Skip to main content
Applications in Plant Sciences logoLink to Applications in Plant Sciences
. 2014 Mar 31;2(4):apps.1300071. doi: 10.3732/apps.1300071

Development and characterization of microsatellite loci for the Moroccan endemic endangered species Argania spinosa (Sapotaceae)1

Yasmina El Bahloul 2,4,5, Nicolas Dauchot 3,5, Ikrame Machtoun 2, Fatima Gaboun 2, Pierre Van Cutsem 3
PMCID: PMC4103133  PMID: 25202614

Abstract

• Premise of the study: Microsatellite loci were developed for the Moroccan endemic endangered species Argania spinosa with a combination of a typical library enrichment procedure and a 454 GS FLX Titanium–based high-throughput sequencing approach.

• Methods and Results: A genomic DNA library was enriched and further screened using (GA)15, (GTA)8, and (TTC)8 biotin-labeled probes coupled with chemi-luminescence detection. To increase simple sequence repeat (SSR) loci number, an ultra-high-throughput sequencing-based approach was used. Evaluation of all primer pairs was performed with labeled dUTP on an ABI 3130xl sequencer. Eleven polymorphic SSR loci were selected out of 79 SSR regions and extensively characterized on 150 individuals from eight populations. Total alleles ranged from six to 19 alleles per locus while expected heterozygosity ranged from 0.618 to 0.869.

• Conclusions: The SSRs developed here will be used to further characterize the genetic diversity of A. spinosa across its distribution range, mainly in the southern part of Morocco and southwestern Algeria. They may also be transferable to other Sapotaceae species.

Keywords: argan tree, Argania spinosa, dUTP labeling, microsatellite, Sapotaceae, simple sequence repeats (SSRs)


Argania spinosa (L.) Skeels is endemic to Morocco and is known worldwide for its oil, which is extremely rich in unsaturated fatty acids and used in the food and cosmetic industries. Argan is the only Sapotaceae species in the region. Argan forest is found primarily in the southwestern part of Morocco and in the Souss-Massa-Drâa region (Msanda et al., 2005); a few populations have also been identified in southwestern Algeria (Kaabèche et al., 2010). Currently, argan is facing critical regeneration problems resulting from overgrazing of young sprouts and trees by goats, coupled with inadequate protection; consequently, argan tree genetic diversity is severely threatened. Molecular analyses of A. spinosa are very recent and still quite limited, mainly due to the lack of species-specific molecular tools. A few studies have tried to evaluate its genetic diversity, first with the analysis of isozymes (El Mousadik and Petit, 1996a) and chloroplast DNA (El Mousadik and Petit, 1996b) and later with interspecific random-amplified polymorphic DNA (RAPDs) and simple sequence repeats (SSRs) initially developed on two different Sapotaceae species (Majourhat et al., 2008). However, only six SSRs were polymorphic, and these exhibited low diversity according to what would be expected in a perennial spontaneous (i.e., natural, nondomesticated) tree. Species-specific codominant molecular markers are thus critically needed.

Here, we developed de novo, highly polymorphic and A. spinosa–specific SSR markers and used them to evaluate the genetic diversity of a collection of geographically diversified argan trees.

METHODS AND RESULTS

Argania spinosa genomic DNA (gDNA) was extracted from young dried leaves and ground using a MM400 mixer mill (Retsch, Düsseldorf, Germany) for 2 min at 30 Hz in 1.5-mL centrifugation tubes with two stainless steel beads (Retsch, no. Fr0120). Between 10 and 20 mg of powder was used for gDNA extraction using the NucleoSpin Plant II DNA extraction kit according to the manufacturer’s instructions (Macherey-Nagel, Düren, Germany). DNA concentration was adjusted to 50 ng/μL.

