Abstract
• Premise of the study: We developed the first microsatellites for Passiflora setacea and characterized new sets of markers for P. edulis and P. cincinnata, enabling further genetic diversity studies to support the conservation and breeding of passion fruit species.
• Methods and Results: We developed 69 microsatellite markers and, in conjunction with assessments of cross-amplification using primers available from the literature, present 43 new polymorphic microsatellite loci for three species of Passiflora. The mean number of alleles per locus was 3.1, and the mean values of the expected and observed levels of heterozygosity were 0.406 and 0.322, respectively.
• Conclusions: These microsatellite markers will be valuable tools for investigating the genetic diversity and population structure of wild and commercial species of passion fruit (Passiflora spp.) and may be useful for developing conservation and improvement strategies by contributing to the understanding of the mating system and hybridization within the genus.
Keywords: genetic diversity, genomic microsatellite-enriched library, molecular markers, Passiflora, simple sequence repeats, wild passion fruit
The genus Passiflora L. (Passifloraceae) comprises approximately 400 species, of which at least 30% are distributed within Brazilian forests (Cervi et al., 2010). Species such as P. edulis Sims are important because of the economic value of their fruit (Faleiro et al., 2005). Certain wild species, including P. setacea DC. and P. cincinnata Mast., are of interest because of their potential use in genetic breeding. However, the limited number of molecular genetic diversity studies of this genus (Faleiro et al., 2005; Cerqueira-Silva et al., 2012) attests to the need for and relevance of novel molecular tools for studies of its populations and mating system.
Although diversity studies of passion fruit began in the late 1990s, efforts to use microsatellites only began in 2005 (Oliveira et al., 2005; Pádua et al., 2005), and studies related to the development of microsatellites have been published for P. cincinnata (Cerqueira-Silva et al., 2012) and P. contracta Vitta (Cazé et al., 2012) only recently. The markers available are still insufficient for performing consistent genetic studies of most Passiflora species because the evaluated populations exhibit low variability and percentages of polymorphic loci (between 0% and 26%) (Pereira, 2010; Ortiz et al., 2012; Cerqueira-Silva et al., 2012). Thus, considering the difficulty in obtaining informative microsatellites for Passiflora and to enhance the genetic investigation of both wild and commercial populations, we isolated, characterized, and evaluated the cross-amplifications of microsatellites for P. edulis, P. setacea, and P. cincinnata.
METHODS AND RESULTS
Two microsatellite-enriched genomic libraries were developed using genotypes from the germplasm collection of P. edulis (Pe-UESB01) and P. setacea (Ps-UESB01) from the Universidade Estadual do Sudoeste da Bahia (UESB; Itapetinga, Bahia, Brazil). Genomic DNA was isolated from fresh leaves using the cetyltrimethylammonium bromide (CTAB) method, and libraries were constructed following Billote et al. (1999). DNA samples (5 μg) were digested with AfaI and ligated to the double-stranded adapters 5′-CTCTTGCTTACGCGTGGACTA-3′ and 5′-TAGTCCACGCGTAAGCAAGAGCACA-3′. Enrichment was performed using a hybridization-based capture with (GT)8 and (CT)8 biotin-linked probes and streptavidin-coated magnetic beads (Streptavidin Magnesphere Paramagnetic Particles; Promega Corporation, Madison, Wisconsin, USA). The selected fragments were cloned into a pGEM-T Easy Vector (Promega Corporation) and used to transform Escherichia coli xl1-blue competent cells (Stratagene, La Jolla, California, USA). The recombinant colonies were selected using blue/white screening. In total, 480 positive clones (192 for P. edulis and 288 for P. setacea) were randomly selected and double-sequenced using an ABI PRISM 377 automated DNA sequencer (Applied Biosystems, Foster City, California, USA). Every sequence was aligned and edited using SeqMan software (DNASTAR, Madison, Wisconsin, USA). We used the MICROSAT software developed by A. M. Risterucci at the Centre de Coopération Internationale en Recherche Agronomique pour le Développement (CIRAD, France; unpublished) to identify and eliminate the adapters and restriction sites from the edited sequences.
