Despite the fact that breadfruit and jackfruit are in different Artocarpus subgenera (Zerega et al., 2010), several primers cross-amplified well and showed polymorphisms, suggesting they might be useful in additional Artocarpus species.

METHODS AND RESULTS

To construct the genomic library, leaf tissue was obtained from an A. altilis individual (voucher DR468 deposited at the National Tropical Botanical Garden [NTBG] Herbarium [PTBG], Kalaheo, Hawaii) collected from Fiji (Living Accession 900261.002 at the Breadfruit Institute, NTBG, Hawaii). DNA was extracted using the QIAGEN DNeasy Plant Mini Kit (QIAGEN, Valencia, California, USA) following standard protocol. Microsatellite libraries were developed by Genetic Identification Services (Chatsworth, California, USA), following the methods of Jones et al. (2002). The libraries were enriched for four repeat motifs—(GA)n, (CA)n, (ATG)n, and (TAGA)n. Thirty-eight clones containing microsatellites were sequenced. Using DesignerPCR version 1.03 (Research Genetics, Huntsville, Alabama, USA), 75 primer pairs were designed (approximately two pairs for each clone) and screened across 25 A. altilis and 12 A. heterophyllus individuals to test for amplification and polymorphisms. Nineteen primers for breadfruit (A. altilis) and related species (A. camansi, A. mariannensis, and A. altilis × mariannensis) and 10 primers for A. heterophyllus yielded either a single band, or two that were consistently different in size, when separated and visualized under UV light on an agarose gel stained with SYBR Green (Proligo, Hamburg, Germany). Three of these primer pairs amplified two loci of differing lengths (Tables 1 and 2). Loci MAA54a/b have conserved sequences flanking similar microsatellite sequences and may represent historical duplications that have since diverged (Karhu et al., 2000). The same is true for loci MAA178a/b. In loci MAA196a/b the microsatellite flanking sequences are not identical, but share enough similarities to allow for cross amplification. For all three primers, the two loci amplified were straightforward to score and consistently amplified in all samples. Loci 178a and 196a do not demonstrate linkage to 178b and 196b, respectively; loci 54a/b did deviate from the null hypothesis that the loci were not linked (P = 0.04), as tested in GENEPOP (Raymond and Rousset, 1995). Nineteen primers (amplifying 21 loci) were then used to evaluate 241 A. altilis, 34 A. camansi, 15 A. mariannensis, and 64 A. altilis × mariannensis samples collected from trees growing in private and public collections (Table 2, Appendix 1), and representing original collections from throughout Oceania as well as Indonesia, the Philippines, and the Seychelle Islands. Ten primers (amplifying 13 loci) were used to evaluate 426 A. heterophyllus samples collected from public collections with provenance from Thailand, Indonesia, Malaysia, Jamaica, Singapore, Australia, India, and Miami, and from private holdings in Bangladesh (Table 2, Appendices 1 and 2). Herbarium vouchers were made from representative sites in Bangladesh; accession numbers are given for samples from public living collections (Appendix 2).

Table 1.

Characteristics of 25 microsatellite loci amplified in Artocarpus species.

Locus Primer sequences (5′–3′) Repeat motifa Ta (°C)b GenBank accession no.
MAA3 F: TGTTCTAGCTGCACGAATTATG (TA)5 59.8/55.0 JX415243
R: CTTGAATCAAACAGGCCAATTA
MAA9 F: AACAGGGTTAAAATCCCTTCAC (CA)15 59.8/55.0 JX415244
R: GTTCCCGTTTTGTTCAAAGAG
MAA26 F: CATGAATGAAACAACATCAGAC (GT)9 59.8/55.0 JQ952762
R: ATAGTCATAAAGCCCTGCG
MAA40 F: AGCATTTCAGGTTGGTGAC (TG)16 59.8/55.0 JX415245
R: GTTGTTCTGTTTGCCTCATC
*MAA54a F: AACCTCCAAACACTAGGACAAC (CA)5,(AT)4 59.8/55.0 JQ952763
R: AGCTACTTCCAAAACGTGACA
*MAA54b F: AACCTCCAAACACTAGGACAAC (AT)9,(CA)6,(AT)4 59.8/55.0 JQ952764
R: AGCTACTTCCAAAACGTGACA
MAA71 F: TTCCTATTTCTTGCAGATTCTC (CT)11(CA)19 59.8/55.0 JX415246
R: AGTGGTGGTAAGATTCAAAGTG
MAA85 F: TCAGGGTGTAGCGAAGACA (CA)11 59.8/55.0 JX415247
R: AGGGCTCCTTTGATGGAA
MAA96 F: GGACCTCAAGGATGTGATCTC (CA)14(TA)7(TG)3 59.8/55.0 JX415248
R: ACACGGTCTTCTTTGGATAGC
MAA105 F: GTTGGGACACTGTGAACTATTC (GT)11 59.8/55.0 JQ952765
R: AAAAGCTAGTGGATTAGATGCA
MAA122 F: CTGGCCTTCAGTTTTGTCAAC (GT)11(GA)4,(GA)11 59.8/55.0 JQ952766
R: CACCAGGCTTCAAGATGAAA
MAA135 F: TGCATCATAAGGTTGCTCTG (AG)22 59.8/55.0 JX415249
R: TGGGCTTTTTCTGGAAAC
MAA140 F: CCATCCCCCATCTTTCCT (CT)25 59.8/55.0 JQ952767
R: TCCTCGTTTGCCACAGTG
MAA145 F: CCAACGCATAGCCAAATC (CTT)9,(GA)14,(GA)8 59.8/55.0 JQ952768
R: AAATCCCAAACCCAACGT
MAA156 F: CTGGTGCTTCAGCCTAATG (GA)3,(GA)5,(GA)8,(GA)13 59.8/55.0 JQ952769
R: TCAGCGTCAAAGATAACTCG
*MAA178a F: GATGGAGACACTTTGAACTAGC (GT)3,(GT)6,(GT)3,(GA)3,(GA)10 59.8/55.0 JQ952770
R: CACCAGGGTTTAAGATGAAAC
*MAA178b F: GATGGAGACACTTTGAACTAGC (GT)3,(GT)3,(GA)3,(GA)11 59.8/55.0 JQ952771
R: CACCAGGGTTTAAGATGAAAC
MAA182 F: TACTGGGTCTGAAAAGATGTCT (CT)19 59.8/55.0 JQ952772
R: CGTTTGCGTTTGGATAAAT
*MAA196a F: GGAATGTGGTAGATGAAACTCC (CT)11,(GA)4 59.8/55.0 JQ952773
R: CGACAAAAAAACAAAGGAAGAC
*MAA196b F: GAATGTGAGAGATAAATCTCC (CT)12 59.8/55.0 JQ952774
R: CGACAAAAAAACAAAGGAAGAC
MAA201 F: GGTTCAATTCACACATACAGG (GA)15 59.8/55.0 JX415250
R: TTGAGGCTAAAAGAATATGAGG
MAA219 F: ATTTGCATCATGTAGGACA (CAT)8 59.8/55.0 JX415251
R: GGACACAACGACATTGAC
MAA251 F: ATCGTCTTTGTCACCACCAC (ATC)10 59.8/55.0 JX415252
R: ATAGCCGAGTAACTGGATGGA
MAA287 F: CTTCCCACTAAATGTAAACG (TCTA)5 59.8/55.0 JX415253
R: TCTCAAACAATGGAGTGATC
MAA293 F: TCCCCTTCACTTTCGGAT (CTAT)6 59.8/55.0 JX415254
R: CGATTTGACCCACCATTC
Open in a new tab

