Development and characterization of nine microsatellites for an endangered tree, Pinus wangii (Pinaceae)

Abstract

• Premise of the study: Pinus wangii is an endemic and endangered species in southwestern China, and microsatellite primers were developed to characterize its genetic diversity and population structure.

• Methods and Results: Using the Fast Isolation by AFLP of Sequences COntaining repeats (FIASCO) protocol, nine sets of microsatellite primers were developed in P. wangii. One population with 26 individuals of P. wangii, as well as 11 individuals each for two congeneric species, P. taiwanensis and P. squamata, were used to test their polymorphism and transferability. The number of alleles per locus ranged from one to seven with an average of 3.7, and the observed heterozygosity and expected heterozygosity ranged from 0 to 0.91 and 0 to 0.75, respectively.

• Conclusions: We developed nine sets of polymorphic microsatellite loci that are suitable for investigating genetic diversity and population structure of P. wangii, and these markers may be useful for other Pinus species.

Pinus wangii Hu & W. C. Cheng is an endemic subtropical tree species in southeastern Yunnan, China. It occurs sparsely in limestone habitats and is narrowly restricted to Xichou and Malipo counties in Yunnan Province (Fu et al.,1999). Due to drastic disturbance of its natural habitat as well as overexploitation for timber, there are only two remaining remnant populations (Fu et al.,1999). Despite the establishment of in situ conservation practices, no studies have measured the genetic diversity and population structure of this critically endangered species, factors which will be useful for assessing its evolutionary potential and establishing concrete conservation strategies. In this study, we developed nine highly variable microsatellite markers for P. wangii and tested the transferability of these loci in two congeneric species—P. taiwanensis Hayata and P. squamata X. W. Li.

METHODS AND RESULTS

One population of P. wangii with 26 individuals was sampled from Xichou County, Yunnan Province (23°10′N, 104°49′E, alt. 1623 m; voucher specimens: DJJ01, deposited at the Herbarium of South China Botanical Garden [IBSC]). In addition, 11 individuals each for two other congeneric species, P. taiwanensis (Songyang County, Zhejiang Province; 28°18′N, 119°16′E, alt. 821 m; voucher specimens: DJJ02, IBSC) and P. squamata (Qiaojia County, Yunnan Province; 27°08′N, 103°2′E, alt. 2014 m; voucher specimens: DJJ03, IBSC), were used to test the transferability of these primers. Genomic DNA was extracted from silica gel–dried needle samples following the cetyltrimethylammonium bromide (CTAB) method (Doyle, 1991). Using the Fast Isolation by AFLP of Sequences COntaining repeats (FIASCO) protocol developed by Zane et al. (2002), we isolated a set of microsatellite loci from an enriched (AC)_n library. First, ∼300 ng of the pooled genomic DNA from three individuals of P. wangii was digested with the MseI restriction enzyme (New England Biolabs, Beverly, Massachusetts, USA) overnight at 16°C, then the digested products were ligated to an MseI adapter pair (5′-TACTCAGGACTCAT-3′/5′-GACGATGAGTCCTGAG-3′) using T4 DNA ligase (Fermentas, Burlington, Ontario, Canada) in a 30 μL reaction mixture for 2 h at 37°C. The 10-fold diluted digestion-ligation mixture was subsequently amplified with the adapter-specific primer MseI-N (5′-GATGAGTCCTGAGTAAN-3′) (25 μM). After being denatured at 95°C for 5 min, the former PCR products were hybridized with a 5′-biotinylated probe ([AC]₁₅) in 250 μL hybridization solution (4× saline sodium citrate [SSC], 0.1% sodium dodecyl sulfate [SDS], 0.5 μmol/L probe) at 48°C for 2 h. Using streptavidin-coated magnetic beads (Promega Corporation, Madison, Wisconsin, USA), the enriched simple sequence repeat (SSR) fragments were separated and captured at room temperature for 30 min, then were subject to an amplification with MseI-N primer, and the amplified PCR products ranging between 300 and 800 bp were gel-sliced by electrophoresis on 1.5% agarose and then purified with the E.Z.N.A. Gel Extraction Kit (Omega Bio-Tek, Winooski, Vermont, USA). Finally, these recovered DNA fragments were transformed and cloned according to a standard clone protocol. A total of 168 positive clones were chosen and sequenced using an ABI 3730 automated DNA Sequencer (Applied Biosystems, Foster City, California, USA). One hundred and two sequences were found to contain microsatellite repeats, of which 50 with sufficient flanking regions were selected to design specific primers using the program Primer Premier version 5.0 (Premier Biosoft International, Palo Alto, California, USA), and candidate primers were subject to the following criteria: GC content varying between 40% and 60%, annealing temperature ranging from 48°C to 60°C, and PCR product size varying between 100 and 400 bp. Nine of the 50 primer pairs were amplified with the appropriate size range and were chosen for polymorphism screening. The forward primers of the nine primer pairs were labeled with fluorescent dye (FAM or TAMRA).

