Skip to main content
Applications in Plant Sciences logoLink to Applications in Plant Sciences
. 2014 Apr 4;2(4):apps.1300093. doi: 10.3732/apps.1300093

Genus-wide microsatellite primers for the goldenrods (Solidago; Asteraceae)1

James B Beck 2,8, John C Semple 3, Justin M Brull 2, Stacey L Lance 4, Mai M Phillips 5, Sara B Hoot 6, Gretchen A Meyer 7
PMCID: PMC4103136  PMID: 25202617

Abstract

• Premise of the study: Microsatellite primers were developed for studies of polyploid evolution, ecological genetics, conservation genetics, and species delimitation in the genus Solidago.

• Methods and Results: Illumina sequencing of a shotgun library from S. gigantea identified ca. 1900 putative single-copy loci. Fourteen loci were subsequently shown to be amplifiable, single-copy, and variable in a broad range of Solidago species.

• Conclusions: The utility of these markers both across the genus and in herbarium specimens of a wide age range will facilitate numerous inter- and intraspecific studies in the ca. 120 Solidago species.

Keywords: Asteraceae, Illumina sequencing, polyploidy, simple sequence repeat (SSR) markers, Solidago


The ca. 120 species of goldenrod (Solidago L.; Asteraceae) are largely confined to North America and occupy an impressive array of habitats, including tundra, rock outcrops, bogs, sand dunes, prairies, barrens, rockhouses, and a variety of woodlands (Semple and Cook, 2006). This taxonomic and ecological diversity has led to Solidago’s popularity as a study system in evolution and ecology. Microsatellite, or simple sequence repeat (SSR), markers could represent a valuable tool in many of these instances, for example, allowing for the estimation of kinship, the identification of invasive genotypes, and the estimation of gene flow among populations.

Microsatellite data could also help clarify Solidago species boundaries. The taxonomic complexity of the genus is widely recognized, a problem stemming from sheer species richness, low overall levels of genetic differentiation, occasional interspecific hybridization, and frequent polyploidy (Semple and Cook, 2006). An accurate delimitation of Solidago species would provide a robust account of biodiversity in the genus and enhance the evolutionary and ecological studies noted above. Given the low overall genetic divergence among Solidago species (Schilling et al., 2008), it should be possible to identify SSR loci that amplify in most species, providing a standard comparative genetic toolkit for the genus.

METHODS AND RESULTS

Silica-dried tissue from a diploid individual of S. gigantea Aiton (confirmed by a meiotic chromosome count) was collected in Chester County, Tennessee, USA. A voucher specimen for this collection (Beck 1258) has been deposited at the Wichita State University Herbarium (WICH). Total DNA was extracted with a DNeasy Plant Mini Kit (QIAGEN, Valencia, California, USA). An Illumina paired-end shotgun library was prepared by shearing 1 μg of DNA using a Covaris S220 ultrasonicator (Covaris, Woburn, Massachusetts, USA) and following the standard Illumina TruSeq DNA Library Kit protocol (Illumina, San Diego, California, USA) using a multiplex identifier adapter index. Sequencing was conducted on the Illumina HiSeq 2000 with 100-bp paired-end reads. Five million of the resulting reads were analyzed with the program PAL_FINDER_v0.02.03 (Castoe et al., 2012) to extract those reads that contained di-, tri-, tetra-, penta-, and hexanucleotide SSRs. Once positive reads were identified in PAL_FINDER_v0.02.03, they were batched to a local installation of Primer3 version 2.0.0 (Rozen and Skaletsky, 2000) for primer design. To avoid targeting multiple-copy loci, only those for which either primer sequence occurred one or two times in the 5 million reads were selected. A total of 1888 loci met this criterion.