Sixteen DNA samples originating from two populations geographically separated by more than 400 km were used for library construction (Appendix 1). The protocol of Glenn and Schable (2005) was slightly modified to prepare genomic libraries enriched for (GA)15, (GTA)8, and (TTC)8 repeats. Biotin-labeled oligonucleotides were used for library enrichment and Southern analysis, which were performed with the Biotin Luminescent Detection Kit (no. 11 811 592 910, Roche Diagnostics GmbH, Mannheim, Germany) and a Bio-Rad Fluor-S MAX MultiImager (Bio-Rad Laboratories, Hercules, California, USA). Positive colonies containing an insert larger than 400 bp were sequenced by Macrogen (Seoul, Korea) on an ABI 3730xl genetic analyzer (Applied Biosystems, Foster City, California, USA) with BigDye Terminator version 3.1 chemistry (Applied Biosystems). SSR motifs were confirmed in 31 nonredundant sequences. Alternatively, to increase the number of SSR loci, gDNA enrichment and direct sequencing using 454 GS FLX Titanium (Roche, Basel, Switzerland) were conducted as described earlier (Micheneau et al., 2011).

A total of 79 primer pairs (31 enriched sequences and 48 sequences developed through next-generation sequencing) were designed with Primer3 (Rozen and Skaletsky, 2000) with the following design parameters: GC content 40–60 (optimum 50), melting temperature (Tm) 55–65°C (optimum 60°C), primer size 18–27 bp (optimum 22 bp), GC clamp 1. A typical pigtail (GTTTCTT-) was added to the 5′ end of the forward or reverse primers. Primers were synthesized at Integrated DNA Technologies (Leuven, Belgium). They were first tested at 55°C on control gDNA. Markers giving no or multiple amplification products were discarded. For the remaining markers, each locus was analyzed on a set of geographically distant argan trees. For this step, amplification was performed using labeled dUTP nucleotides. A 50-μL reaction mixture contained 10 μL of 5× colorless GoTaq reaction buffer (Promega Corporation, Madison, Wisconsin, USA), 10 pmol of each primer, 5 μmol dATP, 5 μmol dCTP, 5 μmol dGTP, 4 μmol dTTP, 0.4 μmol dUTP-DY681 (Dyomics, Jena, Germany), 1.5 unit GoTaq polymerase (Promega Corporation), and 250 ng of gDNA, and was brought to volume with nuclease-free water (Promega Corporation). The amplification program was 94°C for 2 min; followed by 35 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s; followed by a final elongation step at 72°C for 7 min and then hold at 10°C. Amplification products were analyzed on a CEQ 8000 fragment analyzer (Beckman Coulter, Brea, California, USA), using MapMarker MM-D1 as size standard (BioVentures, Murfreesboro, Tennessee, USA) and Frag-4 separation method with a separation time of 100 min. Amplifications were performed on iCycler (Bio-Rad Laboratories). Out of the first 79 primer pairs tested, 11 fulfilled selection criteria regarding polymorphism, lack of background amplification, and ease of scoring. A table summarizing the evaluation results of all 79 primer pairs is available as Appendix S1 (28.7KB, xlsx) .

Validated SSR markers were resynthesized by Eurofins MWG Operon (Ebersberg, Germany) and labeled with 6-FAM, Atto 565, or HEX fluorescent dyes. Amplifications were performed in 10-μL volumes using 0.3 unit of GoTaq DNA polymerase (no. M300, Promega Corporation), 2 μL of 5× GoTaq PCR buffer (no. M7921, Promega Corporation), 10–50 ng of gDNA, 0.1 μL of 10 mmol/L dNTP mix (no. R0192, Thermo Fisher Scientific, Waltham, Massachusetts, USA), and 2 pmol of each primer. ASMS markers (Table 1) were amplified individually and further pooled for separation and detection on an ABI 3130xl genetic analyzer (Applied Biosystems), while ASMS2012 markers were multiplexed for amplification in two triplex reactions. All amplifications were performed according to the melting temperatures reported in Table 1.

Table 1.

Characterization of 11 Argania spinosa SSR loci, with 150 argan individuals.

