Abstract
• Premise of the study: Sixteen novel, polymorphic, multiplexed microsatellite loci were developed for eastern white cedar (Thuja occidentalis) using simple sequence repeat (SSR)–enriched shotgun pyrosequencing.
• Methods and Results: Sixteen loci were tested on a panel of 24 individuals from different populations. The number of observed alleles ranged from four to 22. Four sets of multiplex PCR for the 16 loci were then carried out on 60 individuals of two populations from islands of FERLD Duparquet Forest, Canada. Mean number of alleles, observed heterozygosity, and expected heterozygosity were respectively 5.75, 0.594, and 0.574 for Island 58, and 5.50, 0.704, and 0.624 for Island 134.
• Conclusions: Four sets of multiplex microsatellite loci can be used for future genetic studies, which includes investigating genetic diversity and structure, and fragmentation and regeneration studies.
Keywords: 454 GS-FLX Titanium, microsatellite marker, next-generation sequencing, population genetics, shotgun pyrosequencing, Thuja occidentalis
Eastern white cedar (Thuja occidentalis L.) is a native, wind-pollinated conifer with a broad distribution across North America (Fowells, 1965). The species’ range extends from the Gulf of St. Lawrence in the east to southeastern Manitoba in the west, and from James Bay in the north to Tennessee and North Carolina in the south (Fowells, 1965). A member of the Cupressaceae, it is also commonly called eastern arborvitae, American arborvitae, northern white cedar, Atlantic red cedar, and swamp cedar in English (USDA NRCS, 2013), and thuya occidental, cèdre, balai, cèdre blanc, thuier cèdre, and arborvitae in French (Brouillet et al., 2010). Eastern white cedar (EWC) is listed as endangered in Indiana, Massachusetts, and New Jersey, as a threatened species in Connecticut, Illinois, Kentucky, and Maryland, and of special concern in Tennessee (USDA NRCS, 2013). Genetic analyses previously conducted on EWC have been mainly based on allozyme markers (Hofmeyer et al., 2007), while highly polymorphic markers such as microsatellites have not been developed for EWC. We report on the development and characterization of microsatellite markers for EWC using shotgun pyrosequencing on a simple sequence repeat (SSR)–enriched library (Malausa et al., 2011).
METHODS AND RESULTS
Foliage of EWC individuals from 14 sites across northern Quebec (Appendix 1) was collected and maintained at −20°C before genetic analysis. Genomic DNA was extracted using the DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). DNA extracts of 14 individuals were combined and sent on dry ice to Genoscreen (Lille, France) for microsatellite-enriched GS-FLX library construction following the methodology developed by Malausa et al. (2011). Briefly, main steps included: (1) digestion of genomic DNA with RsaI (Fermentas International Inc., Burlington, Ontario, Canada); (2) enrichment of microsatellite sequences in fragmented DNA with eight types of probes (TG, TC, AAC, AAG, AGG, ACG, ACAT, ACTC), which was accomplished by using Dynabeads (Invitrogen, Carlsbad, California, USA); and (3) PCR amplification of enriched DNA with primers specific to the adapter sequences (Malausa et al., 2011). In total, 11,393 raw sequences with an average read length of 400 bp were obtained, with 2175 sequences containing microsatellite motifs. One hundred seventeen of the sequences successfully had primers designed for them using QDD software (Meglécz et al., 2010) using default parameters except optimal primer length of 22 bp (range 18–27 bp) and 50% GC content (range 40–60%).
To minimize screening costs, we initially selected 48 of 117 pairs following criteria detailed in Lepais and Bacles (2011). In brief, we restricted our selection to loci with hexa-, tetra-, and dinucleotide motif types. Dinucleotide motif was limited to AC, CA, TG, GT, AG, GA, CT, and TC types, because AT and TA types are notoriously hard to amplify (Temnykh et al., 2001). Each of the selected 48 loci was initially tested for amplification with unlabeled primers (Invitrogen) on a screening panel that included seven EWC trees collected across northern Quebec (one tree per site) (Appendix 1) and a negative control. Amplifications were carried out in a total volume of 10 μL using four 96-well Mastercycler pro S PCR systems (Eppendorf Gmbh, Wesselling-Berzdorf, Germany). Each reaction mixture contained 1 μL of DNA extract, 5 μL of 2× QIAGEN Multiplex PCR Master Mix (QIAGEN), and a final concentration of 0.2 μM for each forward and reverse primer. The PCR program consisted of an initial heat-activation step at 95°C for 15 min, 36 cycles of three-step cycling (denaturation at 94°C for 30 s, annealing at 54°C for 90 s, extension at 72°C for 60 s), and a final extension at 60°C for 30 min. A total of 2.5 μL of PCR products were visualized on 3% agarose gel (Promega Corporation, Madison, Wisconsin, USA), with electrophoretic migration performed at 100 V for 20 min on the Bio-Rad Imaging System (Bio-Rad, Montreal, Canada).
