Abstract
Stimulation of the carotid body (CB) chemoreceptors by hypercapnia triggers a reflex ventilatory response via a cascade of cellular events, which includes generation of cAMP. However, it is not known if molecular CO2/HCO3− and/or H+ mediate this effect and how these molecules contribute to cAMP production. We previously reported that the CB highly expresses HCO3−-sensitive soluble adenylyl cyclase (sAC). In the present study we systematically characterize the role of sAC in the CB, comparing the effect of isohydric hypercapnia (IH) in cAMP generation through activation of sAC or transmembrane-adenylyl cyclase (tmAC).
Pharmacological deactivation of sAC and tmAC decreased the CB cAMP content in normocapnia and IH with no differences between these two conditions. Changes from normocapnia to IH did not effect the degree of PKA activation and the carotid sinus nerve discharge frequency.
sAC and tmAC are functional in CB but intracellular elevations in CO2/HCO3− in IH conditions on their own are insufficient to further activate these enzymes, suggesting that the hypercapnic response is dependent on secondary acidosis.
Keywords: Carotid body, cAMP, Adenylyl cyclase, Hypercapnia
1. Introduction
Peripheral arterial chemoreceptors located in the carotid body (CB) and central chemoreceptors located in the brainstem contain specialized cells that either depolarize in response to changes in PaO2 or in response to changes in CO2/H+. Type I (glomus) cells of the CB, the peripheral chemoreceptor units, are innervated by carotid sinus nerve (CSN) afferents, a branch of the glossopharyngeal nerve, which have somas in the petrosal ganglion (PG), and relay on to neurons in the nucleus tractus solitarius in the brainstem (Gonzalez et al., 1994). Although peripheral chemoreceptors were believed to be the major O2 sensors while central chemoreceptors contributed predominantly to the CO2/pH ventilatory response, recent evidence suggest that the central and peripheral chemoreceptors interact with each other, and the latter can modulate the central sensitivity to CO2/pH (for a review see Forster and Smith (2010)). Accordingly, it is now recognized that preservation of functional CB activity is essential for mediating the full ventilatory response to hypercapnia. This emphasizes an important and fundamental homeostatic role for the CB in regulating the PaCO2 throughout the whole organism.
In the CB, transduction of the hypercapnic stimulus into a functional chemoafferent neural signal involves many of the same processes associated with hypoxia sensing. These include type I cell depolarization, Ca2+ influx and neurosecretion (reviewed in Kumar and Prabhakar, 2012). However, identification of the specific CO2 sensing mechanisms in the type I cell required to activate the CB in response to hypercapnia, at present, remains incompletely defined. It is also unknown whether CO2 sensing is mediated by CO2/HCO3−, decreases in pH or both.
A crucial step in the CB hypercapnia transduction process appears to be the intracellular hydration of CO2 to form HCO3− and H+; a reaction catalyzed by carbonic anhydrase (CA) (Iturriaga et al., 1991; Travis, 1971; Zhang and Nurse, 2004). Increasing extracellular PCO2 at constant HCO3− (acidic hypercapnia) is coupled with a reduction in intracellular pH (pHi) in the type I cell (Buckler et al., 1991a). The steady state acidic pHi observed in hypercapnia is reported to be dependent not only on intracellular CA mediated H+ generation, but also on a concurrent extracellular acidosis, most probably by restricting H+ extrusion (Buckler et al., 1991a,b). Initiation of type I cell depolarization in acidic hypercapnia has been suggested as being a consequence of an alteration in the H+ sensitive TASK-like (Buckler et al., 2000; Buckler and Vaughan-Jones, 1994) and acid-sensing (Tan et al., 2007) ion channel currents.
In contrast to this ‘acid’ hypothesis, it has also been observed that in some in vitro CB preparations an increase in extracellular PCO2 and HCO3−, without altering the pHo (isohydric hypercapnia), can stimulate a rise in the type I cell inward Ca2+ current (Summers et al., 2002), augment cellular neurotransmitter release (Rigual et al., 1991) and activate chemoafferent fibers in the CSN (Zhang and Nurse, 2004). These observations are consistent with some of the excitatory mechanisms induced by hypercapnia being independent of concurrent acidosis. Furthermore, augmentation of the inward Ca2+ current in isohydric hypercapnia has been proposed to be dependent on an increase in cAMP leading to the upregulation of protein kinase A (PKA) activity (Summers et al., 2002). Taken together, these observations suggest that the CB senses independently both HCO3− and H+, but the specific target for CO2/HCO3− remains unknown.
Since we had recently identified HCO3−-sensitive soluble adenylyl cyclase (sAC) in the CB, we hypothesized that sAC could be a sensor for rapid changes in [CO2]. Thus, the importance of the present work is to investigate the function of sAC in the CB, through its activation by isohydric hypercapnic conditions, and clarify the mechanism of hypercapnia detection in this organ.
Two types of adenylyl cyclases mediate the production of cAMP in mammalian cells: the family of transmembrane adenylyl cyclase (tmAC) isoforms and sAC. At least nine specific tmAC isoforms have been identified in mammalian genomes, but they have not yet been characterized in the CB. tmAC isoforms are sensitive to G-protein, forskolin (FSK), Ca2+-signaling pathways (Halls and Cooper, 2011) and CO2 (Cook et al., 2012; Townsend et al., 2009). In the CB, it is established that cellular cAMP levels can be modulated by neurotransmitters/neuromodulators that bind to G-protein coupled receptors (GPCR) and alter tmAC activity (Gonzalez et al., 1994; Lahiri et al., 2006). Whether neurotransmitter/neuromodulator or direct CO2 induced activation of tmAC occurs in hypercapnia independent of acidosis is investigated in this study.
sAC is activated by HCO3− (bicarbonate ion) and Ca2+ (reviewed by Kamenetsky et al., 2006). Thus we hypothesized that sAC may be stimulated directly in hypercapnia by a rise in HCO3− subsequent to the CA mediated hydration of CO2. We have previously identified sAC mRNA and protein in the CB and related peripheral non-chemosensitive structures (Nunes et al., 2009). In this article we examine whether sAC is functionally active in the CB and has a role in the chemotransduction process of hypercapnia, independent of concurrent extracellular and therefore intracellular acidosis. Thus, in this work we study tmAC and sAC activity in isohydric hypercapnia to assess whether increases on cAMP levels in the CB in response to hypercapnia are mediated by CO2/HCO3− or decreases in pH.