Sequences containing microsatellites (134 for P. edulis and 114 for P. setacea) were identified using the SSR Identification Tool (SSRIT; Temnykh et al., 2001). Approximately 85% of the microsatellite motifs observed for both of the species were dinucleotides. We designed a total of 30 (P. edulis) and 75 (P. setacea) primer pairs using PrimerSelect (DNASTAR) and Primer3Plus (Untergasser et al., 2007). The 105 primer pairs exhibited the following characteristics: annealing temperatures ranging from 45°C to 65°C (with a maximum difference of 3°C between the forward and reverse primers), CG concentrations ranging from 40% to 70%, and amplified product sizes varying from 100 to 300 bp. We used 16 genotypes of passion fruit (eight for each species) for the amplification tests. PCRs were conducted using a final volume of 15 μL (containing 15 ng of template DNA) with the reagents and concentrations described by Cerqueira-Silva et al. (2012). Every marker was evaluated by PCR amplification as follows: 94°C for 5 min; 34 cycles of 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min; and a final extension at 72°C for 10 min. The loci that showed unsatisfactory amplification with an annealing temperature of 60°C were subjected to two different touchdown PCR protocols (TD 65–55°C and TD 58–48°C) as follows: an initial denaturation (94°C for 5 min); 10 cycles of 94°C for 1 min and an annealing temperature decreasing by 1°C from 65–55°C or 58–48°C every cycle for 1 min; 14 cycles of 94°C for 1 min, 55°C or 48°C for 1 min, and 72°C for 1 min; and a final extension at 72°C for 10 min. For markers that showed inconsistent amplification after the touchdown protocols, we tested reactions with an annealing temperature gradient ranging from 65°C to 50°C. The products were visualized using vertical electrophoresis on 6% denaturing polyacrylamide gels run in 1× TBE and stained with silver nitrate. The product sizes were determined using a 10-bp DNA ladder (Invitrogen, Carlsbad, California, USA). In total, 17 and 52 markers generated consistent patterns of amplification that matched the expected sizes based on the sequenced fragments from P. edulis and P. setacea, respectively (Table 1). Cross-amplification assays were performed according to previously described protocols, with all 69 primer pairs showing a high percentage of amplification (88% [P. edulis], 70% [P. setacea], and 80% [P. cincinnata]) (Table 1). Cross-amplification assays were also performed with the 25 loci previously characterized for P. cincinnata (Cerqueira-Silva et al., 2012), presenting a percentage of amplification of 48% in P. edulis (mPc-UNICAMP02, -04, -06, -10, -11, -14, -15, -17, -18, -20, -21, and -24) and 28% in P. setacea (mPc-UNICAMP02, -04, -06, -10, -15, -19, and -20).
Table 1.
Characteristics of the 69 new microsatellite markers developed for passion fruit species (17 markers for Passiflora edulis and 52 markers for P. setacea) and cross-amplification assays.
| Locus | Primer sequences (5′–3′) | Allele size (bp) | Repeat motif | PCR amplification conditionsa | GenBank accession no. | Cross-amplification | ||
