Table 1.

The table illustrates MVK gene mutations with RefSeq mRNA (NM_000431.2)

Gene	dbSNP	Change	Ref	Obs	P1	P2	P3	P4	P5	P6
MVK NM_000431.2 (Chr 12)	rs104895334	c.16_34del; p.Leu6_Gly12delinsGlyfs	CCTACTGGTGTCTGCTCCGG	C	WT	WT	WT	HET	WT	WT
	rs104895336	c.G394A; p.V132I	G	A	HET	WT	WT	WT	WT	WT
	rs104895297	c.C404T; p.S135L	C	T	WT	WT	HET	WT	WT	WT
	rs104895304	c.T803C; p.I268T	T	C	WT	WT	WT	WT	HET	WT
	rs104895358	c.G1006A; p.G336S	G	A	WT	WT	WT	WT	WT	HOM
	rs28934897	c.G1129A; p.V377I	G	A	HOM	HOM	HET	HET	HET	WT

For each mutation, the following are shown: the respective identifier (dbSNP), the nucleotide substitution and, if present, the amino acid change (Change), the reference sequence (Ref) and the one observed (Obs). For each of the six patients (P1, P2, P3, P3, P4, P5, P6), the mutation is identified as wild-type (WT), heterozygous (HET) or homozygous (HOM).

MVK, mevalonate kinase.