The initial test on 48 loci using agarose gel showed that 38 had amplified products, and four of 38 had three or more products in one PCR reaction (nonspecific). Among the remaining 34 loci, 16 had one or two amplification products, variable in size. Thus, we used all of them to verify polymorphisms and further design multiplex PCR. Each was tested with fluorescent dye–labeled primers (Applied Biosystems, Carlsbad, California, USA) on a panel that included 24 EWC individuals collected from 24 sites across northern Quebec (one individual per site) (Appendix 1) plus one negative control. PCR cycles were the same as those mentioned previously, except for increased annealing temperatures to achieve specific amplifications (Table 1). A total of 2 μL of 1:100 diluted PCR products labeled with four different dyes (6-FAM, VIC, NED, and PET; Applied Biosystems) were mixed with 8.35 μL of Hi-Di Formamide (Applied Biosystems) and 0.15 μL of GeneScan 500 LIZ Size Standard (Applied Biosystems), and sent to GenoQuebec (Montreal, Canada) for genotype reading on an ABI 3730 genetic analyzer. Results were analyzed with GeneMapper 3.7 software (Applied Biosystems).
Table 1.
Characteristics of 16 microsatellites validated for Thuja occidentalis.
| Observed | ||||||||||
| Locus | Primer sequences (5′–3′) | GenBank accession no. | Dye | Repeat motif | Size (bp)a | Ta (°C) | MG | A | Min | Max |
| TO791 | F: AAGAGATTTATTTGCCCTCCG | JX475983 | VIC | (CA)12 | 141 | 57 | 1 | 16 | 133 | 167 |
| R: ATGGTTGATGGACTCCTTGG | ||||||||||
| TO605 | F: GAATAACTTCTTCTGGGAAAGATACA | JX475984 | PET | (AC)8 | 190 | 59 | 1 | 10 | 174 | 196 |
| R: GAGGTGGAAAGAAGTGGATAAAA | ||||||||||
| TO328 | F: CCCGCAACACCTACTTGTCT | JX475985 | FAM | (TACA)7 | 215 | 57 | 1 | 4 | 203 | 215 |
| R: TGCTCCATGTTTGAAGTTGC | ||||||||||
| TO53 | F: AAATGGCCCATAAGCACAAA | JX475986 | NED | (CA)5 | 184 | 58 | 1 | 6 | 174 | 184 |
| R: GGATGTTTCCAGTTGACGGT | ||||||||||
| TO925 | F: TGTGTTTGTGGTGGCTGACT | JX475987 | FAM | (TG)20 | 151 | 58 | 2 | 22 | 129 | 217 |
| R: CATTCATACATTTCCCATCCA | ||||||||||
| TO727 | F: GAGATTCCTTTAAAATATTGGCAT | JX475988 | VIC | (GA)11 | 241 | 57 | 2 | 14 | 233 | 325 |
| R: CCCTCCCATTCCTCTTAATG | ||||||||||
| TO659 | F: TGATGCACCAATTTTCTTTGG | JX475989 | PET | (CT)9 | 191 | 56 | 2 | 7 | 181 | 195 |
| R: TGATGCACTTTAAGGTGTAGGG | ||||||||||
| TO29 | F: TGCAGTGTTAGTGGAGCAACTT | JX475990 | NED | (CA)5 | 162 | 57 | 2 | 14 | 148 | 186 |
| R: TCATTGTTTATTCCCTAAGATGGA | ||||||||||
| TO737 | F: GAGCAAGAAGGAGAGTGGGA | JX475991 | PET | (AGAT)11 | 124 | 63 | 3 | 6 | 102 | 130 |
| R: CCTAGGTTGCCTTGTTGTCC | ||||||||||
| TO587 | F: GTGCCAAACTTTTCAAGGTAAGA | JX475992 | NED | (CT)8 | 167 | 62 | 3 | 13 | 139 | 211 |
| R: GCAAGAGCACAAATGATCACA | ||||||||||
| TO512 | F: TGCATAACAACTCTTCTTAAATCAGC | JX475993 | FAM | (CT)8 | 194 | 63 | 3 | 11 | 146 | 212 |
| R: AGGTCCTATCTAGGTCTTAGACAACTT | ||||||||||
| TO503 | F: CTTGTCCGTCTGACATGTGTTT | JX475994 | VIC | (GA)8 | 190 | 55 | 3 | 12 | 138 | 202 |
| R: CACATAGGTTAAGGGTAGTTTCCT | ||||||||||
| TO715 | F: CATCTACATGGTCGATGATTTAAC | JX475995 | VIC | (AG)10 | 106 | 60 | 4 | 6 | 100 | 110 |
| R: TATCCCAAACCAGCAAAACC | ||||||||||
| TO521 | F: CAAATATGGCACCAATGCCT | JX475996 | PET | (CT)8 | 121 | 54 | 4 | 17 | 113 | 239 |