| Pe | Ps | Pc | ||||||
| mPe-UNICAMP01 | F: CCTGTCGGAAAGACTTCTGC | 230–232 | (AC)4 | TD58 | KF142650 | 232 | 232 | |
| R: GGATCGTTGTGGAGTGTGGT | ||||||||
| mPe-UNICAMP02 | F: TCGAGTGAGATTGGCAGTG | 165–171 | (GT)8 | TD58 | KF142651 | 161–163 | 163 | |
| R: TTGGCTTCGAGGAGAAGAA | ||||||||
| mPe-UNICAMP03 | F: ATAGGCATTTCACAACAGCAC | 261 | (AC)8 | TD58 | KF142652 | 261 | 261 | |
| R: AAGCATCCGTGAGACAGGT | ||||||||
| mPe-UNICAMP04 | F: GCTAACAAGCCCAAATCAAC | 296 | (CA)5 | TD65 | KF142653 | 296 | 296 | |
| R: CAGACCATGAGACGGCAGTA | ||||||||
| mPe-UNICAMP05 | F: CGGGGTTATGCAAGGTAACA | 121 | (TG)8 | TD65 | KF142654 | — | — | |
| R: ACTGGGTGGACTAGGAAACG | ||||||||
| mPe-UNICAMP06 | F: GTTCGAACCTTGGTTCTCTTG | 292 | (TG)4 | TD65 | KF142655 | — | 290–320 | |
| R: AATCCTCTCCCGGTATCCAC | ||||||||
| mPe-UNICAMP07 | F: GGAACCGTGTGATGGGATAC | 255 | (AG)8 | TD65 | KF142656 | 255 | 255 | |
| R: ACCGATTGACAGCTCTGCC | ||||||||
| mPe-UNICAMP08 | F: GCTGAGAACCCCGTGACTTA | 196 | (CA)4 | TD65 | KF142657 | 196 | 196 | |
| R: CGAGTATGGCACATCCCTG | ||||||||
| mPe-UNICAMP09 | F: TGCCTCTCGGATATTTACAGC | 212 | (AC)5 | TD58 | KF142658 | 212 | 248–261 | |
| R: CGCATGTCCCCATACGAC | ||||||||
| mPe-UNICAMP10 | F: GTCACTGCAGCCTGGTATAGTT | 251 | (CT)5 | TD58 | KF142659 | 251 | 251 | |
| R: GAACATATTCGGCAGATGGA | ||||||||
| mPe-UNICAMP11 | F: GCAGCAATCAATGCAATCAG | 180 | (CA)9(AT)5 | TD58 | KF142660 | 172 | 176 | |
| R: GCCATTCTCCTCTCACCGTA | ||||||||
| mPe-UNICAMP12 | F: CACACAAGGCGTTTCTTACG | 214 | (CA)7 | TD65 | KF142661 | — | — | |
| R: TGATATGAACGATACGGTAGGC | ||||||||
| mPe-UNICAMP13 | F: TTCGTGCATTGTTCATTACC | 202 | (TC)5 | TD58 | KF142662 | 202 | 166–168 | |
| R: GCCTTCTTTGTCATGTTGGA | ||||||||
| mPe-UNICAMP14 | F: GACTTCGTATGACGCCAGGT | 263 | (CA)8 | TD65 | KF142663 | 263 | 260 | |
| R: TGCAAGAATCCGAAGACTCA | ||||||||
| mPe-UNICAMP15 | F: CATTCCTCACCCTCACGAA | 253 | (AC)5 | TD58 | KF142664 | 253 | 253 | |
| R: TGGTTGTGTGGTTTGTGCTT | ||||||||
| mPe-UNICAMP16 | F: CGTGGGTGAGTGTGAATGAG | 195 | (AT)4(TG)11 | TD65 | KF142665 | — | — | |
| R: TGATGTGAGCATGGTTGGTT | ||||||||
| mPe-UNICAMP17 | F: GCCACGTGCAATGTCAGT | 300 | (AC)9 | TD65 | KF142666 | — | — | |
| R: CGTGCTGTGACCAAGGAG | ||||||||
| mPs-UNICAMP01 | F: TAGCTTAACACAATGCAACAGA | 153–154 | (TG)5(TG)5 | TD58 | KF171014 | 158–168 | 154 | |
| R: CAACGGAGAACGATGTCAG | ||||||||
| mPs-UNICAMP02 | F: TAGCTTAACACAATGCAACAGA | 154–156 | (TG)5(TG)5 | TD58 | KF171015 | 160–170 | 156 | |
| R: CAACGGAGAACGATGTCAG | ||||||||
| mPs-UNICAMP03 | F: GTAGCGTCTCGGCAGGTC | 176–177 | (CT)4 | TD65 | KF171016 | 176 | 176 | |
| R: ACTCTAAGTCGGCCACTCTTG | ||||||||
| mPs-UNICAMP04 | F: CAACAGGAGGTGAGGTGTGA | 156–157 | (TG)4 | TD65 | KF171017 | 156 | 156 | |
| R: GACAGTGCAACTTTAGGCGAC | ||||||||
| mPs-UNICAMP05 | F: TCGGTCTTCGTATTCAACTCTG | 194–218 | (CT)8 | 61.5°C | KF171018 | 210–220 | 213–216 | |
| R: GAGGAACTGGCATCGCAT | ||||||||
| mPs-UNICAMP06 | F: GTTGGATCAAAGGGTCACA | 218–224 | (CGTG)3(ATGA)3 | TD65 | KF171019 | 194–224 | 215 | |