To select a set of loci for initial screening, we focused on loci with tetra- and trinucleotide repeat motifs and with primer melting temperatures between 55°C and 65°C. Furthermore, loci were targeted for which only one of the paired-end reads sequenced into the repeat motif to avoid relatively small fragment sizes. Using these criteria, 80 loci were chosen for initial screening using a “CAG-tag” strategy similar to the M13 approach in Schuelke (2000). The forward primer from each locus was 5′ modified with an engineered “CAG-tag” sequence (5′-CAGTCGGGCGTCATCA-3′) to enable use of a third, fluorescently labeled primer (identical to the CAG-tag) in PCR. In addition, the “PIG-tail” sequence GTTT was added to the 5′ end of the reverse primer to reduce double peaks. Reactions (10 μL) included 1× Promega GoTaq Buffer (Promega Corporation, Fitchburg, Wisconsin, USA); 0.2 mM each dNTP; 2.5 mM MgCl2; 0.025 μg bovine serum albumin (BSA); 0.5 U Promega GoTaq; 0.4 μM unlabeled primer; 0.04 μM CAG-labeled primer; 0.4 μM labeled CAG-tag, and ca. 30 ng DNA template. PCR amplification involved the touchdown cycling protocol outlined in Lance et al. (2010). CAG-tag screening included DNA extracted from eight herbarium specimens representing species from four subsections of Solidago sect. Solidago (Solidago subsect. Triplinerviae (Torrey & A. Gray) G. L. Nesom, Solidago subsect. Glomeruliflorae (Torrey & A. Gray) A. Gray, Solidago subsect. Squarrosae A. Gray, and Solidago subsect. Junceae (Rydb.) G. L. Nesom) and a sample of Brintonia discoidea (Elliott) Greene, representing a monotypic genus potentially sister to Solidago (Schilling et al., 2008). Full details for these eight specimens are provided in Appendix 1.

Fourteen loci (Table 1) were identified as variable, interpretable, and broadly amplifiable across the four tested Solidago subsections and outgroup Brintonia Greene. These loci were then further evaluated in a larger set of diploid individuals from Solidago subsect. Triplinerviae (47 samples representing 10 species), Solidago subsect. Squarrosae (47 samples representing 10 species), and Solidago subsect. Junceae (32 samples representing seven species). Full specimen details are provided in Appendix 1. All 126 samples were extracted from herbarium specimens archived at the University of Waterloo Herbarium (WAT), the University of Tennessee Herbarium (TENN), the Duke University Herbarium (DUKE), or the Missouri Botanical Garden Herbarium (MO) using the modified cetyltrimethylammonium bromide (CTAB) protocol detailed in Beck et al. (2012). Forward primers (minus the CAG-tag) were dye labeled with either 6-FAM or HEX, while reverse primers retained the PIG-tail for all but two loci (Table 1). Sets of two or three loci were simultaneously amplified using the multiplex PCR protocol described in Beck et al. (2012). Amplicons were sized using the GeneScan 500 LIZ Size Standard on an Applied Biosystems 3730xl DNA Analyzer (Life Technologies, Carlsbad, California, USA) at the University of Chicago Comprehensive Cancer Center DNA Sequencing and Genotyping Facility (Chicago, Illinois, USA). Alleles were determined using GeneMarker 1.9 (SoftGenetics, State College, Pennsylvania, USA).

Table 1.

Characteristics of 14 loci broadly amplifiable in Solidago.a

Locusb Primer sequences (5′–3′)c Repeat motifd Allele size range (bp)e
Sg_1 F: GCGTACTTATTAAATTGATTTCTATAACCG (TTGG) 116–153
R: ACAGATGGCTTCCATGATCG
Sg_2 F: TCTAAACTGTAAGTCTTTGATGAAACC (AATG) 167–248
R: GCCGTCAATCCTTACAATCC
Sg_3 F: TTGAAGATCAAATGCTTCCACC (AAC) 92–182
R: GTTTAACCAATTTGTCACTTCAGATCG
Sg_4 F: CAATCTTGTCAGTTTAATCATTTCTTCC (TTCC) 104–201
R: GTTTCATAAGGAGTGGCATGTTCC
Sg_5 F: TTGTCCTGATACAAATTTCCTACTCG (TTC) 256–296
R: GTTTAACAATGAGAATAAGTGGACAACCC
Sg_6 F: TTTACCTTTGAATTGCGGC (AAAT) 200–244
R: GTTTAGTACCAATCAACCATGGGC
Sg_7 F: TTTGTATGCAAGTCAAAGGCG (AAAG) 360–378
R: GTTTCACAGCTGCCAATAAATCCC
Sg_8 F: TCCCTCTTTATTCTTTCAACAAACC (AAAG) 126–172
R: GTTTAACACCAACATTGCAATCCC
Sg_9 F: GACGTGGCTAAATTAAGGTGTACG (AATG) 170–190
R: GTTTGCAACGTAATCCACCTCC
Sg_10 F: CGTTTGTTCTTTGTCCCTTTCC (ATCT) 276–330
R: GTTTCTATACCTCGTGCGTGTCGG
Sg_11 F: GAGTCTCTTCAGTATAAGTTTATCTTGGC (AAC) 119–155
R: GTTTAAGACTGTCTACATTTCACCTCTCC
Sg_12 F: CTAGAAGATGTGGATTGACCAGC (AAAT) 182–208
R: GTTTCAAATGAGTCAGTCGGTGCC
Sg_13 F: TTGAAATGTTTGTATCATTAGGGTATGG (AAC) 153–172
R: GTTTCATATCCCGTTTCGGCAGG
Sg_14 F: AACCTTTGTTTGGTATGTAAATTAGG (AAC) 317–355
a