Note: Ta = annealing temperature.

a

Commas indicate presence of nonrepeating nucleotides between repeats.

b

PCR was performed using a two-step process with varying annealing temperatures (see Methods and Results section).

*Primers amplified two separate loci.

Table 2.

Genetic diversity results for 25 microsatellite loci in Artocarpus species.a,b

A. altilis (diploid, n = 79) A. altilis (triploid, n = 162) A. a × m (diploid, n = 31) A. a × m (triploid, n = 33) A. camansi (n = 34) A. mariannensis (n = 15) A. heterophyllus (n = 426)c
Locus A ASR (bp) Ho He A ASR (bp) % het. A ASR (bp) Ho He A ASR (bp) % het. A ASR (bp) Ho He A ASR (bp) Ho He A ASR (bp) Ho He
MAA3 1 216 0.000 0.000 1 216 0.000 1 216 0.000 0.000 1 216 0.000 2d 216–218 0.088 0.086 1 216 0.000 0.000 nd nd nd nd
MAA9 5 153–173 0.104 0.113 5 153–171 0.185 3 163–171 0.323 0.332 5 161–171 0.758 2d 161–171 0.088 0.086 2 164–168 0.400 0.405 nd nd nd nd
MAA26 nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd 10 273–297 0.461 0.776
MAA40 8 170–188 0.897 0.795 7 180–192 0.932 2 182–186 0.032 0.032 3 180–190 0.697 2d 180–182 0.000 0.059 1 182 0.000 0.000 nd nd nd nd
*MAA54a 10 167–195 0.709 0.783 10 173–195 0.994 2 173–187 0.194 0.229 4 173–187 1.000 6d 173–185 0.412 0.790 1 173 0.000 0.000 3 181–185 0.187 0.454
*MAA54b 3 205–215 0.308 0.313 2 207–215 0.914 2 205–207 0.032 0.032 3 205–207 0.606 1 207 0.000 0.000 1 207 0.000 0.000 9 211–239 0.724 0.729
MAA71 10 154–184 0.846 0.816 9 152–178 0.988 4 152–182 0.290 0.264 5 152–182 1.000 4d 154–160 0.088 0.294 1 152 0.000 0.000 nd nd nd nd
MAA85 7d 154–178 0.468 0.777 6 154–164 0.938 3d 154–164 0.065 0.485 4 158–164 0.394 1 156 0.000 0.000 1 162 0.000 0.000 nd nd nd nd
MAA96 8 176–214 0.772 0.791 6 204–214 0.975 4d 204–220 0.387 0.547 6 204–220 0.939 4d 208–218 0.441 0.682 1 204 0.000 0.000 nd nd nd nd
MAA105 nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd 13d 265–293 0.282 0.616
MAA122 10 241–293 0.747 0.698 7 277–295 0.988 3 285–291 0.323 0.405 6 277–291 0.939 1 279 0.000 0.000 2 289–291 0.267 0.333 15 254–312 0.482 0.588
MAA135 12 258–300 0.823 0.809 11 268–322 0.994 7 270–320 0.419 0.501 14 268–328 0.970 8d 278–302 0.324 0.808 4 280–326 0.400 0.643 nd nd nd nd
MAA140 10d 131–161 0.532 0.695 9 129–163 0.957 4 145–165 0.097 0.184 9 137–163 0.909 7d 139–157 0.265 0.812 2 147–149 0.067 0.190 9 142–170 0.748 0.747
MAA145 10 256–304 0.608 0.659 9 262–328 0.895 6d 282–328 0.516 0.703 8 268–304 0.970 5d 268–320 0.176 0.514 3d 282–304 0.067 0.195 9d 275–303 0.307 0.662
MAA156 11d 273–307 0.316 0.533 6 273–307 0.988 4 279–307 0.355 0.406 6 277–309 0.970 5d 257–279 0.324 0.715 2 281–307 0.133 0.243 6d 283–307 0.732 0.504
*MAA178a 9d 207–235 0.414 0.793 8 209–229 0.963 5 209–229 0.452 0.578 8 209–229 0.848 3d 211–245 0.029 0.115 2 223–245 0.357 0.302 4 230–258 0.179 0.185
*MAA178b 9d 241–259 0.846 0.729 8 241–259 0.981 5 241–253 0.645 0.686 6 241–253 0.879 6d 241–257 0.242 0.612 3 251–255 0.786 0.566 7 268–284 0.625 0.574
MAA182 6 182–214 0.494 0.536 7 182–212 0.944 5d 200–210 0.484 0.720 6 182–210 0.970 6d 182–210 0.412 0.797 2d 202–204 0.067 0.295 12 186–216 0.578 0.609
*MAA196a nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd 7d 283–315 0.091 0.652
*MAA196b nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd 12d 337–377 0.092 0.509
MAA201 10d 238–288 0.291 0.503 11 262–294 0.975 4d 262–278 0.419 0.588 10 262–296 0.939 15d 268–312 0.382 0.930 3 266–276 0.267 0.388 nd nd nd nd
MAA219 7 247–277 0.705 0.718 5 259–277 0.944 3 259–271 0.290 0.262 4 259–277 0.545 4d 256–277 0.029 0.584 1 260 0.000 0.000 nd nd nd nd
MAA251 6d 173–200 0.911 0.682 6 173–200 0.988 7d 173–212 0.516 0.717 7 173–209 0.970 2d 191–197 0.030 0.326 4d 199–209 0.333 0.721 nd nd nd nd
MAA287 10d 179–223 0.397 0.695 7 179–215 0.975 3 183–211 0.097 0.154 5 179–199 0.970 1 179 0.000 0.000 1 183 0.000 0.000 nd nd nd nd
MAA293 3d 158–166 0.449 0.593 5 154–174 0.957 3 160–166 0.300 0.372 3 160–166 0.879 2d 162–166 0.147 0.316 1 160 0.000 0.000 nd nd nd nd
Average 7.86 0.55 0.62 6.90 0.88 3.8 0.30 0.31 5.86 0.82 4.1 0.17 0.41 1.9 0.15 0.20 8.9 0.42 0.59
Open in a new tab