2. Materials and methods
2.1. Animals and surgical procedures
The Animal Care and Use Committee at the Johns Hopkins University School of Medicine approved all experimental protocols. CSN recording experiments were performed at University of Birmingham and were approved by the Biomedical Services Unit.
All tissues (CB and PG) were isolated from Sprague-Dawley rats (SD, Charles River Laboratories, Wilmington, MA) of both sexes.
In one set of experiments, prior to tissue removal or dissection, the animals at postnatal days (P) 16 and 17 were anesthetized briefly with isoflurane and immediately decapitated. At this age, CB hypoxic chemosensitivity is mature (Kholwadwala and Donnelly, 1992). The carotid bifurcation, including the CB, superior cervical ganglia, and the nodose/petrosal ganglia complex, was removed en bloc. CBs and PGs were subsequently isolated and cleaned of surrounding connective tissue under a dissecting microscope. In another set of experiments, we dissected CB for dissociation of type I cells from SD rats at P5–9. At this age dissociated cells were easier to obtain and no statistical differences (p = 0.1143, Mann–Whitney test) in cAMP accumulation were observed between the whole CB from rats P7 (23.5 ± 3.1 fmol/μg protein, n = 6) and P17 (33.9 ± 4.6 fmol/μg protein, n = 4) in normocapnic conditions.
Lastly, CSN recording experiments were performed with tissues obtained from adult male SD rats (50–100 g, Charles River UK, Ltd., Margate, UK). CBs were harvested as described previously (Pepper et al., 1995). Briefly, anesthesia was induced in an airtight induction chamber using 4% isoflurane in medical O2 administered at a flow rate of 1.5–3 ml/min. Surgical anesthesia was continuously maintained through a nose cone with 1.5–2.0% isoflurane in O2, at a flow rate of 1.5–3 ml/min. The carotid bifurcation along with the superior cervical ganglion, vagus nerve, glossopharyngeal nerve, CSN, and the CB were all excised. The tissue was immediately placed in ice-cold HCO3− buffered extracellular Krebs solution containing (in mM): 125 NaCl, 3 KCl, 1.25 NaH2PO4, 5 Na2SO4, 1.3 MgSO4, 24 NaHCO3, 2.4 CaCl2, 11 D-glucose, equilibrated with 95% O2 and 5% CO2.
2.2. sAC and tmAC mRNA gene expression
The mRNA expression levels for sAC and the nine isoforms of tmAC in the CB and PG were compared. The tissues were isolated as discussed for surgical procedures (4 rats per condition; n = 3 independent experiments), cleaned from surrounded tissue, frozen on dry ice, and stored at −80 °C until further processing for quantitative Real-Time PCR, as outlined below.
2.3. Quantitative Real-Time (qRT) PCR
Tissues used to determine the level of sAC and tmAC mRNA gene expression were processed to obtain total RNA (Micro-to-Midi Total RNA Purification, Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. DNase treatment (PureLink DNase, Invitrogen) was performed to avoid genomic DNA contamination. RNA yield and quality was measured at 260 and 280 nm using a UV spectrophotometer (Beckman Du 530) or NanoDrop spectrophotometer (for RNA from CB samples, Thermo Scientific, Wilmington, DE). Total RNA (about 1 μg) was used for first-strand cDNA synthesis using an iSCRIPt cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA).
The primer sequences for each adenylyl cyclase isoform used are shown in Table 1 (Chang et al., 2003; Pastor-Soler et al., 2003). Relative expression levels for adenylyl cyclase genes between tissues and conditions were standardized using the reference gene glucose-6-phosphate dehydrogenase (G6PDH). Results were further validated using two additional reference genes: glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and beta-actin (β-actin). The primer sequences for the reference genes used are presented in Table 1 (Wang and Xu, 2010). The expression of the three reference genes in all the tissues used and conditions was evaluated by combining four different algorithms used to determine the stability of the reference genes: geNorm, Normfinder, Bestkeeper, and the comparative ΔCT method (http://www.leonxie.com/referencegene.php?type=reference).
Table 1.
Gene name | Direction | Primer sequence (5′–3′) | Product size (bp) |
---|---|---|---|
sACa | Sense Antisense |
CATGAGTAAGGAATGGTGGTACTCA AGGGTTACGTTGCCTGATACAATT |
111 |
AC1b | Sense Antisense |
ACCAGCCAAGAGGATGAAGTT ATACCAGCAGCAGCAGGACAG |
446 |
AC2b | Sense Antisense |
GGGAAGATTAGTACCACGGAT AGGAGAAGCCAAGGATGGACG |
334 |
AC3b | Sense Antisense |
ATGAGCACGAACTGAACCAGCT GTCCCATGTAGTACTGGAGACAGCTC |
456 |
AC4b | Sense Antisense |
AGCCAGCCTACCCAGGTT GCTTGGGTCTGAGGTCA |
283 |
AC5b | Sense Antisense |
CAGAGAACCAACTCCATTGGACACAATCCG CACACAGGCGTAGATCACAGATATTTTCAC |
456 |
AC6b | Sense Antisense |
TGCTGCTGGTCACCGTGCTCAT GGACGCTAAGCAGTAGATCATAGTTGTCAA |
495 |
AC7b | Sense Antisense |
GCTCCTACTGAAGCCCAAGTTC AATCACTCCAGCAATCACAGGC |
256 |
AC8b | Sense Antisense |
CAGTCTGGGCCTGAGGAAATT AAGTCAGGTTCTTCAAGGGTA |
478 |
AC9b | Sense Antisense |
ACCTACCTTTACCCAAAGTGCACGGACAAT CTCGGCGCTGCCTCACACACTCTTTGAGAC |
360 |
G6PDH | Sense Antisense |
GAAGCCTGGCGTATCTTCAC GTGAGGGTTCACCCACTTGT |
162 |
GAPDHc | Sense Antisense |
CACGGCAAGTTCAACGGCACAGTCA GTGAAGACGCCAGTAGACTCCACGAC |
152 |
β-Actin | Sense Antisense |
GGCCAACCGTGAAAAGATGACC GCCACGCTCGGTCAGGATCTTC |
253 |
qRT-PCR was performed using a MyiQ iCycler RT-PCR system (Bio-Rad) with the SYBR Green detection system. Each PCR reaction consisted of 1 μl of cDNA and 3.5 μl of 300 nM primers diluted in DEPC-H2O and 10 μl of SYBR Green Supermix (Bio-Rad) for a final volume of 20 μl. Triplicates were performed for each sample. PCR conditions for adenylyl cyclase (tmAC and sAC) expression were: denaturing 5 min at 95 °C, followed by 40 cycles at 95 °C for 20 s, 62 °C for 20 s, 72 °C for 20 s, and a terminal extension period (72 °C, 10 min). The specificity of the RT-PCR product was analyzed by performing a melting curve with 0.5 °C increments in temperature. Product formation during the exponential phase of the reaction was analyzed for relative quantification to reference gene based on the threshold cycle (CT) for amplification as 2(ΔCT), where ΔCT = CT,reference – CT,target.