Paired-end sequence data are deposited in the Dryad Digital Repository: http://doi.org/10.5061/dryad.72p7k (Beck et al., 2014).

b

A multiplex amplification protocol incorporating a single annealing temperature (see text) was used for all loci.

c

Nucleotides added to create PIG-tail are noted in boldface for relevant primers.

d

Total repeat motif number is not reported because it could not be determined whether paired-end reads sequenced through the entire repeat region.

e

Full size range across the three Solidago subsections evaluated in the broad analysis.

The 14 loci were variable and generally transferable across the 27 species representing three Solidago subsections (Table 2). The number of alleles per locus ranged from seven to 51, and all loci (if amplifiable) were polymorphic in all three subsections. A null allele was inferred if no amplification was observed in all individuals of a given species, and seven of the 14 loci exhibited no evidence for null alleles in any of the 27 species (Table 2). Not surprisingly, the fewest null alleles were observed in subsect. Triplinerviae (11 of 140 locus/species combinations), the subsection to which S. gigantea belongs. In only one case did all species in a subsection exhibit a null allele for a given locus (Sg_7 in subsect. Squarrosae). Lineage-specific locus duplication was inferred in two cases based on the observation of more than two alleles per individual in multiple confirmed diploid samples (Sg_4 in subsect. Junceae and Sg_5 in subsect. Squarrosae).

Table 2.

Number of alleles, size range, and amplification success in three Solidago subsections. Loci successfully amplified in all taxa are shown in bold.

subsect. Triplinerviae subsect. Squarrosae subsect. Junceae All samples
Locus A Allele size range (bp) Amplification successa A Allele size range (bp) Amplification successa A Allele size range (bp) Amplification successa A Allele size range (bp) Amplification successa
Sg_1 5 121–144 10/10 7 129–153 10/10 9 116–153 7/7 13 116–153 27/27
Sg_2 32 167–226 10/10 37 175–248 10/10 24 171–209 7/7 48 167–248 27/27
Sg_3 39 92–182 8/10 11 99–141 7/10 23 94–139 7/7 51 92–182 22/27
Sg_4 29 127–201 10/10 17 104–171 10/10 — — — 38 104–201 20/27
Sg_5 30 256–296 10/10 — — — 13 266–290 7/7 31 256–296 17/27
Sg_6 11 214–244 10/10 13 200–239 10/10 6 214–226 7/7 21 200–244 27/27
Sg_7 7 360–378 3/10 0 0 0/10 2 368–372 4/7 7 360–378 7/27
Sg_8 17 126–172 10/10 14 138–172 10/10 13 134–172 7/7 22 126–172 27/27
Sg_9 4 178–190 10/10 6 170–185 10/10 7 173–186 7/7 10 170–190 27/27
Sg_10 13 268–330 10/10 8 274–283 10/10 7 276–290 7/7 17 276–330 27/27
Sg_11 10 119–143 10/10 3 143–149 6/10 11 122–155 7/7 13 119–155 23/27
Sg_12 6 190–208 10/10 6 182–200 10/10 4 182–200 7/7 10 182–208 27/27
Sg_13 10 153–171 10/10 4 156–165 4/10 10 155–172 7/7 16 153–172 21/27
Sg_14 15 322–355 8/10 16 317–352 9/10 6 328–340 4/7 23 317–355 21/27

Note: — = duplicated; A = number of alleles.

a

Number of taxa with successful amplification/number of taxa attempted.

CONCLUSIONS

The general transferability, single-copy status, and variability of these loci suggest that primers designed for a single Solidago species should be applicable across the genus. Screening of the 14 SSR loci described here and those previously reported for S. sempervirens L. (Wieczorek and Geber, 2002), S. canadensis L. (Zhao et al., 2012), and S. altissima L. (Sakata et al., 2013) should therefore provide a set of >20 informative SSR loci for any goldenrod species. These loci were also readily amplifiable from herbarium specimens of a wide age range (1932–2007, Appendix 1), creating opportunities for the broad inclusion of archived museum material in future studies.

Appendix 1.