| R: CAACTACTGGATCGAACTGGTA | ||||||||
| mPs-UNICAMP07 | F: ACAGGGGTGAGGCACATTC | 143–145 | (CA)4 | TD58 | KF171020 | — | — | |
| R: TCTGTTATTATCATCGGCAGGA | ||||||||
| mPs-UNICAMP08 | F: AGTGCCAGTGGCTTCGTATT | 207–211 | (TGCAA)3 | TD65 | KF171021 | 174 | 176 | |
| R: GATCGTCATGGCTGTTGCTA | ||||||||
| mPs-UNICAMP09 | F: GGGCCGTTGTCAAAGTAGT | 250–268 | (AC)4 | 61.5°C | KF171022 | 258–260 | 260 | |
| R: GAGGTTAAGGCAAGCACTG | ||||||||
| mPs-UNICAMP10 | F: ACTCTCACCTCAATCGACC | 256–260 | (AG)4(GT)5(GT)4 | 60°C | KF171023 | 264–268 | 260–268 | |
| R: AATTGTTACTCCGTTTCTCTGA | ||||||||
| mPs-UNICAMP11 | F: CAGACGTTGTGTTTTGGTAAT | 232–270 | (CA)4(CA)4(AT)4 | 60°C | KF171024 | 262 | — | |
| R: TCAGGTTAGGAAGCTGCATC | ||||||||
| mPs-UNICAMP12 | F: ACAGGGGTGAGGCACATACA | 201–204 | (CA)4 | TD65 | KF171025 | 208 | 208 | |
| R: GTAGTGCGTGGCTTGGGTAG | ||||||||
| mPs-UNICAMP13 | F: CCTATACCTGCCCAGTCAGC | 146–148 | (CA)4 | TD65 | KF171026 | 144 | — | |
| R: ACTTAAGCACCCCAATCGTT | ||||||||
| mPs-UNICAMP14 | F: CGTTCATAAGTGAATCAGTCAA | 112–116 | (CA)4 | TD65 | KF171027 | 114 | 114 | |
| R: GGATCGACAAACAAAGGTAGA | ||||||||
| mPs-UNICAMP15 | F: TATGGAGTTGCGAGGCTTTAG | 145–148 | (GT)4 | 60°C | KF171028 | 143–145 | 146 | |
| R: CGGGCAACGAACACTTTATT | ||||||||
| mPs-UNICAMP16 | F: GAGAAAGCGAGTCAGCGAGA | 157–165 | (GAG)6(CAA)4 | TD65 | KF171029 | 163–167 | 159–170 | |
| R: GACTCCAATATCGGCACTTCA | ||||||||
| mPs-UNICAMP17 | F: CATCCAACCTCCGAACCTTA | 142–148 | (AC)5 | 60°C | KF171030 | 147 | 146 | |
| R: TACCCAGTCCGGTCCATTAG | ||||||||
| mPs-UNICAMP18 | F: GGGGTTCTTCACTCATCCAC | 262–278 | (CA)10(AT)6 | TD65 | KF171031 | — | — | |
| R: TGACGACTAGGGGATTCAGG | ||||||||
| mPs-UNICAMP19 | F: CTGTGGCAAGTGGCTAACAA | 290–294 | (TG)4 | 60°C | KF171032 | 290 | 290 | |
| R: CCACCCTACTCGACCAACTC | ||||||||
| mPs-UNICAMP20 | F: GCTGGCTCTAGCTCAACTCG | 200 | (CT)5 | TD65 | KF171033 | 200 | 200 | |
| R: GCCAGCATAGGATGTCAGGT | ||||||||
| mPs-UNICAMP21 | F: CCCAATCGCTGAGAGGAGT | 228 | (TG)4 | TD58 | KF171034 | — | — | |
| R: CGGTAGGCTCATTCGTGTCA | ||||||||
| mPs-UNICAMP22 | F: AGGCATGCCCATCAAATG | 131 | (GT)5(GT)4 | TD58 | KF171035 | — | — | |
| R: CACTAAAACCTGCAAAGCGAA | ||||||||
| mPs-UNICAMP23 | F: GAGCAGCTAAAAGAAACCTAC | 298 | (AC)5(CA)4 | TD58 | KF171036 | 298 | 298 | |
| R: TAGAGGTTGTGCTGGAGTC | ||||||||
| mPs-UNICAMP24 | F: GAGGTCCCACCAGTGTCAGT | 254 | (AG)4 | TD58 | KF171037 | 254 | 258–260 | |
| R: CTAGCGTCACCCTCCAGAAG | ||||||||
| mPs-UNICAMP25 | F: GTGTTTGTGGCGATGTGATTA | 162 | (AAG)5 | TD58 | KF171038 | 162 | 162 | |
| R: GACAAACGTTGTTTCCGCTC | ||||||||
| mPs-UNICAMP26 | F: TGTGGCATGTGTATGACTTGAT | 166 | (TG)4 | TD58 | KF171039 | 166 | 174 | |
| R: CATAGATATGGGATGAGCGACA | ||||||||
| mPs-UNICAMP27 | F: AGATGGAACAGGTGGGTGAG | 151 | (CCA)5 | TD58 | KF171040 | 151 | 151 | |
| R: TAGGCTTGTTCTGGCTCTGG | ||||||||
| mPs-UNICAMP28 | F: AATTGTCATCGGTAAACCTGC | 274 | (AC)6 | TD58 | KF171041 | 274 | 274 | |
| R: TGCCATTGCGAGTGAATAAG | ||||||||
| mPs-UNICAMP29 | F: GAGAAATCTCAGCACACGCA | 204 | (CA)5 | TD58 | KF171042 | — | — | |
| R: CGGTTCTTGGTTTTGTGGAT | ||||||||