2.4. Intracellular pH measurement in carotid body
Intracellular pH (pHi) was measured using the pH-sensitive fluorescence dye, BCECF-AM (Molecular Probes, Eugene, OR) using a protocol previously described by Iturriaga et al. (1992). The isolated CB was incubated with trypsin (0.02%, Sigma) and collagenase (0.01%, Sigma) for 30 min, and rinsed in phosphate buffered saline (PBS). The CB was incubated with BCECF-AM (5 μM) at 37 °C for 1 h and washed to remove excess dye. Since type I cells, the sensors of the CB, appear usually in clusters, these regions were selected as the regions of interest (ROI) and were analyzed for changes in BCECF-AM fluorescence intensity while the whole organ was superfused with oxygenated solutions containing increasing concentrations of HCO3−/CO2. All solutions were titrated to pH 7.4 as described above. Fluorescent images were examined with a fluorescent microscope (Nikon Eclipse E-400, Nikon Instruments, Melville, NY) and captured at 400× with an attached charge-coupled device (CCD) camera (Hamamatsu, Photonic ItSystems, Bridgewater, NJ). The BCECF dye was excited at 495 nm and emission was recorded at 519 nm. The images were captured over a period of 200 frames corresponding to 2.38 min and analyzed using Ivison (BioVision Technologies, PA). To avoid photobleaching, the intensity of light was controlled by Exfo X-cite 1200PC (0.12 intensity, Exfo Photonic Solutions, Ontario, Canada). A calibration curve for each CB was performed at the end of each experiment using the nigericin (10 μM)/high K+ method (Thomas et al., 1976) to determine changes in fluorescence intensity versus pH (6.5–8.0). Exposure to ammonium chloride (NH4Cl, 50 mM) was used to ensure that dye intensity corresponded to changes in intracellular pH (Buckler et al., 1991b).
2.5. Contribution of sAC and tmAC on cAMP levels in response to different concentrations of HCO3−/CO2 (normocapnic and isohydric hypercapnic conditions)
In one set of experiments, we pre-incubated CB in Krebs modified solution containing (in mM): NaCl 135, KCl 5, CaCl2 2, MgCl2 1.1, Hepes 10, glucose 5.5, pH 7.40 (Peréz-García et al., 1990) without HCO3−/CO2 in the absence and presence of the tmAC inhibitor, 2′5′-ddADO (100 μM) or sAC inhibitor, KH7 (50 μM) or both for 30 min. The CBs were subsequently transferred to a fresh incubation buffer for 30 min, in normocapnic and isohydric hypercapnic conditions, in the absence and presence of the tmAC inhibitor, 2′5′-ddADO (100 μM) or sAC inhibitor, KH7 (50 μM) or both.
In another set of experiments, we tested the effect of the tmAC selective inhibitor, 2′5′-ddADO (100 μM, Sigma), or sAC inhibitor, KH7 (10 μM, Sigma), separately or together on the cAMP accumulation in the CB over time (0, 5, 15 and 30 min of incubation) under normocapnic and isohydric hypercapnic conditions. We pre-incubated the CBs in Krebs modified solution without HCO3−/CO2 or containing either 24 mM HCO3−/5%CO2 or 44 mM HCO3−/10%CO2 in the absence or presence of the adenylyl cyclase inhibitors for 30 min. Then, the CBs were placed in fresh incubation buffer without HCO3−/CO2 or containing either 24 mM HCO3−/5%CO2 or 44 mM HCO3−/10%CO2, in the presence of a non-specific inhibitor for phosphodiesterase (PDE), IBMX (500 μM, Sigma) and in the absence or presence of adenylyl cyclase inhibitors, for 0, 5, 15 and 30 min. The incubation buffer was modified by changing CO2 and HCO3− concentrations and adjusting the osmolarity with NaCl. This approach allowed the assessment of any HCO3−/CO2 effect while keeping extracellular pH constant. All the experiments were done in the presence of 60%O2 since hypoxia has been known to increase the chemosensitivity response to CO2 (Fitzgerald and Parks, 1971).
2.6. Cyclic nucleotide extraction and quantification
cAMP was measured as previously reported (Batuca et al., 2003). Briefly, tissues were immersed in cold 6% (w/v) trichloroacetic acid (600 μl) for 10 min, and then the tissues were homogenized at 2–8 °C and centrifuged at 12,000 × g for 10 min at 4 °C. The pellet was washed four times in 3 ml of water saturated with diethyl ether solution (50:50) and then lyophilized. The sample was stored at −20 °C until cAMP quantification by enzyme immunoassay (EIA, RPN 2255, GE Healthcare Bio-Sciences AB, Piscataway, NJ). Protein pellets were stored at −20 °C until measured with a fluorescence detection kit, NanoOrange Protein (Invitrogen, Eugene, OR). cAMP levels were expressed in femtomoles per microgram of protein (fmol/μg protein), which is more accurate than normalizing to grams of tissue, especially for small tissue samples, such as the CB.