Sampling information for the eight individuals used in CAG-tag screening followed by the 126 individuals analyzed in the broader survey of locus transferability. Information presented: taxon, sample number, collector and number, herbarium, country: state/province/region, year collected.

Solidago altissima L., S206, Semple 11415, WAT, USA: Nebraska, 2006.

Solidago caesia L., S351, Semple 10778, WAT, USA: Kentucky, 1999.

Solidago gigantea Aiton, S208, Cook C-456, WAT, USA: Iowa, 2001. S215, Semple 10165, WAT, USA: Mississippi, 1991. S217, Semple 9620, WAT, USA: Kentucky, 1991.

Solidago pinetorum Small, S536, Semple 11625, WAT, USA: North Carolina, 2006.

Solidago squarrosa Muhl., S384, Semple 11529, WAT, Canada: New Brunswick, 2006.

Brintonia discoidea (Elliott) Greene, S298, Semple 11194, WAT, USA: Alabama, 2003.

Solidago subsect. Junceae (Rydb.) G. L. Nesom

Solidago confinis A. Gray, S506, Semple 8984, WAT, USA: California, 1987. S507, Semple 9632, WAT, USA: California, 1990. S508, Semple 9347, WAT, USA: California, 1990. S510, Semple 8970, WAT, USA: California, 1987. Solidago gattingeri Chapm. ex A. Gray, S521, Semple 5288, WAT, USA: Missouri, 1980. S522, Dietrich 49, MO, USA: Missouri, 1994. S524, McNeilus 93-1443, TENN, USA: Tennessee, 1993. S525, Nordman s.n., TENN, USA: Tennessee, 2000. S526, Baily s.n., TENN, USA: Tennessee, 2000. Solidago guiradonis A. Gray, S502, Semple 9356, WAT, USA: California, 1990. S503, Semple 9351, WAT, USA: California, 1990. S504, Semple 9355, WAT, USA: California, 1990. S505, Semple 9352, WAT, USA: California, 1990. Solidago juncea Aiton, S540, Semple 10677, WAT, USA: Pennsylvania, 1999. S542, Semple 4897, WAT, Canada: Nova Scotia, 1980. S543, Semple 2757, WAT, USA: Missouri, 1977. S544, Semple 2759, WAT, USA: Michigan, 1977. Solidago missouriensis Nutt., S527, Semple 7699, WAT, USA: Colorado, 1985. S528, Semple 9195, WAT, USA: Nebraska, 1990. S530, Semple 9263, WAT, USA: Utah, 1990. S531, Semple 8844, WAT, USA: Wisconsin, 1987. S532, Semple 9381, WAT, USA: New Mexico, 1990. S534, Semple 2669, WAT, Canada: Manitoba, 1977. Solidago pinetorum Small, S535, Semple 11223, WAT, USA: North Carolina, 2003. S536, Semple 11625, WAT, USA: North Carolina, 2006. S537, Semple 11599, WAT, USA: North Carolina, 2006. S538, Semple 9734, WAT, USA: North Carolina, 1991. Solidago spectabilis (D. C. Eaton) A. Gray, S511, Semple 8717, WAT, USA: California, 1986. S512, Semple 9301, WAT, USA: California, 1990. S513, Semple 9299, WAT, USA: California, 1990. S514, Semple 9310, WAT, USA: California, 1990. S516, Semple 8401, WAT, USA: California, 1986.