Note: A = number of alleles; A. a × m = A. altilis × mariannensis; ASR = allele size range; He = expected heterozygosity; Ho = observed heterozygosity; n = sample size for each species; nd = no data.

a

Ho and He are shown for diploids.

b

The percent heterozygosity (% het.) is shown for triploids.

c

Allele sizes for A. heterophyllus include tag used in PCR (see Methods and Results section).

d

Locus deviated significantly from Hardy–Weinberg equilibrium for indicated taxon.

*

Primer amplified two separate loci.

All Bangladeshi jackfruit samples were processed at the Chicago Botanic Garden (CBG), while all breadfruit and some jackfruit samples were processed at U.S. Department of Agriculture (USDA) laboratories. A subset of the jackfruit samples were processed at both laboratories, yielding identical results. For samples processed at CBG, DNA was extracted as described above. For PCR reactions, forward primers had an M13 tail (5′-CACGACGTTGTAAAA-3′), and M13 primer labeled with WellRED Dye D2, D3, or D4 (Beckman Coulter, Brea, California, USA) was added to each reaction (Schuelke, 2000). PCR reactions used a two-step process. First, 10-μL reactions contained 5 μL of Master Mix (Promega Corporation, Madison, Wisconsin, USA), 0.5 μL of 10 mg/mL bovine serum albumin (BSA), 0.25 μL of 10 μM forward primer with the M13 tail, 0.25 μL of 10 μM reverse primer, 3 μL of H2O, and 1 μL of template DNA. PCR conditions for the first step were 94°C for 3 min; 13 cycles at 94°C for 30 s, 59.8°C for 30 s, and 72°C for 1 min; and a final extension of 72°C for 10 min. To each 10-μL reaction was added 2.5 μL Master Mix (Promega Corporation), 0.25 μL of 10 mg/mL BSA, 0.125 μL of 2.5 μM MgCl2, 0.25 μL of 10 μM labeled M13 primer, and 1.875 μL of H2O. PCR conditions for the second step were 94°C for 3 min; 27 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min; and a final extension of 72°C for 10 min. PCR product (0.5 μL of WellRED Dye D4-labeled product, 1 μL of WellRED Dye D3-labeled product, or 2.5 μL of WellRED Dye D2-labeled product [Beckman Coulter]) was added to 30 μL of HiDi formamide (Azco Biotech, San Diego, California, USA) and 3.3 μL of 400-bp size standard ladder (Beckman Coulter) and analyzed on a Beckman Coulter CEQ 8000 Genetic Analysis System. Alleles were scored using the CEQ 8000 software version 9.0 (Beckman Coulter). For samples processed at USDA laboratories, DNA was extracted at the USDA–Agricultural Research Service (ARS) Tropical Agriculture Research Station (TARS) following manufacturer’s protocol using MP Biomedicals FastDNA Spin Kit (MP Biomedicals, Solon, Ohio, USA). DNA samples were then shipped to the USDA-ARS Genomics and Bioinformatics Research Unit in Stoneville, Mississippi. PCR reactions were carried out with 10 ng of DNA using the QIAGEN Multiplex PCR Kit (QIAGEN) in 5.0-μL reactions. Reactions contained 2.5 μL of 2× QIAGEN Multiplex PCR Master Mix, 0.1 μL each of a 10 mM forward and reverse primer labeled with HEX fluorescent dye, 0.1 μL each of a 10 mM forward and reverse primer labeled with FAM fluorescent dye, 10 ng of DNA, and water to equal 5 μL. PCR conditions were 95°C for 15 min; 40 cycles of 94°C for 30 s, 55°C for 90 s, and 72°C for 1 min; and a final extension of 60°C for 30 min. PCR fragments were analyzed on an ABI 3730xl DNA Analyzer and data processed using GeneMapper version 3.7 (Applied Biosystems, Foster City, California, USA).