2.7. Changes in protein kinase A (PKA) activity in dissociated type I cells of the CB using FRET-based sensors
CBs isolated from SD rats P5–9 were mechanically and enzymatically dissociated with an enzyme mixture consisting of trypsin and collagenase (~0.5 mg/ml) according to the protocol described by Carroll et al. (2005). CB cells were plated on poly-D-lysine coated imaging dishes and cultured for 3 h. A 3rd generation genetically encoded A-Kinase activity reporter dependent on FRET (AKAR3) was used to monitor PKA activity. AKAR3 consists of a fusion of CFP, a phosphothreonine-binding domain, a PKA substrate, and the YFP variant venus (Allen and Zhang, 2006). When PKA is activated, the catalytic subunit of PKA phosphorylates the target in AKAR3, causing a conformational reorganization that increases FRET between CFP and YFP (Allen and Zhang, 2006). Adenoviruses expressing the AKAR3 reporter were obtained from Yang K. Xiang’s laboratory and infected into the CB type I cells for 24 h. One hour before FRET imaging, CB type I cells were labeled with rhodamine PNA (Rho-PNA, 30 μg/ml) in complete CB medium at 37 °C as previously described by Kim et al. (2009). After an hour, the imaging dish containing the cells infected with AKAR3 and labeled with Rho-PNA was placed into a chamber (Warner Instruments, Hamden, CT) to allow superfusion of the cells with a constant flow rate of 2 ml/min (Ismatec, Cole Parmer instrument CO, Vernon Hills). The cells were imaged on a Zeiss Axiovert 200 M microscope (Carl Zeiss, Thornwood, NY) with a 40× oil immersion objective and a cooled charge-coupled device camera (Roper Scientific, Trenton, NJ) controlled by Metafluor 6.2 software (Molecular Deices, Downingtown, PA). Dual emission ratio imaging used a 420DF20 excitation filter, a 450DRLP dichroic mirror and two emission filters (475DF40 for CFP and 535DF25 for YFP). Exposure time was 50–500 ms and images were acquired every 20 s. Background correction of the fluorescence images was performed by subtracting intensities from regions of the imaging dish with no cells. To test the contribution of tmAC and sAC to PKA activity, CB cells were incubated in the presence of sAC and tmAC activators, HCO3−/CO2 (0/0–44/10 mM/%) and FSK (50 μM), respectively. PDEs were inhibited by IBMX (10 μM). Graph curves were normalized by setting the emission ratio before drug addition equal to one.
In a subset of experiments we identify type I cells by tyro-sine hydroxylase (anti-TH mouse monoclonal antibody, 1:50, and detected with goat anti-mouse secondary antibody, 1:100) and fluoresceinated peanut agglutin (rho-PNA) staining and confirmed that those cells expressed A-Kinase activity reporter (AKAR3).
2.8. Extra-cellular CSN recordings
The carotid bifurcation, along with the superior cervical ganglion, vagus nerve, glossopharyngeal nerve, CSN, and the CB were pinned out in a small volume (ca. 0.2 ml) dissecting chamber with a Sylgard 184 base (Dow Corning). The tissue was continuously superfused with a bicarbonate buffered extracellular Krebs solution containing (in mM): 125 NaCl, 3 KCl, 1.25 NaH2PO4, 5 Na2SO4, 1.3 MgSO4, 24 NaHCO3, 2.4 CaCl2, 11 D-glucose, equilibrated with 95% O2 and 5% CO2. Connective tissue was removed and the superior cervical ganglion, branches of the vagus nerve and the occipital artery were all individually excised. The CSN was cut away from the glossopharyngeal nerve exposing the nerve endings. The whole tissue was partially digested by incubation in a bicarbonate buffered, equilibrated 95% O2 and 5% CO2 enzyme solution (0.075 mg/ml collagenase type II, 0.0025 mg/ml dispase type I; Sigma) at a temperature of 37 °C, for 20–30 min, in a water bath at 37 °C (Grant W14, Grant Instruments Cambridge, Ltd.).
Extracellular recordings were made from the cut end of the CSN using glass suction electrodes pulled from GC150-10 capillary glass (Harvard Apparatus). Voltage was amplified using an AC pre-amplifier (NeuroLog NL104; Digitimer) then filtered between 50 Hz and 3 kHz (NeuroLog NL125; Digitimer) and amplified further with an AC amplifier (NeuroLog 105; Digitimer). The total amplification was 4000×. Derived voltage was recorded using a CED micro1401 (Cambridge Electronic Design) and visualized on a PC with Spike2 (version 7.1) software (Cambridge Electronic Design). Offline analysis using Spike2 allowed for discrimination of single unit activity.
Flow meters with high precision valves (Cole Palmer Instruments) were used in order to gas the superfusate with a desired gas mixture. The superfusate PO2 was continuously measured using an O2 meter (OXELP, World Precision Instruments) and was maintained throughout at 300 mm Hg. The superfusate PCO2 was increased from 40 mm Hg with 24 mM NaHCO3 to 80 mm Hg with 44 mM NaHCO3 to monitor CB responses to isohydric hypercapnia, or from 40 to 80 mm Hg, both in the presence of 24 mM NaHCO3 to monitor CB responses to acidic hypercapnia. Osmolality was balanced by reducing the NaCl concentration.
2.9. Data analysis and statistical procedures
The data are represented as mean ± SEM and differences between the experimental groups were determined using statistical software from GraphPad Prism (GraphPad Software Inc., version 4, San Diego, CA) or SPSS (SPSS Inc., version 12, Chicago, IL). Statistical significance was set at p < 0.05.
3. Results
3.1. sAC and tmAC (I–IX isoforms) gene expression
mRNA levels for sAC and the 9 tmAC isoforms were quantified in the CB and PG. As previously observed (Nunes et al., 2009), we confirmed that sAC expression was higher in the CB than in the PG (p < 0.05, Fig. 1). In the CB, relative gene expression for the isoforms: tmAC1 (Ca2+ and calmodulin stimulated), tmAC4 (G-protein Gβγ stimulated), tmAC6 (PKA, PKC and Ca2+ inhibited) and tmAC9 (Ca2+ inhibited) were significantly greater than sAC (p < 0.001, Fig. 1). We observed that the CB and PG expression profile for the 9 tmAC isoforms (Fig. 1) differed; tmAC1 (Ca2+ and calmodulin stimulated), tmAC4 (Gβγ stimulated), and tmAC6 (PKA, PKC and Ca2+ inhibited) was higher in the CB than in the PG (p < 0.001, Fig. 1), while the levels of tmAC2 (Gβγ and PKC stimulated) were lower (p < 0.001, Fig. 1). tmAC3 and tmAC8 (calmodulin-Ca2+ stimulated), tmAC5 and tmAC7 (PKC-stimulated), and tmAC9 (Ca2+-inhibited) gene expression did not differ between tissues. These results demonstrated that even though sAC mRNA is highly expressed in the CB, it is much lower than of the level of expression for tmAC.