| R: CAATTTCCTCAGGTTTGGGA | ||||||||||
| TO418 | F: ATGCTTTTCTAACCCTTTTGGA | JX475997 | NED | (AC)7 | 253 | 61 | 4 | 8 | 163 | 255 |
| R: TGATCAGTTGGATTTCTAGATTGC | ||||||||||
| TO20 | F: TTTGGCTTGTAGGTGGTTTT | JX475998 | FAM | (TG)5 | 192 | 57 | 4 | 15 | 168 | 204 |
| R: CTCCATTTTGGAGTGTTGGT | ||||||||||
Note: A = number of alleles observed; Max = maximum allele size observed during screening; MG = multiplex group; Min = minimum allele size observed during screening; Ta = annealing temperature.
Product size from shotgun pyrosequencing.
All 16 loci showed interpretable, repeatable, and polymorphic patterns (Table 1). We used Multiplex Manager (Holleley and Geerts, 2009) to design and optimize multiplex PCRs to find annealing temperatures for each multiplex group to ensure specific amplifications and avoid complementary sequences among primers. Primer pairs were multiplexed to reduce amplification costs (Table 1). Coamplifications of all multiplexed primers were tested on two populations (30 trees per population) sampled from islands in Lake Duparquet, northwestern Quebec (Table 2). PCR cycles were the same as those mentioned previously, except for multiplexed annealing temperatures (M1 at 57°C, M2 at 56°C, M3 at 55°C, M4 at 54°C). PCR products were genotyped as previously detailed.
Table 2.
Results of initial primer screening in Thuja occidentalis samples from Lake Duparquet, Lake Duparquet Research & Teaching Forest, Quebec, Canada.
| Island 58 (N = 30)a | Island 134 (N = 30)a | |||||||||
| Locus | A | Ho | He | FIS | Null alleles present (frequency) | A | Ho | He | FIS | Null alleles present (frequency) |
| TO53 | 5.00 | 0.567 | 0.705 | 0.212 | no | 4.00 | 0.900 | 0.652 | −0.366 | no |
| TO328 | 4.00 | 0.567 | 0.585 | 0.048 | no | 3.00 | 0.667 | 0.491 | −0.343 | no |
| TO605 | 3.00 | 0.200 | 0.580 | 0.665* | yes (0.24) | 2.00 | 0.367 | 0.433 | 0.169 | no |
| TO791 | 12.00 | 0.667 | 0.794 | 0.177 | no | 11.00 | 0.800 | 0.839 | 0.063 | no |
| TO29 | 7.00 | 0.500 | 0.543 | 0.096 | no | 7.00 | 0.700 | 0.712 | 0.034 | no |
| TO659 | 4.00 | 0.400 | 0.581 | 0.326 | yes (0.11) | 6.00 | 0.500 | 0.608 | 0.194 | no |
| TO727 | 2.00 | 0.833 | 0.486 | −0.706* | no | 5.00 | 0.900 | 0.686 | −0.296 | no |
| TO925 | 18.00 | 0.800 | 0.847 | 0.072 | no | 10.00 | 0.667 | 0.770 | 0.151 | no |
| TO503 | 6.00 | 0.967 | 0.644 | −0.487* | no | 4.00 | 0.633 | 0.521 | −0.199 | no |
| TO512 | 5.00 | 0.367 | 0.322 | −0.121 | no | 7.00 | 0.733 | 0.556 | −0.305 | no |
| TO587 | 5.00 | 1.000 | 0.712 | −0.391* | no | 7.00 | 0.867 | 0.710 | −0.204 | no |
| TO737 | 5.00 | 0.733 | 0.634 | −0.139 | no | 4.00 | 0.867 | 0.624 | −0.375 | no |
| TO20 | 2.00 | 0.400 | 0.320 | −0.234 | no | 4.00 | 0.933 | 0.676 | −0.366 | no |
| TO418 | 3.00 | 0.067 | 0.065 | −0.009 | no | 3.00 | 0.433 | 0.443 | 0.038 | no |
| TO521 | 8.00 | 0.933 | 0.777 | −0.185 | no | 8.00 | 0.800 | 0.738 | −0.067 | no |
| TO715 | 3.00 | 0.500 | 0.583 | 0.159 | no | 3.00 | 0.500 | 0.529 | 0.072 | no |
| Mean | 5.75 | 0.594 | 0.574 | — | — | 5.50 | 0.704 | 0.624 | — | — |
| SE | 1.031 | 0.068 | 0.050 | — | — | 0.658 | 0.045 | 0.030 | — | — |
Note: A = number of alleles; FIS = inbreeding coefficient; He = expected heterozygosity; Ho = observed heterozygosity.