Locusa Primer sequences (5′–3′)b Fluorescent dye Tm (°C) Repeat motif Allele size range (bp) A Ar He Ho χ2 GenBank accession no.
ASMS01 (-) F: GTTTCTTGCAGTTTGAGAATTGAAAGGACAACG 6-FAM 57 (CT)11(CA)17 142–180 18 9.085 0.869 0.887 NS KC138526
#R: CCTCCCATCTAATATTTCTAGTTCCATCC
ASMS04 (-) F: GTTTCTTCAAAAATAAATGTGAATGAGCAC 6-FAM 57 (GA)14 309–351 14 5.930 0.787 0.792 NS KC138527
#R: TGATGGGATTATGAGAAAGAG
ASMS19 (- -) F: GTTTCTTATGTAGGTCGCTGGCATTT HEX 57 (GTA)8 194–248 10 5.440 0.740 0.545 * KC138528
#R: AAGCCTGGGATTATGTTATCAG
ASMS20 (- -) F: GTTTCTTAATACTTCAATGCGAAGGTCGTG ATTO-565 53.8 (CT)14 198–228 15 6.294 0.726 0.725 NS KC138529
#R: ATTACTCCCAACCTCAGTCAGC
ASMS31 (- -) F: GTTTCTTATGTGGGTAAAGCTCTAGAAGG 6-FAM 57 (GA)15 166–184 11 6.991 0.834 0.532 * KC138530
#R: GTGCAAATCAACAGACCTC
ASMS2012-04 (+) #F: CCAATAATAGAAACACCCGGAA HEX 55 (CTT)7 303–320 7 3.992 0.618 0.604 NS KC527586
R: GTTTCTTACTTAGCCCACCTTCCTCTTCT
ASMS2012-10 (+) #F: AGCTGAGACCATTGCAGTCATA ATTO-565 55 (TTC)10 236–254 6 4.278 0.624 0.679 NS KC527587
R: GTTTCTTCGATCCAAACAAGAAGAGTGTG
ASMS2012-22 (+) #F: TGGGGTCTGTGCTGTTTAAGTA 6-FAM 55 (TTC)8 117–144 9 5.541 0.721 0.688 NS KC527588
R: GTTTCTTCCAATCTCCATACGAACCAGAT
ASMS2012-34 (++) #F: CCCATTGTAGACTTCCGCTTAC 6-FAM 55 (AG)16 199–251 16 7.101 0.832 0.864 NS KC527589
R: GTTTCTTAACCACAGAGAGCAGCAACTTT
ASMS2012-37 (++) #F: CGGAAAGGAATTAGGATTTGG HEX 55 (AG)15 180–230 16 7.210 0.793 0.771 NS KC527590
R: GTTTCTTCGGTTCGTCTCTTCTCCAGTAT
ASMS2012-41 (++) #F: ATTGATTGGAGGCTAGAGTTGG ATTO-565 55 (GA)17 151–177 14 8.739 0.859 0.814 NS KC527591
R: GTTTCTTACGTGGCTATGGTAGTTGAGGT

Notes: A = number of alleles; Ar = allelic richness; He = expected heterozygosity; Ho = observed heterozygosity per population; NS = no significant difference; Tm = melting temperature.

a

SSR loci labeled with (-) or (- -) are two sets of markers designed for multiplex detection but simplex amplification. SSR loci labeled with (+) or (++) are two sets of markers designed for multiplex amplification and detection. ASMS2012 loci were isolated using an NGS-based approach while the other loci were isolated using a typical genomic library enrichment strategy.

b

Labeled primers are preceded by #.

*

Significant difference (P < 0.05) between He and Ho according to χ2 test.

One hundred fifty argan trees originating from seven populations located in southern Moroccan argan forests and one population from the Oued Grou relict area, in northwestern Morocco, were used for in-depth testing of the newly developed SSRs (Appendix 1). Allele number (A), allelic richness (Ar), and expected (He) and observed (Ho) heterozygosities were calculated using FSTAT software version 2.9.3.2 (Goudet, 1995). Results revealed high allele numbers (Table 1). A total of 136 alleles were scored. A ranged from six (ASMS2012-10) to 18 (ASMS01). Ar varied from 3.992 to 9.085. He and Ho ranged from 0.618 to 0.869 and 0.532 to 0.887, respectively. No significant difference was observed between Ho and He for nine loci, indicating that populations are approaching Hardy–Weinberg equilibrium. A difference has been noticed for loci ASMS19 and ASMS31, where He was higher than Ho, indicating a slight lack of heterozygotes. This might be due to natural selection of loci near the two SSRs or to the presence of null alleles.