Many breadfruit cultivars are known to be triploid based on chromosome counts (Ragone, 2001; Zerega et al., 2004), and this was confirmed with microsatellite data. The data revealed additional cultivars, which were thought to be triploid due to sterile fruits, to indeed be triploid. GenoDive (Meirmans and Van Tienderen, 2004) was used for diversity statistics. The number of alleles was evaluated for all primers. Methods for assessing allele dosage in triploids were only partially successful (Esselink et al., 2004), so observed and expected heterozygosities and deviation from Hardy–Weinberg equilibrium (HWE) were only analyzed in diploids, while percent heterozygosity was evaluated in triploids. All loci are polymorphic for at least one species. The allele numbers across loci and species range from one to 15, with the average number within a species ranging from two to nine (Table 2). GenoDive also assigned clones to determine if individuals could be differentiated. Genotypes across all loci were unique for A. heterophyllus and diploid A. altilis × mariannensis samples. In the remaining species, multiple samples share genotypes (number of unique genotypes/total samples): triploid A. altilis (53/162), triploid A. altilis × mariannensis (27/33), diploid A. altilis (46/79), A. mariannensis (14/15), and A. camansi (33/34). Several loci showed significant departure from HWE, although the loci varied between taxa (Table 2). Given that these are cultivated species and they violate several assumptions for HWE, this is not a surprising result and could be due to selection, nonrandom mating, or asexual reproduction.

CONCLUSIONS

The newly developed microsatellite loci show high levels of polymorphism in several Artocarpus species, and the success in cross-amplification is promising for broad use of these markers in congeners. These markers provide an excellent resource to quantify levels of genetic variation, patterns of population structure, and evolutionary and domestication history. They should also prove useful in future studies for cultivar identification, establishing crop germplasm conservation strategies, helping to determine ploidy level, and understanding origins and dispersal of breadfruit and jackfruit.

Appendix 1.

Location data for Artocarpus samples used to characterize microsatellite loci.

Below is the list of samples from public germplasm collections. For each sample, the following information is given: germplasm accession number, the collection provenance or cultivar name, and the name of the germplasm collection, in that order. Abbreviations: CHIC = Nancy Poole Rich Herbarium at the Chicago Botanic Garden; FTG-H = Fairchild Tropical Botanic Garden, Homestead, Florida; FTG-M = Fairchild Tropical Botanic Garden, Miami, Florida (http://www.fairchildgarden.org/livingcollections/tropicalfruitprogram/jackfruit/); NTBG = National Tropical Botanic Garden, Kalaheo, Hawaii (http://ntbg.org/breadfruit/collection/); TARS = Tropical Agriculture Research Station; USDA-NGR-H = U.S. Department of Agriculture–National Germplasm Repository, Hilo, Hawaii (http://www.ars-grin.gov/cgi-bin/npgs/html/site_holding.pl?HILO); USDA-NGR-M = U.S. Department of Agriculture–National Germplasm Repository, Mayagüez, Puerto Rico (http://www.ars-grin.gov/cgi-bin/npgs/html/site_holding.pl?MAY).