| mPs-UNICAMP30 | F: CGGCTGAAGGAGGAGGTAG | 118 | (GT)6 | TD58 | KF171043 | — | — | |
| R: TGAAAAACAAGTCAGCCAACA | ||||||||
| mPs-UNICAMP31 | F: GGTGTGGTAGCCTGTTTGTC | 211 | (TG)4(GT)5 | TD65 | KF171044 | 215 | 215–219 | |
| R: CCGCATCTCTTACATCGTTA | ||||||||
| mPs-UNICAMP32 | F: CAGACGTTGCATCTTGGTAAT | 172 | (CA)4(AC)9(AT)6 | TD65 | KF171045 | 172 | 172 | |
| R: CATCGGAGGAGTTTTACACATT | ||||||||
| mPs-UNICAMP33 | F: GCAGCAATCAATGCAATCAG | 184 | (AT)4(CA)10(AT)6 | TD65 | KF171046 | 184 | 184 | |
| R: GCCATTCTCCTCTCACCGTA | ||||||||
| mPs-UNICAMP34 | F: GGCAGGATATGCTTTGGTT | 162 | (TC)10 | TD65 | KF171047 | 160 | 158–161 | |
| R: GCTGTCGGACACATGGAC | ||||||||
| mPs-UNICAMP35 | F: TCGAGAGTTGCGTGTGTTTC | 183 | (TG)4 | TD65 | KF171048 | 183 | 183 | |
| R: CATTCTCCTGCCACCTGAGT | ||||||||
| mPs-UNICAMP36 | F: GGGAGTCGGGTTGAGTTA | 228 | (TG)4(TG)7 | TD65 | KF171049 | 228 | 228 | |
| R: AGTCGAGGACCAGTCAAAG | ||||||||
| mPs-UNICAMP37 | F: TTGTTTGGGTTAGCGTGTGAG | 172 | (TG)6 | TD65 | KF171050 | 172 | 172 | |
| R: CCCTGCCACCTGAGTAATCA | ||||||||
| mPs-UNICAMP38 | F: CCTGACCTCTGGCACTACC | 112 | (TGC)6 | TD65 | KF171051 | 112 | 112 | |
| R: GAGGCGTATCAGGCTTTGA | ||||||||
| mPs-UNICAMP39 | F: GGAGGGTTGTTGTGTGAGTG | 230 | (GT)4 | TD65 | KF171052 | 230 | — | |
| R: CTCCTGTCGGAAAGACTTCTG | ||||||||
| mPs-UNICAMP40 | F: GAATCAATGGAACACAAGCA | 224 | (AC)5 | TD65 | KF171053 | 234 | 230 | |
| R: CCAGCCCACTAGACCACCT | ||||||||
| mPs-UNICAMP41 | F: CTTCAGTGCAGCCTTCCAT | 168 | (GT)4 | 60°C | KF171054 | 168 | 170 | |
| R: ATACCGATACTCGCCTTGATAG | ||||||||
| mPs-UNICAMP42 | F: AGTGCCAGTGGCTTCGTATT | 174 | (TGCAA)3 | 61.5°C | KF171055 | 174 | 174 | |
| R: GATCGTCATGGCTGTTGCTA | ||||||||
| mPs-UNICAMP43 | F: CTCAGTGAGGAATAAGCAATCA | 192 | (CA)4 | 61.5°C | KF171056 | 198 | 198 | |
| R: ATTTGGCATGCTGTTACGC | ||||||||
| mPs-UNICAMP44 | F: AGTCGTGCTTGTGTTGTTGAG | 275 | (GATT)3 | TD65 | KF171057 | 280 | 275 | |
| R: CCACTGTTGAGGTCCAGATG | ||||||||
| mPs-UNICAMP45 | F: CCTATACCTGCCCCAGTCAG | 110 | (AT)4(CA)4 | TD65 | KF171058 | 110 | 110 | |
| R: GTATGTGTGTGCCGTGGATT | ||||||||
| mPs-UNICAMP46 | F: TGCGTGTTGTCCCACCAT | 138 | (CT)8 | TD65 | KF171059 | 138 | 138–139 | |
| R: GACTGAGCGGACTCACATCA | ||||||||
| mPs-UNICAMP47 | F: AAATTTCGGCATGGTTTATG | 298 | (AC)5(CA)4 | 60°C | KF171060 | 294 | 298 | |
| R: CCGAGATCGTTGGAGCTTA | ||||||||
| mPs-UNICAMP48 | F: AGCTTACCGGCTCACTCTTG | 144 | (AC)6 | 60°C | KF171061 | 143 | 142 | |
| R: GACAGGCTTGGAACTGGAAT | ||||||||
| mPs-UNICAMP49 | F: TGTATGAGTGAGAATGAGCCCA | 118 | (TA)4 | TD65 | KF171062 | 126 | 126 | |
| R: CAATCAACATGAGACAAGCGG | ||||||||
| mPs-UNICAMP50 | F: TTCTGCGAAACTGGTGAGTG | 202 | (TA)6 | 60°C | KF171063 | 202 | 202 | |
| R: CGCCCGTATTTTGTCATGA | ||||||||
| mPs-UNICAMP51 | F: CTTGCACACTCACGGCTAAA | 152 | (GT)5 | 60°C | KF171064 | 152 | 150–152 | |
| R: CAACCTACTGGATCGAACTGAA | ||||||||
| mPs-UNICAMP52 | F: GTCCGTTGAGAACCCCGTA | 118 | (AT)5 | 60°C | KF171065 | 118 | — | |
Note: — = unsuccessful amplification; Pc = Passiflora cincinnata; Pe = Passiflora edulis; Ps = Passiflora setacea.