3.2. sAC and tmAC inhibition in isohydric hypercapnia
We previously reported that, when tmAC was inhibited by MDL-12,330 A (500 μM, IC50 = 250 μM (Guellaen et al., 1977)), increasing HCO3−/CO2 from 0/0 to 24/5 (mM/%) HEPES based Krebs solution in the presence of IBMX (500 μM) augmented cAMP levels in the CB from 15.3 ± 3.2 (n = 16) to 35.3 ± 6.0 (n = 14) fmol/μg protein (p < 0.01) but not in peripheral non-chemosensitive tissues (Nunes et al., 2009). Higher concentrations of HCO3−/% CO2 (44 mM/10%) did not produce additional increase in cAMP levels in this tissue (Nunes et al., 2009). In the present work, additional experiments including 12 mM HCO3−/2.5% CO2 confirmed an increase in cAMP levels from 0/0 to 12/2.5 and to 24/5 (mM/%), with no changes of cAMP levels in the presence of isohydric hypercapnia (Supplemental Fig. 1).
Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.resp.2013.05.013.
To determine whether the changes in cAMP levels in response to different concentrations of HCO3−/CO2 were mediated by a direct effect of bicarbonate or due to changes in intracellular pH (pHi) in the CB, we measured pHi using the pH-sensitive fluorescence dye BCECF-AM. A control experiment with NH4Cl showed that there was a distinct change in fluorescent intensity in the cells of the CB (Fig. 2A and B). Furthermore, incremental changes in fluorescent intensity associated with changes in extracellular pH (6.5–8.0) were observed using the nigericin (10 μM)/high K+ method to construct calibration curves. No variation in pHi associated with changes from 0 mM HCO3−/0% CO2 to 44 mM HCO3−/10% CO2 within each selected region of the whole CB was observed (Fig. 2C and D). These results suggested that increases in HCO3−/CO2 with constant extracellular pH did not change pHi in our experimental preparations.
Although we had observed that MDL-12,330 A was effective blocking tmAC in our preparations suggesting little contribution of sAC when tmAC is activated by forskolin (Supplemental Fig. 2) (Delpiano and Acker, 1991), we did not find evidence in literature about its selectivity for tmAC relative to sAC. To study the selectivity of this inhibitor, we compared its effect with other tmAC inhibitors: 2′5′-ddADO (30–300 μM, IC50 = 3–16 μM (Ramos et al., 2008) and SQ 22536 (200 μM, IC50 = 20 μM (Rocher et al., 2009), and sAC inhibitor KH7 (10–100 μM, IC50 = 2–5 μM (Ramos et al., 2008)) on cAMP production during isohydric hypercapnia. MDL-12,330 A (500 μM) blocked cAMP production by 96.1 ± 0.4% (n = 22, Supplemental Fig. 3). Other tmAC specific inhibitors, 2′5′-ddADO (100 μM, 60.0 ± 10.5% of inhibition, n = 6, Supplemental Fig. 3) and SQ 22536 (200 μM, 63.0 ± 3.5% of inhibition, n = 3, Supplemental Fig. 3) had less of an impact on blocking cAMP production compared with MDL-12,330 A, suggesting either that the latter may not be a specific tmAC inhibitor at this high concentration or that cAMP production could be mainly due to tmAC activation. KH7 blocked cAMP production in a concentration-dependent manner (10 μM of KH7 blocked cAMP levels by 6.9 ± 13.0%, n = 9; 50 μM by 60.7 ± 13.0%, n = 9; 100 μM by 69.4 ± 6.7%, n = 8, Supplemental Fig. 3).
Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.resp.2013.05.013.
3.3. From normocapnia to isohydric hypercapnia: relative contribution of sAC and tmAC to cAMP accumulation
To investigate if these enzymes have a role in HCO3−/CO2 sensing in the CB, we compared the effect of an equipotent concentration of tmAC and sAC inhibitors (100 μM of 2′5′-ddADO and 50 μM of KH7). We pre-incubated CB tissue in the absence and presence of the tmAC inhibitor, 2′5′-ddADO (100 μM) or sAC inhibitor, KH7 (50 μM) or both, during 30 min, in normocapnic and isohydric hypercapnic conditions.
2′5′-ddADO (100 μM) reduced whole CB cAMP content by 55.1 ± 5.5% (n = 8) under normocapnia and by 55.3 ± 6.7% (n = 10) under isohydric hypercapnic conditions. KH7 (50 μM) decreased cAMP by 30.81 ± 8.5% (n = 4) and by 43.1 ± 9.2% (n = 4) under normocapnia and isohydric hypercapnia conditions, respectively. No differences were observed in the presence of both KH7 (50 μM) and 2′5′-ddADO (100 μM) between these two conditions (33.4 ± 10.8 (n = 4) and 25.4 ± 11.7 (n = 4) under normocapnia and isohydric hypercapnia conditions, respectively). These results suggested that the level of depression in cAMP accumulation induced by sAC or tmAC inhibition does not change significantly between normocapnia and isohydric hypercapnia, and thus, sAC or tmAC activity is not up regulated in response to isohydric hypercapnia.
Since sAC is directly activated by HCO3−/CO2 while tmAC can be activated by neurotransmitters released by the cells that bind to G-protein coupled receptors, we postulated that sAC could be activated earlier than tmAC. We explored this hypothesis by determining the time course (0, 5, 15, 30 min) of cAMP production. cAMP levels were assessed after a 30 min pre-incubation without HCO3−/CO2 or containing either 24 mM HCO3−/5% CO2 or 44 mM HCO3−/10% CO2, taken as the 0 min time point, with subsequent measurements after 5, 15 or 30 min, in an incubation media without HCO3−/CO2 or during normocapnic and isohydric hypercapnic conditions, in the presence of IBMX and in the presence or absence of adenylyl cyclase inhibitors. After a pre-incubation of 30 min, no changes in cAMP levels were found over time up to 30 min in an incubation media containing 24 mM HCO3−/5% CO2 or 44 mM HCO3−/10% CO2, in the absence and presence of AC inhibitors and IBMX (Fig. 3A and B). These findings suggest to us that changes in HCO3−/CO2 in the presence of a phosphodiesterase inhibitor did not increase cAMP levels after pre-incubation and sAC is not contributing to an increase in cAMP in response to changes in HCO3−/CO2, even in more acute conditions.