Artocarpus altilis (Parkinson) Fosberg, diploid samples: HART 26, unknown, USDA-NGR-H; HART 1, Samoa, USDA-NGR-H; HART 21, Marquesas Islands, USDA-NGR-H; HART 50, Solomon Islands, USDA-NGR-H; 020354.001, Samoa, NTBG; 910278.001, Vanuatu, NTBG; 890470.002, Rotuma, NTBG; 890470.001, Rotuma, NTBG; 900248.001, Society Islands, NTBG; 890457.001, Rotuma, NTBG; 900265.001, Fiji, NTBG; 890469.002, Solomon Islands, NTBG; 890469.001, Solomon Islands, NTBG; 70659.021, Samoa, NTBG; 70659.022, Samoa, NTBG; 770517.001, Samoa, NTBG; 900259.001, Vanuatu, NTBG; 890473.001, Vanuatu, NTBG; 900263.001, Samoa, NTBG; 890461.001, Marquesas Islands, NTBG; 890461.002, Marquesas Islands, NTBG; 070246.002, ‘Meiuhpw en Samoa’, NTBG; 770519.001, Samoa, NYBG; 960575.001, ‘Mos en Samoa’, NTBG; 890454.001, Cook Islands, NTBG; 900231.001, Cook Islands, NTBG; 890471.002, Fiji, NTBG; 890153.001, Cook Islands, NTBG; 910266.001, Society Islands, NTBG; 790492.001, Society Islands, NTBG; 900233.002, Rotuma, NTBG; 900233.001, Rotuma, NTBG; 030039.001, ‘Puou’, NTBG; 770520.001, Samoa, NTBG; 890474.001, Samoa, NTBG; 910275.001, Vanuatu, NTBG; 880691.001, Tonga, NTBG; 900257.001, Rotuma, NTBG; 890475.002, Samoa, NTBG; 900234.001, Fiji, NTBG; 900261.001, Fiji, NTBG; 900261.002, Fiji, NTBG; 910279.001, Vanuatu, NTBG; 910279.002, Vanuatu, NTBG; 910276.001, Vanuatu, NTBG; 890156.002, Cook Islands, NTBG; 890156.001, Cook Islands, NTBG; 910277.001, Vanuatu, NTBG; 900281.001, Solomon Islands, NTBG; 900281.002, Solomon Islands, NTBG; 890456.001, Solomon Islands, NTBG; 770521.001, Samoa, NTBG; 040063.001, ‘Ulu Fiti’, NTBG; 890258.001, Rotuma, NTBG; 020356.001, ‘Ulu Fiti’, NTBG; 890458.001, Rotuma, NTBG; 890458.002, Rotuma, NTBG; 900368.001, Rotuma, NTBG; 900260.002, Fiji, NTBG; 900260.001, Fiji, NTBG; 890155.001, Samoa, NTBG; 890155.002, Samoa, NTBG; 900228.001, Samoa, NTBG; 900235.001, Solomon Islands, NTBG; 020498.001, Solomon Islands, NTBG; 020500.001, Solomon Islands, NTBG; 890471.001, Fiji, NTBG; 900264.001, Fiji, NTBG; 890477.001, Fiji, NTBG; 970236.001, Rotuma, NTBG; 910289.001, unknown, NTBG; 900226.001, unknown, NTBG; 900224.001, unknown, NTBG; 020347.001, unknown, NTBG; 020348.001, unknown, NTBG; 020352.001, unknown, NTBG; 020353.002, unknown, NTBG; 020353.001, unknown, NTBG; 020355.001, unknown, NTBG