TD65 and TD58 indicate touchdown PCR programs with temperatures ranging from 65°C to 55°C and 58°C to 48°C, respectively.
To characterize all the loci, we used genotypes from the germplasm collection of the Embrapa Mandioca Fruticultura Center (Empresa Brasileira de Pesquisa Agropecuária [EMBRAPA]), Cruz das Almas, Bahia, Brazil, and of the UESB, Itapetinga, Bahia, totaling 114 genotypes. For each species, 42, 42, and 30 genotypes from P. edulis (all from EMBRAPA), P. setacea (30 from EMBRAPA and 12 from UESB), and P. cincinnata (all from EMBRAPA), respectively, were used (Appendix S1 (130.5KB, doc) ). We performed a descriptive statistical analysis for all the polymorphic loci using GENEPOP software (Raymond and Rousset, 1995; Table 2). The polymorphism information content was calculated using PIC Calculator software (Kemp, 2002), and the probability of null alleles was estimated using MICRO-CHECKER software (van Oosterhout et al., 2004), with significant probabilities between two and six loci observed for the three species evaluated (Table 2).
Table 2.
Results of the initial screening of polymorphic microsatellite markers in populations of Passiflora edulis, P. setacea, and P. cincinnata.
| P. edulis (N = 42) | P. setacea (N = 42) | P. cincinnata (N = 31) | ||||||||||
| Locus | A | Ho | He | PIC | A | Ho | He | PIC | A | Ho | He | PIC |
| mPe-UNICAMP01 | 2 | 0.051 | 0.047 | 0.476 | 1 | — | — | — | 1 | — | — | — |
| mPe-UNICAMP02 | 4 | 0.651 | 0.515 | 0.404 | 2 | 0.261 | 0.497 | 0.371a | 1 | — | — | — |
| mPe-UNICAMP06 | 1 | — | — | — | 0 | — | — | — | 2 | 0.083 | 0.079 | 0.077 |
| mPe-UNICAMP09 | 1 | — | — | — | 1 | — | — | — | 6 | 0.458 | 0.679 | 0.628a |
| mPe-UNICAMP13 | 1 | — | — | — | 1 | — | — | — | 3 | 0.055 | 0.205 | 0.191ab |
| mPs-UNICAMP01 | 5 | 0.578 | 0.723 | 0.642a | 2 | 0.333 | 0.512 | 0.393a | 1 | — | — | — |
| mPs-UNICAMP02 | 5 | 0.631 | 0.768 | 0.704 | 2 | 0.333 | 0.511 | 0.389a | 1 | — | — | — |
| mPs-UNICAMP03 | 1 | — | — | — | 2 | 0.311 | 0.266 | 0.225 | 1 | — | — | — |
| mPs-UNICAMP04 | 1 | — | — | — | 2 | 0.142 | 0.133 | 0.123 | 1 | — | — | — |
| mPs-UNICAMP05 | 4 | 0.381 | 0.471 | 0.476b | 4 | 0.261 | 0.593 | 0.468a, b | 3 | 0.401 | 0.513 | 0.392 |
| mPs-UNICAMP06 | 4 | 0.191 | 0.176 | 0.157 | 2 | 0.424 | 0.401 | 0.322 | 1 | — | — | — |
| mPs-UNICAMP07 | 0 | — | — | — | 2 | 0.251 | 0.221 | 0.194 | 0 | — | — | — |
| mPs-UNICAMP08 | 1 | — | — | — | 2 | 0.102 | 0.097 | 0.093 | 1 | — | — | — |
| mPs-UNICAMP09 | 2 | 0.024 | 0.024 | 0.023 | 4 | 0.761 | 0.614 | 0.551 | 1 | — | — | — |
| mPs-UNICAMP10 | 3 | 0.119 | 0.197 | 0.186a | 3 | 0.357 | 0.583 | 0.493a,b | 4 | 0.448 | 0.637 | 0.577a |
| mPs-UNICAMP11 | 1 | — | — | — | 3 | 0.166 | 0.157 | 0.149 | 0 | — | — | — |
| mPs-UNICAMP12 | 1 | — | — | — | 2 | 0.208 | 0.187 | 0.371 | 1 | — | — | — |
| mPs-UNICAMP13 | 1 | — | — | — | 2 | 0.282 | 0.456 | 0.351a | 0 | — | — | — |