3.4. Changes in protein kinase A (PKA) activity in dissociated type I cells of the CB
As the CB O2/CO2 sensors are located in type I cells, we explored whether the lack of effect of isohydric hypercapnia on cAMP accumulation observed in the whole CB was consistent with modulation of downstream targets of cAMP in isolated type I cells. Thus, we determined the effect of different concentrations of HCO3−/CO2 on PKA activity in type I cells of the CB using a genetically encoded AKAR3 reporter dependent on FRET. We confirmed the co-localization of Rho-PNA with tyrosine hydroxylase (Fig. 4.1), and co-localization of Rho-PNA with AKAR3 virus expression in type I cells of the CB (Fig. 4.2). Cells were perfused with medium containing 0 mM HCO3−/0% CO2, followed by application of a sub-maximal concentration of IBMX (10 μM) to avoid saturation of the reporter, which increased FRET emission ratio by 6.0 ± 4.8% (n = 21 cells). IBMX (10 μM) was maintained through the experiment and the perfusate was changed from 0 mM HCO3−/0% CO2 to 24 mM HCO3−/5% CO2 or to 44 mM HCO3−/10% CO2 with no observed change in FRET emission ratio (Fig. 5). Addition of FSK (50 μM) markedly increased the emission ratio to 7.4 ± 1.1%. H89 (10 μM, IC50 = 50 nM (Rocher et al., 2009)), a PKA inhibitor, decreased the emission ratio by 14.6 ± 1.4% (n = 21, Fig. 5A–C). These results demonstrate that PKA activity is independent of HCO3− concentration. These results are consistent with the measurements of cAMP in the whole CB and suggest that isohydric hypercapnia does not increase PKA activity in type I cells.
3.5. The impact of isohydric hypercapnia on chemoafferent carotid sinus nerve activity
Since isohydric hypercapnia did not induce a change on cAMP-PKA levels, we examined if there was any functional impact of isohydric hypercapnia on the CSN chemoafferent discharge frequency. A characteristic raw trace example is demonstrated in Fig. 6A. Analysis of grouped data showed that the single fiber frequency measured in normocapnia (PCO2 ~ 40 mm Hg, HCO3− ~ 24 mM) was significantly augmented by acidic hypercapnia (PCO2 ~ 80 mm Hg, HCO3− ~ 24 mM) but not by isohydric hypercapnia (PCO2 ~ 80 mm Hg, HCO3− ~ 44 mM) (n = 6, Fig. 6B). These findings are consistent with the notion that activation of the CSN chemoafferents in response to a rise in PCO2 is critically dependent on a decrease in extracellular pH (that acts to maintain the hypercapnia induced steady state intracellular acidosis), as previously suggested by others (Buckler et al., 1991a; Gray, 1968; Lahiri et al., 1996).
4. Discussion
The present results show that sAC does not have any physiologically significant role in cAMP production in response to isohydric hypercapnia in the carotid body since: (1) sAC relative mRNA expression is lower than tmACs (Fig. 1), (2) no time-dependent changes in cAMP, in the presence or absence of KH7 (sAC blocker), from 0 mM HCO3−/0%CO2 to 44 mM HCO3−/10%CO2 were observed (Fig. 3) and (3) no effect on PKA activity in the presence of different concentrations of HCO3−/CO2 was observed (Fig. 5). These results suggest that the enhanced cAMP generation and CB chemoafferent discharge frequency associated with an increase in CO2 is not mediated directly by CO2 or HCO3− but is probably a consequence of a concurrent elevation in intracellular and extracellular H+ generation.
The CO2-sensing mechanism in the CB is not fully understood. CO2, H+ and HCO3− are intimately connected yet the nature of the primary stimuli remains uncertain. Some studies in the CB have demonstrated that this mechanism is mediated via decreasing extracellular or intracellular pH (pHi), leading to a membrane depolarization, which can be mediated by TASK channels (Buckler et al., 2000) or acid channels (Tan et al., 2007). Membrane depolarization leads to an activation of calcium channels with concomitant increase in intracellular calcium levels and neurotransmitter release (Buckler and Vaughan-Jones, 1994). Acidosis can also activate Na+/H+ exchange promoting the reversal of Na2+/Ca2+ exchange, which results in elevated intracellular calcium concentrations (Rocher et al., 1991). CO2/HCO3− (isohydric hypercapnia) has been reported to be directly involved in the activation of Ca2+ currents leading to an increase of intracellular Ca2+ (Summers et al., 2002). Once in the cell, CO2 is in dynamic equilibrium with HCO3− and pH, through the reaction catalyzed by carbonic anhydrases (Ridderstråle and Hanson, 1984). It has been proposed that carbonic anhydrase function influences the CB sensitivity to CO2/pH (Iturriaga et al., 1993; Lahiri and Forster, 2003). Thus increases in CO2 could lead to increases in HCO3− that could activate sAC (Chen et al., 2000) and consequently increase cAMP levels. Our group had previously identified the expression of sAC gene in the CB and suggested a functional role for sAC in this organ since: (1) sAC gene expression levels in the CB were at least 10 times higher than in non-chemoreceptors, except testis, a tissue where high levels of sAC have been observed; (2) sAC mRNA levels in the CB were up-regulated by HCO3−/CO2, (3) sAC protein was present in the CB and (4) cAMP levels increased with augments in HCO3−/CO2 from 0/0 to 24/5 (Nunes et al., 2009). Other than the CB, the role for sAC has been described in tissues where changes in HCO3−/CO2 are essential to their function. For instance, in the testis, where sAC is highly expressed, sAC mediates sperm maturation and acquisition of motility, in kidneys it regulates recycling of V-ATPse, in airway epithelial cells sAC regulates the ciliary beat frequency, and in corneal endothelium it plays a role in the activation of the cystic fibrosis transmembrane conductance regulator, among others (Buck et al., 1999; Chen et al., 2000; Hess et al., 2005; Pastor-Soler et al., 2003; Schmid et al., 2007; Sun et al., 2004). The role of sAC in CO2/HCO3− sensing has never been studied in the CB chemoreceptors.
cAMP levels can also be synthesized by tmAC. Recently, it was demonstrated that tmAC activity is modulated by CO2 (Townsend et al., 2009). Since it has been suggested that, in the CB, cAMP levels increase in response to acidic and possibly isohydric hypercapnia (Peréz-García et al., 1990; Summers et al., 2002), it was of interest to understand the role of tmAC and sAC in the CO2/HCO3− sensing mechanism of the CB.