Solidago subsect.Squarrosae A. Gray

Solidago bicolor L., S385, Semple 10681, WAT, USA: West Virginia, 1999. S389, Semple 5927, WAT, USA: Virgina, 1981. S390, Semple 3487, WAT, USA: Vermont, 1978. S391, Semple 9487, WAT, USA: Pennsylvania, 1991. S393, Semple 6002, WAT, USA: North Carolina, 1981. S398, Semple 3614, WAT, USA: Connecticut, 1978. S400, Semple 4708, WAT, Canada: New Brunswick, 1980. S406, Semple 11472, WAT, Canada: Prince Edward Island, 2006. Solidago erecta Banks ex Pursh, S424, Semple 5984, WAT, USA: Virginia, 1981. S425, Semple 11189, WAT, USA: Tennessee, 2003. S428, Semple 9501, WAT, USA: New Jersey, 1991. S429, Semple 9454, WAT, USA: Kentucky, 1990. S433, Semple 6098, WAT, USA: South Carolina, 1981. S434, Semple 10175, WAT, USA: Mississippi, 1991. Solidago hispida Muhl., S408, Semple 3638, WAT, USA: New York, 1978. S411, Semple 4634, WAT, USA: Maine, 1980. S418, Semple 11065, WAT, Canada: Ontario, 2001. S419, Morton 12474, WAT, Canada: Newfoundland, 1978. S420, Semple 8298, WAT, USA: Arkansas, 1985. Solidago pallida (Porter) Rydb., S465, Semple 8082, WAT, USA: New Mexico, 1985. S462, Semple 11304, WAT, USA: South Dakota, 2004. S464, Semple 11401, WAT, USA: Wyoming, 2006. Solidago puberula Nutt., S437, Semple 11635, WAT, USA: North Carolina, 2006. S440, Kral 44276, WAT, USA: Alabama, 1971. S441, Semple 10137, WAT, USA: Florida, 1991. S442, Semple 9813, WAT, USA: South Carolina, 1991. S445, Cook C-118, WAT, Canada: Quebec, 2000. S448, Semple 7628, WAT, USA: Maryland, 1984. S451, Semple 6867, WAT, USA: Massachusetts, 1982. S452, Semple 10815, WAT, USA: North Carolina, 1999. Solidago rigidiuscula (Torr. & A. Gray) Porter, S466, Semple 10602, WAT, Canada: Ontario, 1997. S467, Semple 4532, WAT, USA: Indiana, 1979. S468, Semple 9121, WAT, USA: Tennessee, 1986. S469, Semple 5063, WAT, USA: Wisconsin, 1980. Solidago roanensis Porter, S455, Cook C-332, WAT, USA: Tennessee, 2000. S457, Cook C-557, WAT, USA: North Carolina, 2001. S458, Semple 9658, WAT, USA: North Carolina, 1991. S459, Poindexter 05-1580, WAT, USA: North Carolina, 2005. Solidago speciosa Nutt., S470, Semple 6180, WAT, USA: South Carolina, 1981. S471, Semple 11613, WAT, USA: Virginia, 2006. Solidago squarrosa Muhl., S371, Semple 2426, WAT, Canada: Ontario, 1976. S375, Semple 4660, WAT, USA: Maine, 1980. S379, Semple 3692, WAT, Canada: Ontario, 1978. S383, Cook C-125, WAT, Canada: Quebec, 2000. S384, Semple 11529, WAT, Canada: New Brunswick, 2006. Solidago villosicarpa LeBlond, S460, Semple 11645, WAT, USA: North Carolina, 2006. S461, Semple 11637, WAT, USA: North Carolina, 2006.

Solidago subsect. Triplinerviae (Torrey & A. Gray) G. L. Nesom

Solidago altissima L., S203, Semple 7637, WAT, USA: Illinois, 1983. S206, Semple 11415, WAT, USA: Nebraska, 2006. Solidago brendiae Semple, S253, Semple 11515, WAT, Canada: New Brunswick, 2006. S254, Semple 11432, WAT, Canada: Quebec, 2006. S255, Semple 11436, WAT, Canada: Quebec, 2006. Solidago canadensis L., S161, Cook C-14, WAT, Canada: Ontario, 1999. S164, Semple 3549, WAT, USA: Massachusetts, 1978. S165, Semple 3667, WAT, USA: New York, 1978. S166, Semple 3446, WAT, USA: Vermont, 1978. S173, Semple 2416, WAT, Canada: Ontario, 1976. Solidago chilensis Meyen, S259, Lopez Laphitz 4, WAT, Argentina: Buenos Aires, 2007. S260, Lopez Laphitz 27, WAT, Argentina: Catamarca, 2007. S262, Lopez Laphitz 12, WAT, Argentina: Chubut, 2007. S263, Lopez Laphitz 20, WAT, Argentina: Cordoba, 2007. S268, Lopez Laphitz 10, WAT, Chile: Region XI, 2007. Solidago elongata Nutt., S174, Semple 7100, WAT, USA: Oregon, 1983. S180, Semple 7170, WAT, USA: Oregon, 1983. S182, Semple 7151A, WAT, USA: Oregon, 1983. S186, Semple 8460, WAT, USA: California, 1986. S191, Semple 8431, WAT, USA: California, 1986. S196, Semple 8416, WAT, USA: California, 1986. S201, Semple 8660, WAT, USA: California, 1986. Solidago gigantea Aiton, S209, Semple 4721, WAT, Canada: Nova Scotia, 1980. S211, Semple 4960, WAT, USA: Vermont, 1980. S215, Semple 10165, WAT, USA: Mississippi, 1991. S217, Semple 9620, WAT, USA: Kentucky, 1991. S338, H.L.B 5350, DUKE, USA: North Carolina, 1932. S342, Freisner 6204, DUKE, USA: Maine, 1933. Solidago juliae G. L. Nesom, S221, Morton 16373, WAT, USA: Texas, 1985. S222, Morton 16370, WAT, USA: Texas, 1985. S223, Nesom 7219, WAT, USA: Texas, 1989. S224, Reeves R4521, WAT, USA: Arizona, 1975. S225, Keil 18989, WAT, USA: Arizona, 1985. S226, Nesom 7213, WAT, USA: Texas, 1989. Solidago lepida DC., S241, Semple 4381, WAT, USA: Idaho, 1979. S242, Semple 9209, WAT, USA: Wyoming, 1990. S245, Semple 7755, WAT, USA: Colorado, 1985. S250, Semple 11154, WAT, Canada: NW Territories, 2003. Solidago microglossa DC., S269, Lopez Laphitz 16, WAT, Argentina: Chaco, 2007. S270, Lopez Laphitz 42, WAT, Argentina: Chaco, 2007. S271, Lopez Laphitz 41, WAT, Argentina: Formosa, 2007. S273, Lopez Laphitz 47, WAT, Argentina: Corrientes, 2007. Solidago tortifolia Elliott, S227, Semple 7422, WAT, USA: Florida, 1983. S228, Semple 7534, WAT, USA: Florida, 1983. S229, Semple 3175, WAT, USA: Florida, 1977. S230, Kral 41722, WAT, USA: Alabama, 1970. S231, Cook C-669, WAT, USA: South Carolina, 2001.