Artocarpus altilis (Parkinson) Fosberg, triploid samples: TARS 6732 plot 22, Barbados, USDA-NGR-M; TARS plot 11, unknown, USDA-NGR-M; TARS 7990 plot 5, Samoa, USDA-NGR-M; TARS plot 18, unknown, USDA-NGR-M; HART 11, Marquesas Islands, USDA-NGR-H; HART 16, Society Islands, USDA-NGR-H; HART 18, Society Islands, USDA-NGR-H; HART 23, Marquesas Islands, USDA-NGR-H; HART 28, Marquesas Islands, USDA-NGR-H; HART 29, Society Islands, USDA-NGR-H; HART 30, Society Islands, USDA-NGR-H; HART 32, Society Islands, USDA-NGR-H; HART 33, Society Islands, USDA-NGR-H; HART 34, Society Islands, USDA-NGR-H; HART 35, Palau, USDA-NGR-H; HART 33, Chuuk, USDA-NGR-H; HART 38, Northern Mariana Islands, USDA-NGR-H; HART 40, Society Islands, USDA-NGR-H; HART 42, Society Islands, USDA-NGR-H; HART 44, Society Islands, USDA-NGR-H; HART 45, Society Islands, USDA-NGR-H; HART 33, Palau, USDA-NGR-H; HART 49, Pohnpei, USDA-NGR-H; HART 51, Chuuk, USDA-NGR-H; HART 52, Pohnpei, USDA-NGR-H; HART 53, Pohnpei, USDA-NGR-H; HART 54, Society Islands, USDA-NGR-H; HART 56, unknown, USDA-NGR-H; HART 57, unknown, USDA-NGR-H; 900232.001, Cook Islands, NTBG; 890153.002, Cook Islands, NTBG; 900256.001, Cook Islands, NTBG; 890472.002, Cook Islands, NTBG; 890472.001, Cook Islands, NTBG; 890476.002, Fiji, NTBG; 890162.002, Northern Mariana Islands, NTBG; 890162.001, Northern Mariana Islands, NTBG; 900241.001, Marquesas Islands, NTBG; 900240.001, Marquesas Islands, NTBG; 900238.001, Marquesas Islands, NTBG; 900242.001, Marquesas Islands, NTBG; 900239.001, Marquesas Islands, NTBG; 890462.001, Marquesas Islands, NTBG; 900237.001, Marquesas Islands, NTBG; 890159.001, Palau, NTBG; 890159.002, Palau, NTBG; 890183.003, Palau, NTBG; 900266.002, Pohnpei, NTBG; 900266.001, Pohnpei, NTBG; 890478.001, Pohnpei, NTBG; 890478.002, Pohnpei, NTBG; 000534.001, Pohnpei, NTBG; 790497.002, Pohnpei, NTBG; 000531.001, Pohnpei, NTBG; 890167.001, Pohnpei, NTBG; 890167.002, Pohnpei, NTBG; 890479.002, Pohnpei, NTBG; 890479.001, Pohnpei, NTBG; 790493.001, Pohnpei, NTBG; 910273002, Pohnpei, NTBG; 910271.001, Pohnpei, NTBG; 910274.001, Pohnpei, NTBG; 900262.001, Samoa, NTBG; 770524.001, Samoa, NTBG; 890455.001, Samoa, NTBG; 810290.001, Seychelles, NTBG; 810290.002, Seychelles, NTBG; 810290.003, Seychelles, NTBG; 810289.002, Seychelles, NTBG; 780332.001, Society Islands, NTBG; 40051.001, Society Islands, NTBG; 780325.001, Society Islands, NTBG; 910267.001, Society Islands, NTBG; 780333.001, Society Islands, NTBG; 900249.001, Society Islands, NTBG; 900249.002, Society Islands, NTBG; 890157.001, Society Islands, NTBG; 890158.001, Society Islands, NTBG; 890158.002, Society Islands, NTBG; 900243.001, Society Islands, NTBG; 890147.001, Society Islands, NTBG; 890147.002, Society Islands, NTBG; 780335.001, Society Islands, NTBG; 780330.002, Society Islands, NTBG; 780330.001, Society Islands, NTBG; 890151.001, Society Islands, NTBG; 780291.001, Society Islands, NTBG; 790487.001, Society Islands, NTBG; 900245.001, Society Islands, NTBG; 890150.001, Society Islands, NTBG; 800269.001, Society Islands, NTBG; 890459.001, Society Islands, NTBG; 890459.002, Society Islands, NTBG; 890149.001, Society Islands, NTBG; 890154.001, Society Islands, NTBG; 30035.001, Society Islands, NTBG; 780327.001, Society Islands, NTBG; 890464.001, Society Islands, NTBG; 890463.002, Society Islands, NTBG; 890463.001, Society Islands, NTBG; 790489.001, Society Islands, NTBG; 910266.002, Society Islands, NTBG; 030037.001, Society Islands, NTBG; 900244.001, Society Islands, NTBG; 780328.001, Society Islands, NTBG; 890460.001, Society Islands, NTBG; 790485.001, Society Islands, NTBG; 890152.002, Society Islands, NTBG; 890152.001, Society Islands, NTBG; 780329.001, Society Islands, NTBG; 790486.001, Society Islands, NTBG; 780338.001, Society Islands, NTBG; 890465.001, Society Islands, NTBG; 790488.001, Society Islands, NTBG; 790491.001, Society Islands, NTBG; 900246.001, Society Islands, NTBG; 900247.001, Society Islands, NTBG; 890186.001, Society Islands, NTBG; 890186.002, Society Islands, NTBG; 890148.001, Society Islands, NTBG; 900236.001, Solomon Islands, NTBG; 880690.001, Tonga, NTBG; 890165.001, Chuuk, NTBG; 070883.001, unknown, NTBG; 30033.001, ‘Mei Tehid’, NTBG; 40518.001, ‘Rare Autia’, NTBG; 780345.001, ‘Raumae’, NTBG; 030042.001, ‘Toneno’, NTBG; 070882.001, ‘Ulu’, NTBG; 070882.002, ‘Ulu’, NTBG; 090739.001, ‘Ulu’, NTBG; 100346.001, ‘Ulu’, NTBG; 100347.001, ‘Ulu’, NTBG; 100348.001, ‘Ulu’, NTBG; 100349.001, ‘Ulu’, NTBG; 100369.001, ‘Ulu’, NTBG; 100370.001, ‘Ulu’, NTBG; 970274.001, ‘Ulu’, NTBG; 070101.001, ‘Ulu’, NTBG; 070132.001, ‘Ulu’, NTBG; 080439.001, ‘Ulu’, NTBG; 080440.001, ‘Ulu’, NTBG; 080858.001, ‘Ulu’, NTBG; 080859.001, ‘Ulu’, NTBG; 080863.001, ‘Ulu’, NTBG; 080864.001, ‘Ulu’, NTBG; 080864.002, ‘Ulu’, NTBG; 080881.001, ‘Ulu’, NTBG; 030044.001, ‘Ulu Tala’, NTBG; 900268.001, unknown, NTBG; 910290.001, unknown, NTBG; 900267.001, unknown, NTBG; 910288.001, unknown, NTBG; 910287.001, unknown, NTBG; 900225.001, unknown, NTBG; 910286.001, unknown, NTBG; 030028.001, ‘White’, NTBG; 810290.004, ‘White’, NTBG; 810289.001, ‘White’, NTBG

Artocarpus altilis × mariannensis, diploid samples: 890452.001, Kiribati, NTBG; 890177.003, Tokelau, NTBG; 890178.001, Tokelau, NTBG; 890177.001, Tokelau, NTBG; 890172.001, Kiribati, NTBG; 890179.001, Tokelau, NTBG; 890257.001, Tokelau, NTBG; 890171.001, Tokelau, NTBG; 890176.001, Tokelau, NTBG; 890174.001, Tokelau, NTBG; 890172.002, Tokelau, NTBG; 890176.002, Tokelau, NTBG; 890168.002, Tokelau, NTBG; 890177.002, Tokelau, NTBG; 890171.002, Tokelau, NTBG; 890181.002, Tokelau, NTBG; 890181.001, Tokelau, NTBG; 890173.001, Tokelau, NTBG; 890173.002, Tokelau, NTBG; 900230.001, Tokelau, NTBG; 890175.001, Tokelau, NTBG; 890182.001, Tokelau, NTBG; 890182.002, Tokelau, NTBG; 890180.001, Tokelau, NTBG; 890170.002, Tolekau, NTBG; 900253.002, Chuuk, NTBG; 900253.001, Chuuk, NTBG; 890166.001, Chuuk, NTBG; 890466.002, Chuuk, NTBG; 890184.001, Yap, NTBG