*P ≤ 5%; Bonferroni correction was applied, and indicative adjusted P value for 5% nominal level was 0.0031.
Geographical coordinates: Island 58 (48°26′41.4″N, 79°15′51.9″W), Island 134 (48°27′52.5″N, 79°16′19.6″W).
The number of different alleles per locus (A), observed heterozygosity (Ho), and expected heterozygosity (He) were calculated in GenAlEx version 6.2 (Peakall and Smouse, 2006). Inbreeding coefficient (FIS) and Hardy–Weinberg equilibrium (HWE) tests were done in FSTAT version 2.9.3 (Goudet, 2001). Null allele presence was checked in MICRO-CHECKER (Van Oosterhout et al., 2004). Mean values for A, Ho, and He were, respectively, 5.75, 0.594, and 0.574 on Island 58, and 5.50, 0.704, and 0.624 on Island 134 (Table 2). FIS ranged from −0.706 to 0.665 on Island 58, and from −0.357 to 0.194 on Island 134 (Table 2).
CONCLUSIONS
Shotgun pyrosequencing has proved to be effective for isolating microsatellite markers in EWC. The four sets of multiplex microsatellite loci that were developed here for the first time will facilitate future studies of population genetics in EWC, including investigating phylogeographic patterns of postglacial expansion in North America, and studying the impacts of habitat fragmentation on population genetic structure and gene flow. They will also help resolve questions regarding regeneration patterns in this species along postfire successions (Bergeron, 2000).
Appendix 1.
Voucher information for Thuja occidentalis samples. All samples were preserved at the Institut de recherche sur les forêts, Université du Québec en Abitibi-Témiscamingue, Canada.
| No. | Site | Latitude | Longitude | Location | Country | Year of collection |
| 1 | MZ1 | 49°52′31.44″N | 74°23′34.224″W | Chibougamau | Canada | 2007 |
| 2 | MZ2 | 49°54′32.976″N | 74°19′21.396″W | Chibougamau | Canada | 2007 |
| 3 | MZ3 | 49°57′12.636″N | 74°13′44.688″W | Chibougamau | Canada | 2007 |
| 4 | MZ4 | 49°38′30.336″N | 74°20′2.58″W | Chibougamau | Canada | 2007 |
| 5 | MZ5 | 48°55′39.792″N | 78°53′8.808″W | James Bay | Canada | 2007 |
| 6 | MZ6 | 49°25′23.412″N | 79°12′39.492″W | James Bay | Canada | 2007 |
| 7 | MZ7 | 49°51′30.708″N | 78°36′25.956″W | James Bay | Canada | 2007 |
| 8 | MZ8 | 49°53′0.564″N | 78°38′45.78″W | James Bay | Canada | 2007 |
| 9 | MZ9 | 49°51′21.924″N | 78°38′41.496″W | James Bay | Canada | 2007 |
| 10 | DZ1 | 48°32′24.72″N | 78°38′30.696″W | Abitibi | Canada | 2007 |
| 11 | DZ2 | 48°28′12.54″N | 79°27′8.46″W | Abitibi | Canada | 2007 |
| 12 | DZ3 | 48°28′47.244″N | 79°26′12.624″W | Abitibi | Canada | 2007 |
| 13 | DZ4 | 48°25′53.796″N | 79°24′6.588″W | Abitibi | Canada | 2007 |
| 14 | DZ5 | 48°15′6.656″N | 78°34′29.208″W | Abitibi | Canada | 2007 |
| 15 | DZ6 | 48°25′51.636″N | 79°23′2.976″W | Abitibi | Canada | 2007 |
| 16 | DZ7 | 48°12′4.752″N | 79°25′8.796″W | Abitibi | Canada | 2007 |
| 17 | CZ1 | 47°25′45.192″N | 78°40′42.528″W | Témiscamingue | Canada | 2007 |
| 18 | CZ2 | 47°25′0.084″N | 78°40′55.704″W | Témiscamingue | Canada | 2007 |
| 19 | CZ3 | 47°23′44.052″N | 78°43′53.904″W | Témiscamingue | Canada | 2007 |
| 20 | CZ4 | 47°20′2.18″N | 79°23′33.396″W | Témiscamingue | Canada | 2007 |