We characterized for the first time the nine tmAC isoforms (tmAC1–9) in the CB and PG. Differences in the tissue distribution of the different isoforms were observed with a predominance of the expression of tmAC versus sAC in both tissues. The information available in the literature is not sufficient to allow a correlation between AC mRNA profiles and specific G-protein and consequently specific GPCR. D2-dopamine and M2-muscarinic receptors, which inhibit tmAC, have been identified in both PG and CB (Alcayaga et al., 1999; Bairam et al., 2006; Gonzalez et al., 1994). A2 adenosine receptors and adrenergic β-receptors, which are positively coupled to tmAC, are present in the CB (Gauda, 2002; Gonzalez et al., 1994). While β-adrenergic and D2 dopamine receptors in heart and striatum are coupled to tmAC5 (Chern, 2000; Sadana and Dessauer, 2009) in the CB and PG these receptors would have to be coupled to a different tmAC isoform because we here demonstrate that tmAC5 is not expressed in the PG and CB.
In order to isolate the stimulus to better understand the CO2/HCO3− chemosensitivity with pH controlled in the CB, and although it is far from being physiological, we study the effect of isohydric hypercapnia in tmAC and sAC activities. Although tmAC and sAC were expressed and functional in the CB, the results presented here suggested that the increases in cAMP levels in response to isohydric hypercapnia suggested by others (Summers et al., 2002) could not be directly attributed to increases in sAC and tmAC activity mediated by CO2/HCO3−. sAC and tmAC inhibitors did not alter cAMP levels between normocapnia and isohydric hypercapnia. Also, in the absence of adenylyl cyclase inhibitors, cAMP levels did not increase in response to HCO3−/CO2 concentrations either after 5 or 30 min of incubation. PKA activity did not change with isohydric hypercapnia.
Peréz-García et al. (1990) described that increases in cAMP levels mediated by CO2 were associated with decreases in intracellular pH. However our results were not dependent on decreases in intracellular pH with CO2 since we designed our experiments to maintain the extracellular pH constant at 7.4 in all solutions and confirmed that exposure to different concentrations of HCO3−/CO2 did not modify intracellular pH (Supplemental Fig. 3). It is known that when extracellular pH remains constant minimal changes are observed in pHi of type I cells; when PCO2 increases, pHi transiently decreases and then rapidly equilibrates to the extracellular pH (Buckler et al., 1991a). Hornbein and Roos reported in 1963 that HCO3− and CO2 do not affect pHi in type 1 cells (see in Wilding et al., 1992). Furthermore, pH varying from 7.0 to 8.0 does not alter sAC mRNA expression (Sun et al., 2004). sAC enzyme activity is also independent of pHi (Chen et al., 2000).
In the present work, we also observed that an increase in CO2/HCO3− was not essential to induce an increase in CSN discharge. Biscoe et al. (1970) had demonstrated that isohydric hypercapnia induced an increase in cat CSN discharge; however, for PaCO2 up to 60 mm Hg the discharge in their experiments seemed to plateau. Buckler et al. (1991) had demonstrated that changes in PCO2 at constant extracellular pH caused rapid transient changes in pHi but did not affect steady-state pHi. However, using our preparation we believe that this transient change is not enough to induce neurotransmitter release from type I cells and consequent CSN depolarization.
All together, isohydric hypercapnia causes no change in sAC or tmAC activity, which translates into no change in cAMP, PKA or discharge frequency. Thus, we propose that, for cAMP levels to increase in response to increases in PCO2 as observed by others, intracellular and extracellular acid sensing may be necessary, but not CO2/HCO3−, to lead to calcium dependent neurotransmitter release followed by K+ channel inhibition to cause autocrine activation of GPCR and further activation of tmAC.
We quantified mRNA levels, pHi and cAMP amounts in the whole CB, which preserves cell-cell interactions, but does not enable determination of the specific contribution of chemo and non-chemosensitive units within the CB. However, the results obtained measuring PKA activity using FRET based-reporters in isolated type I cells were consistent with those in the whole CB. Since the absence of response to HCO3−/CO2 in PKA activity in P7 was consistent with the functional studies in P17 rats, we consider that the groups are comparable and the results obtained in the whole CB can be extrapolated to type I cells even though these experiments were done with animals at different postnatal ages. To our best knowledge, the effect of the development of the CB in the activity of the PKA has not been studied, however, in the rat hippocampus, there is evidence that the PKA activity and the subunit regulatory levels do not change between the first and third week of life (Karege et al., 2001).
We used 44 mM HCO3−/10% CO2 as a hypercapnia condition, and since this lies outside the physiological range, we cannot exclude the possibility that the HCO3−/CO2 transport mechanism could be saturated or that the HCO3−/CO2 sensor may no longer be sensitive to such supra-physiological conditions. While these are limitations to our study design, we believe that our thorough approach of examining the contribution of sAC and tmAC on PCO2 transduction at multiple levels (mRNA, PKA regulation, cAMP production and integrated chemodischarge) using robust pharmacological and novel (FRET) approaches has contributed to our understanding of this basic signaling pathway in carotid chemoreceptors.
In conclusion, we have shown that sAC and tmAC are active in the CB and postulate that they co-operate to maintain adequate cAMP levels in physiological conditions. In addition, we support the notion that a functional response to CO2 requires a decrease in intracellular and extracellular pH suggested by others (Buckler et al., 1991a; Lahiri et al., 1996).
Supplementary Material
Acknowledgments
A.R. Nunes was supported by Science and Technology Foundation Fellowship (FCT, SFRH/BD/39473/2007). A.P.S. Holmes was supported by an A.E. Hills Scholarship from the University of Birmingham. This work was also financially supported by R01 HL 072748 (EBG) and R01 DK073368 (JZ). The authors would like to thank Dr. Yang K. Xiang for supplying the adenoviruses expressing the AKAR3 for FRET experiments. We would like to thank Insook Kim for her help and time to discuss protocols about dissociation and identification of type I cells.