Artocarpus altilis × mariannensis, triploid samples: 890468.002, Kiribati, NTBG; 890163.002, Northern Mariana Islands, NTBG; 890163.001, Northern Mariana Islands, NTBG; 980210.001, Palau, NTBG; 890160.001, Palau, NTBG; 910652.001, Palau, NTBG; 890182.001, Tokelau, NTBG; 890183.001, Palau, NTBG; 890183.002, Palau, NTBG; 900250.001, Palau, NTBG; 890480.002, Pohnpei, NTBG; 890480.001, Pohnpei, NTBG; 910270.001, Pohnpei, NTBG; 890480.003, Pohnpei, NTBG; 790494.001, Pohnpei, NTBG; 910272.002, Pohnpei, NTBG; 910272.001, Pohnpei, NTBG; 900255.001, Pohnpei, NTBG; 890467.001, Pohnpei, NTBG; 790490.001, Society Islands, NTBG; 910265.001, Society Islands, NTBG; 890453.001, Tokelau, NTBG; 890185.001, Tokelau, NTBG; 910269.001, Chuuk, NTBG; 910268.001, Chuuk, NTBG; 890164.001, Chuuk, NTBG; 890164.002, Chuuk, NTBG; 890161.001, Yap, NTBG; 030034.001, ‘Pohnpei, NTBG; 030034.002, Pohnpei, NTBG; 030041.001, ‘Rotuma’, NTBG; 990781.001, unknown, NTBG; 30045.001, ‘Yap’, NTBG

Artocarpus camansi Blanco, all diploid: TARS 18009 plot 14, unknown, USDA-NGR-M; HART 63 N90-148, unknown, USDA-NGR-H; NTBG50, 910283.001, Indonesia, NTBG; 980212.001, Palau, NTBG; 000398.001, Papua New Guinea, NTBG; 000501.001, Papua New Guinea, NTBG; 000398.003, Papua New Guinea, NTBG; 000399.001, Papua New Guinea, NTBG; 000398.002, Papua New Guinea, NTBG; 000502.001, Papua New Guinea, NTBG; 000501.001, Papua New Guinea, NTBG; 000499.001, Papua New Guinea, NTBG; 000503.001, Papua New Guinea, NTBG; 000499.002, Papua New Guinea, NTBG; 000395.001, Papua New Guinea, NTBG; 000390.001, Papua New Guinea, NTBG; 000503.002, Papua New Guinea, NTBG; 000389.001, Papua New Guinea, NTBG; 000398004, Papua New Guinea, NTBG; 000500.001, Papua New Guinea, NTBG; 910281.001, Philippines, NTBG; 910280.001, Pohnpei, NTBG; 770444.001, Society Islands, NTBG; 960576.001, unknown, NTBG; 000390.002, Papua New Guinea, NTBG; 000394.002, Papua New Guinea, NTBG; 000395.002, Papua New Guinea, NTBG; 000398.005, Papua New Guinea, NTBG; 000499.003, Papua New Guinea, NTBG; 000500.002, Papua New Guinea, NTBG; 000501.004, Papua New Guinea, NTBG; 000501.005, Papua New Guinea, NTBG; 000502.002, Papua New Guinea, NTBG; 000503.004, Papua New Guinea, NTBG

Artocarpus heterophyllus Lam., all diploid: TARS 1566 plot 5, Indonesia, USDA-NGR-M; TARS 1566 plot 9, Indonesia, USDA-NGR-M; TARS 1566 plot 10, Indonesia, USDA-NGR-M; TARS 1566 plot 19, Indonesia, USDA-NGR-M; TARS 18002 plot 16, Malaysia, USDA-NGR-M ; HART 27, Thailand, USDA-NGR-H; WB2-FTBG-F-21-A, unknown, FTG-M; WB2-FTBG-F-05-A, unknown, FTG-M; S2-01-07-07, unknown, FTG-M; WB2-FTBG-F-16-A, unknown, FTG-M; T#10 R4, ‘Black Gold’, FTG-H; T#5 R5, ‘Chenna’, FTG-H; T#15 R4, ‘Cochin’, FTG-H; T#5 R3, ‘Dang Rasimi’, FTG-H; T#11 R4, ‘J31’, FTG-H; T#6 R4, ‘L.”, FTG-H; T#2 R4, ‘L.”, FTG-H; T#12 R4, ‘NS1’, FTG-H; T#5 R4, ‘Pani Varaka’, FTG-H; WB2-FTBG-F-15-A, ‘Golden Nugget’, FTG-M; WB2-FTBG-F-01-A, ‘Kwai Mok’, FTG-M

Artocarpus mariannensis Trécul, all diploid: HART 67 N05-8, unknown, USDA-NGR-H; 900252.001, Northern Mariana Islands, NTBG; 900252.003, Northern Mariana Islands, NTBG; 900252.002, Northern Mariana Islands, NTBG; 000522.002, Northern Mariana Islands, NTBG; 000523.001, Northern Mariana Islands, NTBG; 000521.002, Northern Mariana Islands, NTBG; 000521.001, Northern Mariana Islands, NTBG; 000522.001, Northern Mariana Islands, NTBG; 000521.003, Northern Mariana Islands, NTBG; 970306.001, Pohnpei, NTBG; 970306.002, Pohnpei, NTBG; 000528.001, Pohnpei, NTBG; 000523.002, Northern Mariana Islands, NTBG; 940010.002, Northern Mariana Islands, NTBG

Appendix 2.