LITERATURE CITED

  1. Beck J. B., Alexander P. J., Allphin L., Al-Shehbaz I. A., Rushworth C., Bailey C. D., Windham M. D. 2012. Does hybridization drive the transition to asexuality in diploid Boechera? Evolution 66: 985–995 [DOI] [PubMed] [Google Scholar]
  2. Beck J. B., Semple J. C., Brull J. M., Lance S. L., Phillips M. M., Hoot S. B., Meyer G. A.2014. Data from: Genus-wide microsatellite primers for the goldenrods (Solidago; Asteraceae). Dryad Digital Repository. http://doi.org/10.5061/dryad.72p7k.
  3. Castoe T. A., Poole A. W., de Konig A. P. J., Jones K. L., Tomback D. F., Oyler-McCance S. J., Fike J. A., et al. 2012. Rapid microsatellite identification from Illumina paired-end genomic sequencing in two birds and a snake. PLoS ONE 7: e30953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Lance S. L., Light J. E., Jones K. L., Hagen C., Hafner J. C. 2010. Isolation and characterization of 17 polymorphic microsatellite loci in the kangaroo mouse, genus Microdipodops (Rodentia: Heteromyidae). Conservation Genetics Resources 2: 139–141 [Google Scholar]
  5. Rozen S., Skaletsky H. 2000. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
  6. Sakata Y., Kaneko S., Hayano A., Inoue-Murayama M., Ohgushi T., Isagi Y. 2013. Isolation and characterization of microsatellite loci in the invasive herb Solidago altissima (Asteraceae). Applications in Plant Sciences 1: 1200313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Schilling E. E., Beck J. B., Calie P. J., Small R. L. 2008. Molecular analysis of Solidaster cv. Lemore, a hybrid goldenrod (Asteraceae). Journal of the Botanical Research Institute of Texas 2: 7–18 [Google Scholar]
  8. Schuelke M. 2000. An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology 18: 233–234 [DOI] [PubMed] [Google Scholar]
  9. Semple J. C., Cook R. E. 2006. Solidago. In Flora of North America Editorial Committee [eds.], Flora of North America, 107–166. Oxford University Press, Oxford, United Kingdom. [Google Scholar]
  10. Wieczorek A. M., Geber M. A. 2002. Microsatellite loci for studies of population differentiation and range expansion in Solidago sempervirens L. (Asteraceae). Molecular Ecology Notes 2: 554–556 [Google Scholar]
  11. Zhao S. Y., Sun S. G., Guo Y. H., Chen J. M., Wang Q. F. 2012. Isolation and characterization of polymorphic microsatellite loci from the invasive plant Solidago canadensis (Asteraceae). Genetics and Molecular Research 11: 421–424 [DOI] [PubMed] [Google Scholar]

Articles from Applications in Plant Sciences are provided here courtesy of Wiley

RESOURCES