After optimizing the annealing temperature for each pair of primers by gradient PCR (Table 1), PCR amplification was performed in a 20 μL reaction mixture consisting of 20 ng of genomic DNA, 0.2 mM of dNTPs, 0.2 μM of each primer, 1× PCR buffer, and 1 U of Taq DNA polymerase (TaKaRa Biotechnology Co., Dalian, China), with the following thermocycling conditions: denaturation for 4 min at 94°C, 35 cycles denaturation at 94°C for 40 s, annealing temperature between 46°C and 53°C (depending on locus) for 45 s, extension at 72°C for 50 s, and a final extension of 8 min at 72°C. Using Genotyper 4.0 with LIZ 500 (Applied Biosystems) as an internal size standard, the fragment sizes of these PCR products were determined on an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems).

Table 1.

Characteristics of nine microsatellite loci for Pinus wangii.

Locus	Primer sequences (5′–3′)	Repeat motif	Size (bp)	Ta (°C)	GenBank accession no.
PW01	F: CTAATACAACAGCCAATA	(TA)6(AG)5	186	46.0	JQ692298
	R: GACATAATGTCTCAGGAT
PW02	F: GGAGCAAATGTGAAGGAC	(TG)17(TG)16	241	47.0	JQ692299
	R: AAGGGATTATCAGTCTAAAGAA
PW03	F: GATGTTGGAACACCTAAT	(TG)15	284	47.0	JQ692300
	R: GTCAATCACTATCCTTCG
PW04	F: GGTACAGTGGCTAACATT	(TG)17	494	50.0	JQ692301
	R: CCAGAACGACCTACAATC
PW05	F: TCCACTAATAGGCTATCG	(TG)7	341	53.0	JQ692302
	R: ATGCGTATGGAAATTATG
PW06	F: GCGACCTACAGGAACAAC	(TG)9	187	48.0	JQ692303
	R: TGGAATCCCAGATTACAT
PW07	F: TAGTAGGCTATCGGGTTG	(TG)8	345	53.0	JQ692304
	R: ATGCATGTGAATGGAAGT
PW08	F: ATTGGAGACATCGGTCAA	(AC)8	236	48.0	JQ692305
	R: TCAAGTTGCGAGGAGTTT
PW09	F: GCCATTAGGAGGAAGAGG	(TG)7	320	49.0	JQ692306
	R: CATCCATGCAAATGAAAAT

Note: T_a = optimal annealing temperature.

Nine primer pairs were successfully amplified with expected size ranges (Table 1), and all of them showed polymorphism within populations. Genetic diversity was estimated with POPGENE version 1.3.1 (Yeh et al., 1999). For each locus, the number of alleles (A) ranged from one to seven with an average of 3.7; the observed and expected heterozygosities varied from 0 to 0.91 and 0 to 0.75, respectively (Table 2). Except for one locus, PW04, which failed to amplify in P. taiwanensis, all of the loci showed good transferability. For all three species, most of the loci demonstrated significant departure from Hardy–Weinberg equilibrium (Table 2) due to a deficiency of heterozygosity. All of the loci should be considered to be independent loci across the genome, because none of them showed significant linkage disequilibrium in the three populations.

Table 2.

Results of initial primer screening in Pinus wangii and two congeneric species, P. taiwanensis and P. squamata.

	P. wangii (N = 26)				P. taiwanensis (N = 11)				P. squamata (N = 11)
Locus	A	Ho	He	HWEa	A	Ho	He	HWEa	A	Ho	He	HWEa
PW01	2	0.12	0.18	0.05*	3	0.09	0.26	0.00***	3	0.82	0.60	0.00***
PW02	7	0.46	0.58	0.06ns	6	0.27	0.72	0.00***	3	0.09	0.26	0.00***
PW03	5	0.23	0.40	0.00***	2	0	0.17	0.00***	5	0.36	0.70	0.00***
PW04	5	0.08	0.55	0.00***	—	—	—	—	2	0.18	0.31	0.12ns
PW05	6	0.65	0.75	0.00***	5	0.55	0.58	0.01*	3	0.82	0.65	0.10ns
PW06	4	0.35	0.61	0.06ns	3	0.36	0.39	0.20ns	1	0	0	—
PW07	5	0.69	0.61	0.02*	5	0.36	0.66	0.04*	4	0.82	0.64	0.00***
PW08	4	0.58	0.47	0.69ns	4	0.64	0.50	0.92ns	3	0.91	0.56	0.08ns
PW09	4	0.04	0.47	0.00***	3	0.18	0.39	0.02*	3	0.09	0.26	0.00***

Note: A = number of alleles; H_e = expected heterozygosity; H_o = observed heterozygosity; HWE = Hardy–Weinberg equilibrium; N = sample size for each population.

^aSignificant departures from HWE: *P < 0.05, **P < 0.01, ***P < 0.001; ns = not significant.

CONCLUSIONS

In this study, we developed nine pairs of polymorphic microsatellite primers that are suitable for investigating the genetic diversity and population structure of P. wangii. Most of these microsatellite primers can also be applied to two other congeneric species, P. taiwanensis and P. squamata. We expect these markers will be useful in the conservation genetic study of P. wangii as well as other congeneric species.