| mPs-UNICAMP14 | 1 | — | — | — | 4 | 0.589 | 0.674 | 0.678b | 1 | — | — | — |
| mPs-UNICAMP15 | 2 | 0.024 | 0.024 | 0.023 | 3 | 0.101 | 0.531 | 0.411a,b | 1 | — | — | — |
| mPs-UNICAMP16 | 3 | 0.476 | 0.585 | 0.499 | 3 | 0.391 | 0.485 | 0.395 | 4 | 0.561 | 0.541 | 0.464 |
| mPs-UNICAMP17 | 1 | — | — | — | 4 | 0.833 | 0.714 | 0.656b | 1 | — | — | — |
| mPs-UNICAMP18 | 0 | — | — | — | 4 | 0.524 | 0.454 | 0.412 | 0 | — | — | — |
| mPs-UNICAMP19 | 1 | — | — | — | 2 | 0.189 | 0.173 | 0.566 | 1 | — | — | — |
| mPs-UNICAMP24 | 1 | — | — | — | 1 | — | — | — | 2 | 0.125 | 0.187 | 0.169 |
| mPs-UNICAMP31 | 1 | — | — | — | 1 | — | — | — | 3 | 0.217 | 0.326 | 0.282 |
| mPs-UNICAMP34 | 0 | — | — | — | 1 | — | — | — | 5 | 0.401 | 0.671 | 0.592a,b |
| mPs-UNICAMP46 | 1 | — | — | — | 1 | — | — | — | 2 | 0.041 | 0.041 | 0.041 |
| mPs-UNICAMP51 | 1 | — | — | — | 1 | — | — | — | 2 | 0.033 | 0.033 | 0.038 |
| mPc-UNICAMP11c | 4 | 0.237 | 0.447 | 0.424b | 0 | — | — | — | 1 | — | — | — |
| mPc-UNICAMP19c | 0 | — | — | — | 4 | 0.418 | 0.411 | 0.367 | 1 | — | — | — |
Note: — = information not available; A = number of alleles per locus; He = expected heterozygosity; Ho = observed heterozygosity; PIC = polymorphism information content.
Markers with the probability of null allele occurrence after a Bonferroni correction.
Markers deviating from Hardy–Weinberg equilibrium after a Bonferroni correction (P < 0.004 [P. edulis and P. cincinnata]; P < 0.002 [P. setacea]).
Microsatellite markers published by Cerqueira-Silva et al. (2012).
The percentage of polymorphic microsatellites observed was 15% in P. edulis, 29% in P. setacea, and 20% in P. cincinnata, totaling 11, 21, and 11 polymorphic loci, respectively (Table 2). This low number of polymorphic loci was expected because low variability appears to be a characteristic of the genus Passiflora, as suggested by Cerqueira-Silva et al. (2012). The number of alleles per locus ranged from two to six, with a mean of 3.1 for the three species evaluated; overall, the observed heterozygosity was lower than expected heterozygosity. Of the 31 polymorphic microsatellites, only one (P. edulis), six (P. setacea), and two (P. cincinnata) showed significant deviation from Hardy–Weinberg equilibrium (HWE) after a Bonferroni correction. Deviations from HWE can be explained by linkage disequilibrium (LD) or the occurrence of null alleles. Among the 320 possible pairs of microsatellites, we observed significant LD for two pairs (in P. edulis; P < 0.004), 49 pairs (in P. setacea; P < 0.002), and one pair (in P. cincinnata; P < 0.004) after a Bonferroni correction. However, with no additional information, LD should not be attributed solely to physical linkages among loci because of the possibility of population processes such as nonrandom mating (Hedrick, 2005).