Argan tree is considered as a spontaneous natural species with no genetic change due to human selection. The observed levels of genetic diversity are thus explained by the combined effects of mutation, genetic drift, gene flow, and natural selection.

CONCLUSIONS

In our study, 150 argan trees were genotyped with 11 SSR markers. Samples originated from eight geographically separated regions with no possibility of natural gene exchange. The 11 microsatellite markers used in this study were very informative and showed a high ability to detect polymorphism within analyzed genotypes. Outcomes of this research provide the first codominant markers specific to A. spinosa and will help in elaborating strategies to better protect this threatened species. They will contribute more efficiently to evaluate the genetic diversity and to understand gene flow among and between argan forest areas. Moreover, developed markers may constitute valuable tools for evaluation of genetic diversity in other Sapotaceae species.

Supplementary Material

Supplementary Material

Appendix

Appendix 1.

Location information for Moroccan populations of Argania spinosa used in this study.a

Population Site name Region N Latitude (°N) Longitude (°W) Altitude (m)
POP01* AGD Agadir 23 30°24′56.3″ 009°36′17.3″ 32
POP02* OG1 Rabat oued grou 29 33°55′48.2″ 006°45′00.0″ 429
POP03 ESSII Essaouira 20 31°55′35.3″ 009°24′28.9″ 108
POP04 AG10S1 Agadir 20 30°32′14.1″ 009°41′42.3″ 34
POP05 AG10S5 Agadir 21 29°02′54.0″ 009°58′07.6″ 412
POP06 B2-02 Agadir 17 30°11′52.5″ 009°18′53.5″ 178
POP07 B3-09 Agadir 12 30°04′28.0″ 009°09′07.4″ 563
POP08 EI Essaouira 8 31°24′58.8″ 009°42′58.5″ 97

Note: N = sample size.

a

No herbarium vouchers were collected due to the sensitive status of the species.

*

Population used for DNA library generation.

LITERATURE CITED

  1. El Mousadik A., Petit R. J. 1996a. High level of genetic differentiation for allelic richness among populations of the argan tree [Argania spinosa (L.) Skeels] endemic to Morocco. Theoretical and Applied Genetics 92: 832–839 [DOI] [PubMed] [Google Scholar]
  2. El Mousadik A., Petit R. J. 1996b. Chloroplast DNA phylogeography of the argan tree of Morocco. Molecular Ecology 5: 547–555 [DOI] [PubMed] [Google Scholar]
  3. Glenn T. C., Schable N. A. 2005. Isolating microsatellite DNA loci. Methods in Enzymology 395: 202–222 [DOI] [PubMed] [Google Scholar]
  4. Goudet J. 1995. FSTAT: A computer program to calculate F-statistics, version 1.2. Journal of Heredity 86: 485–486 [Google Scholar]
  5. Kaabèche M., Benkheira A., de Foucault B. 2010. L’Arganeraie d’Algérie: Structure, écologie, syntaxonomie, dynamique. Acta Botanica Gallica 157: 563–572 [Google Scholar]
  6. Majourhat K., Jabbar Y., Hafidi A., Martínez-Gómez P. 2008. Molecular characterization and genetic relationships among most common identified morphotypes of critically endangered rare Moroccan species Argania spinosa (Sapotaceae) using RAPD and SSR markers. Annals of Forest Science 65: 805 [Google Scholar]
  7. Micheneau C., Dauby G., Bourland N., Doucet J. L., Hardy O. J. 2011. Development and characterization of microsatellite loci in Pericopsis elata (Fabaceae) using a cost-efficient approach. American Journal of Botany 98: e268–e270 [DOI] [PubMed] [Google Scholar]
  8. Msanda F., El Aboudi A., Peltier J. P. 2005. Biodiversité et biogéographie de l’arganeraie marocaine. Cahiers Agricultures 14: 357–364 [Google Scholar]
  9. Rozen S., Skaletsky H. 2000. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material

Articles from Applications in Plant Sciences are provided here courtesy of Wiley

RESOURCES