| 21 | CZ5 | 47°18′39.96″N | 78°30′55.8″W | Témiscamingue | Canada | 2007 |
| 22 | CZ6 | 47°27′14.22″N | 78°35′15.54″W | Témiscamingue | Canada | 2007 |
| 23 | CZ7 | 47°25′8.184″N | 78°40′42.384″W | Témiscamingue | Canada | 2007 |
| 24 | CZ8 | 47°24′56.844″N | 78°42′41.94″W | Témiscamingue | Canada | 2007 |
| 25 | IS58 | 48°26′41.4″N | 79°15′51.9″W | Abitibi | Canada | 2008 |
| 26 | IS134 | 48°27′52.5″N | 79°16′19.6″W | Abitibi | Canada | 2008 |
LITERATURE CITED
- Bergeron Y. 2000. Species and stand dynamics in the mixed woods of Quebec’s southern boreal forest. Ecology 81: 1500–1516 [Google Scholar]
- Brouillet L., Coursol F., Meades S. J., Favreau M., Anions M., Bélisle P., Desmet P. 2010. VASCAN, the Database of Vascular Plants of Canada. Website http://data.canadensys.net/vascan/ [accessed 8 February 2012].
- Fowells H. A. 1965. Silvics of forest trees of the United States. USDA Agricultural Handbook 271. U.S. Department of Agriculture, Washington, D.C., USA [Google Scholar]
- Goudet J. 2001. FSTAT, a program to estimate and test gene diversities and fixation indices (version 2.9.3). Website http://www2.unil.ch/popgen/softwares/fstat.htm [accessed 8 February 2012].
- Hofmeyer P. V., Kenefic L. S., Seymour R. S. 2007. Northern white-cedar: An annotated bibliography. Cooperative Forestry Research Unit Research Report 01: 1–30 [Google Scholar]
- Holleley C. E., Geerts P. G. 2009. Multiplex Manager 1.0: A cross-platform computer program that plans and optimizes multiplex PCR. BioTechniques 46: 511–517 [DOI] [PubMed] [Google Scholar]
- Lepais O., Bacles C. F. E. 2011. Comparison of random and SSR-enriched shotgun pyrosequencing for microsatellite discovery and single multiplex PCR optimization in Acacia harpophylla F. Muell. ex Benth. Molecular Ecology Resources 11: 711–724 [DOI] [PubMed] [Google Scholar]
- Malausa T., Gilles A., Meglécz E., Blanquart H., Duthoy S., Costedoat C., Dubut V., et al. 2011. High-throughput microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries. Molecular Ecology Resources 11: 638–644 [DOI] [PubMed] [Google Scholar]
- Meglécz E., Costedoat C., Dubut V., Gilles A., Malausa T., Pech N., Martin J.-F. 2010. QDD: A user-friendly program to select microsatellite markers and design primers from large sequencing projects. Bioinformatics (Oxford, England) 26: 403–404 [DOI] [PubMed] [Google Scholar]
- Peakall R., Smouse P. E. 2006. GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: 288–295 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Temnykh S., DeClerck G., Lukashova A., Lipovich L., Cartinhour S., McCouch S. 2001. Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): Frequency, length variation, transposon associations, and genetic marker potential. Genome Research 11: 1441–1452 [DOI] [PMC free article] [PubMed] [Google Scholar]
- USDA, NRCS. 2013. The PLANTS database. National Plant Data Team, Greensboro, North Carolina, USA. Website http://plants.usda.gov [accessed 27 March 2013]. [Google Scholar]
- Van Oosterhout C., Hutchinson W. F., Wills D. P. M., Shipley P. 2004. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535–538 [Google Scholar]