CONCLUSIONS
We present the first set of microsatellites developed for P. setacea and characterize new markers for P. edulis and P. cincinnata, thereby increasing the number of available markers for these species. This effort potentiates the use of microsatellites in genetic studies of wild and commercial populations of Passiflora species, enabling the development of more efficient conservation and genetic breeding strategies.
Supplementary Material
LITERATURE CITED
- Billote N., Lagoda P. J. L., Risterucci A. M., Baurens F. C. 1999. Microsatellite-enriched libraries: Applied methodology for the development of SSR markers in tropical crops. Fruits 54: 277–288 [Google Scholar]
- Cazé A. L. R., Kriedt R. A., Beheregaray L. B., Bonatto S. L., Freitas L. B. 2012. Isolation and characterization of microsatellite markers for Passiflora contracta. International Journal of Molecular Sciences 13: 11343–11348 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cerqueira-Silva C. B. M., Santos E. S. L., Souza A. M., Mori G. M., Oliveira E. J., Corrêa R. X., Souza A. P. 2012. Development and characterization of microsatellite markers for the wild South American Passiflora cincinnata (Passifloraceae). American Journal of Botany 99: e170–e172 [DOI] [PubMed] [Google Scholar]
- Cervi A. C., Milward-De-Azevedo M. A., Bernacci L. C. 2010. Passifloraceae. In Lista de Espécies da Flora do Brasil [online]. Jardim Botânico do Rio de Janeiro, Rio de Janeiro, Brazil. Website http://floradobrasil.jbrj.gov.br/jabot/floradobrasil/FB182 [accessed 19 January 2014].
- Faleiro F. G. F., Junqueira N. T. V., Braga M. F. 2005. Germoplasma e melhoramento genético do maracujazeiro: Desafios da pesquisa, 55–78. In F. G. Faleiro, N. T. V. Junqueira, and M. F. Braga [eds.], Maracujá: Germoplasma e melhoramento genético. Embrapa Cerrados, Planaltina, Brazil. [Google Scholar]
- Hedrick P. W. 2005. Genetics of populations, 3rd ed. Jones Bartlett Publishers, Boston, Massachusetts, USA [Google Scholar]
- Kemp S. 2002. PIC Calculator Extra. Website http://www.genomics.liv.ac.uk/animal/pic.html [accessed 25 April 2012].
- Oliveira E. J., Padua J. G., Zucchi M. I., Camargo L. E. A., Fungaro M. H. P., Vieira M. L. C. 2005. Development and characterization of microsatellite markers from the yellow passion fruit (Passiflora edulis f. flavicarpa). Molecular Ecology Notes 5: 331–333 [Google Scholar]
- Ortiz D. C., Bohórquez A., Duque M. C., Tohme J., Cuéllar D., Vásquez T. M. 2012. Evaluating purple passion fruit (Passiflora edulis Sims f. edulis) genetic variability in individuals from commercial plantations in Colombia. Genetic Resources and Crop Evolution 59: 1089–1099 [Google Scholar]
- Pádua J. G., Oliveira E. J., Zucchi M. I., Oliveira G. C. X., Camargo L. E. A., Vieira M. L. C. 2005. Isolation and characterization of microsatellite markers from the sweet passion fruit (Passiflora alata Curtis Passifloraceae). Molecular Ecology Notes 5: 863–865 [Google Scholar]
- Pereira G. S.2010. Desenvolvimento de Marcadores SSR, M-AFLP e SNP visando à integração de mapas genético-moleculares de Passiflora alata Curtis. M.Sc. dissertation, Universidade Estadual de São Paulo, Escola Superior de Agricultura ‘Luiz de Queiroz’, Piracicaba, São Paulo, Brazil.
- Raymond M., Rousset F. 1995. GENEPOP (version 1.2): Population genetics software for exact tests and ecumenicism. Heredity 86: 248–249 [Google Scholar]
- Temnykh S., Clerck G., Lukashova A., Lipovich L., Cartinhour S., McCouch S. 2001. Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): Frequency, length variation, transposon associations, and genetic marker potential. Genome Research 11: 1441–1452 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Untergasser A., Nijveen H., Rao X., Bisseling T., Geurts R., Leunissen J. A. M. 2007. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Research 35 (Supplement 2): W71–W74 [DOI] [PMC free article] [PubMed] [Google Scholar]
- van Oosterhout C. V., Hutchinson W. F., Wills D. P. M., Shipley P. 2004. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535–538 [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.