Artocarpus heterophyllus samples collected in Bangladesh by authors Witherup, Zuberi, and Zerega. A representative herbarium voucher was made at most sites, and a picture voucher exists for all samples.

N Collection date Collection site District GPS Latitude GPS Longitude Collection no. Voucher
12 5 July 2010 Madhupur village Tangail N24.61475 E090.03149 CW1–12 CHIC
21 6 July 2010 Mohismara village Tangail N24.59060 E90.12699 CW13–33 CHIC
30 6 July 2010 GachaBari village Tangail N24.67237 E090.07662 CW34–64
27 8 July 2010 Bangladeshi Tea Research Institute,  Srymangal Sylhet N24.29532 E091.74686 CW65–91 CHIC
29 9 July 2010 Ashidu orchard and village Sylhet N24.28276 E091.76509 CW92–119, 101b CHIC
36 9 July 2010 Lawachara National Park Sylhet N24.31972 E091.78361 CW120–155 CHIC
23 10 July 2010 Bangladesh Agricultural Research Institute Sylhet CW160–182 CHIC
13 11/19 July 2010 National Botanic Garden of Bangladesh Dhaka N23.81300 E90.34690 CW183–191, 285–288 CHIC
13 12 July 2010 Bangladesh Agricultural Research Institute Gazipur N23.99420 E090.41130 CW192–204
16 12 July 2010 Bagabazar village Gazipur N24.16302 E090.43024 CW205–220 CHIC
19 14 July 2010 Leather Research Institute Savar N23.91534 E090.23549 CW221–239 CHIC
28 16 July 2010 Madan Hati village Rajshahi N24.48321 E088.59244 CW240–267 CHIC
17 17 July 2010 Nimtoli village Jessore N23.16448 E089.29896 CW268–284 CHIC
31 20 July 2010 Jahangirnagar University Savar N23.88113 E090.26915 CW289–319 CHIC
11 20 July 2010 Gono University Savar N23.91812 E90.24538 CW320–330
30 21 July 2010 Khula Pater village Comilla N23.67553 E091.17191 CW331–360 CHIC
20 23 July 2010 Council of Scientific and Industrial Research Dhaka N23.74027 E090.38531 CW361–380 CHIC
18 20 July 2010 Hortus Nursery Savar Hortus1–18
Open in a new tab

Note: CHIC = Nancy Poole Rich Herbarium at the Chicago Botanic Garden; N = number of samples.

LITERATURE CITED

  1. Esselink G. D., Nybom H., Vosman B. 2004. Assignment of allelic configuration in polyploids using the MAC-PR (microsatellite DNA allele counting–peak ratios) method. Theoretical and Applied Genetics 109: 402–408 [DOI] [PubMed] [Google Scholar]
  2. Jarrett F. M. 1959. Studies in Artocarpus and allied genera. III. A revision of Artocarpus subgenus Artocarpus. Journal of the Arnold Arboretum 40: 114–155 [Google Scholar]
  3. Jones K. C., Levine K. F., Banks J. D. 2002. Characterization of 11 polymorphic tetranucleotide microsatellites for forensic applications in California elk (Cervus elaphus canadensis). Molecular Ecology Notes 2: 425–427 [Google Scholar]
  4. Jones A. M. P., Murch S. J., Wiseman J., Ragone D. 2013. Morphological diversity in breadfruit (Artocarpus, Moraceae): Insights into domestication, conservation, and cultivar identification. Genetic Resources and Crop Evolution 10.1007/s10722-012-9824-8. [Google Scholar]
  5. Karhu A., Dieterich J. H., Savolainen O. 2000. Rapid expansion of microsatellite sequences in pines. Molecular Biology and Evolution 17: 259–265 [DOI] [PubMed] [Google Scholar]
  6. Meirmans P. G., Van Tienderen P. H. 2004. GENOTYPE and GENODIVE: Two programs for the analysis of genetic diversity of asexual organisms. Molecular Ecology Notes 4: 792–794 [Google Scholar]
  7. Ragone D. 2001. Chromosome numbers and pollen stainability of three species of Pacific Island breadfruit (Artocarpus, Moraceae). American Journal of Botany 88: 693–696 [PubMed] [Google Scholar]
  8. Raymond M., Rousset F. 1995. GENEPOP (version 1.2): Population genetics software for exact tests and ecumenicism. Journal of Heredity 86: 248–249 [Google Scholar]
  9. Schuelke M. 2000. An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology 18: 233–234 [DOI] [PubMed] [Google Scholar]
  10. Shyamalamma S., Chandra S. B. C., Hegde M., Naryanswamy P. 2008. Evaluation of genetic diversity in jackfruit (Artocarpus heterophyllus Lam.) based on amplified fragment length polymorphism markers. Genetics and Molecular Research 7: 645–656 [DOI] [PubMed] [Google Scholar]
  11. Zerega N. J. C., Ragone D., Motley T. J. 2004. Complex origins of breadfruit (Artocarpus altilis, Moraceae): Implications for human migrations in Oceania. American Journal of Botany 91: 760–766 [DOI] [PubMed] [Google Scholar]
  12. Zerega N. J. C., Nur Supardi M. N., Motley T. J. 2010. Phylogeny and recircumscription of Artocarpeae (Moraceae) with a focus on Artocarpus. Systematic Botany 35: 766–783 [Google Scholar]

Articles from Applications in Plant Sciences are provided here courtesy of Wiley

RESOURCES