Abbreviations
- CB
carotid body
- CA
carbonic anhydrase
- IH
isohydric hypercapnia
- CSN
carotid sinus nerve
- PG
petrosal ganglion
- sAC
soluble adenylyl cyclase
- tmAC
transmembrane adenylyl cyclase
- HCO3−
bicarbonate ion
- PKA
protein kinase A
- SD rats
Sprague-Dawley rats
- P
postnatal days
- FSK
forskolin
- GPCR
G-protein coupled receptors
References
- Alcayaga J, Varas R, Arroyo J, Iturriaga R, Zapata P. Dopamine modulates carotid nerve responses induced by acetylcholine on the cat petrosal ganglion in vitro. Brain Research. 1999;831:97–103. doi: 10.1016/s0006-8993(99)01402-x. [DOI] [PubMed] [Google Scholar]
- Allen MD, Zhang J. Subcellular dynamics of protein kinase A activity visualized by FRET-based reporters. Biochemical and Biophysical Research Communications. 2006;348:716–721. doi: 10.1016/j.bbrc.2006.07.136. [DOI] [PubMed] [Google Scholar]
- Bairam A, Joseph V, Lajeunesse Y, Kinkead R. Developmental pattern of M1 and M2 muscarinic gene expression and receptor levels in cat carotid body, petrosal and superior cervical ganglion. Neuroscience. 2006;139:711–721. doi: 10.1016/j.neuroscience.2005.12.030. [DOI] [PubMed] [Google Scholar]
- Batuca JR, Monteiro TC, Monteiro EC. Contribution of dopamine D2 receptors for the cAMP levels at the carotid body. Advances in Experimental Medicine and Biology. 2003;536:367–373. doi: 10.1007/978-1-4419-9280-2_48. [DOI] [PubMed] [Google Scholar]
- Biscoe TJ, Purves MJ, Sampson SR. The frequency of nerve impulses in single carotid body chemoreceptor afferent fibres recorded in vivo with intact circulation. Journal of Physiology. 1970;208:121–131. doi: 10.1113/jphysiol.1970.sp009109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Buck J, Sinclair ML, Schapal L, Cann MJ, Levin LR. Cytosolic adenylyl cyclase defines a unique signaling molecule in mammals. Proceedings of the National Academy of Sciences of the United States of America. 1999;96:79–84. doi: 10.1073/pnas.96.1.79. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Buckler KJ, Williams BA, Honore E. An oxygen-, acid- and anaesthetic-sensitive TASK-like background potassium channel in rat arterial chemoreceptor cells. Journal of Physiology. 2000;525:135–142. doi: 10.1111/j.1469-7793.2000.00135.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Buckler KJ, Vaughan-Jones RD. Effects of hypercapnia on membrane potential and intracellular calcium in rat carotid body type I cells. Journal of Physiology. 1994;478:157–171. doi: 10.1113/jphysiol.1994.sp020239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Buckler KJ, Vaughan-Jones RD, Peers C, Lagadic-Gossmann D, Nye PC. Effects of extracellular pH PCO2 and HCO3− on intracellular pH in isolated type-I cells of the neonatal rat carotid body. Journal of Physiology. 1991a;444:703–721. doi: 10.1113/jphysiol.1991.sp018902. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Buckler KJ, Vaughan-Jones RD, Peers C, Nye PC. Intracellular pH and its regulation in isolated type I carotid body cells of the neonatal rat. Journal of Physiology. 1991b;436:107–129. doi: 10.1113/jphysiol.1991.sp018542. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Carroll JL, Boyle KM, Wasicko MJ, Sterni LM. Dopamine D2 receptor modulation of carotid body type 1 cell intracellular calcium in developing rats. American Journal of Physiology: Lung Cellular and Molecular Physiology. 2005;288:L910–L916. doi: 10.1152/ajplung.00414.2003. [DOI] [PubMed] [Google Scholar]
- Chang LC, Wang CJ, Lin YL, Wang JP. Expression of adenylyl cyclase isoforms in neutrophils. Biochimica et Biophysica Acta. 2003;1640:53–60. doi: 10.1016/s0167-4889(03)00003-x. [DOI] [PubMed] [Google Scholar]
- Chen Y, Cann MJ, Litvin TN, Iourgenko V, Sinclair ML, Levin LR, Buck J. Soluble adenylyl cyclase as an evolutionarily conserved bicarbonate sensor. Science. 2000;289:625–628. doi: 10.1126/science.289.5479.625. [DOI] [PubMed] [Google Scholar]
- Chern Y. Regulation of adenylyl cyclase in the central nervous system. Cellular Signalling. 2000;12:195–204. doi: 10.1016/s0898-6568(99)00084-4. [DOI] [PubMed] [Google Scholar]
- Cook ZC, Gray MA, Cann MJ. Elevated carbon dioxide blunts mammalian cAMP signaling dependent on inositol 1,4,5-triphosphate receptor-mediated Ca2+ release. Journal of Biological Chemistry. 2012;287:26291–26301. doi: 10.1074/jbc.M112.349191. http://dx.doi.org/10.1074/jbc.M112.349191. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Delpiano MA, Acker H. Hypoxia increases the cyclic AMP content of the cat carotid body in vitro. Journal of Neurochemistry. 1991;57:291–297. doi: 10.1111/j.1471-4159.1991.tb02127.x. [DOI] [PubMed] [Google Scholar]
- Fitzgerald RS, Parks DC. Effect of hypoxia on carotid chemoreceptor response to carbon dioxide in cats. Respiration Physiology. 1971;12:218–229. doi: 10.1016/0034-5687(71)90054-5. [DOI] [PubMed] [Google Scholar]
- Forster HV, Smith CA. Contributions of central and peripheral chemoreceptors to the ventilatory response to CO2/H+ Journal of Applied Physiology. 2010;108:989–994. doi: 10.1152/japplphysiol.01059.2009. http://dx.doi.org/10.1152/japplphysiol.01059.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gauda EB. Gene expression in peripheral arterial chemoreceptors. Microscopy Research and Technique. 2002;59:153–167. doi: 10.1002/jemt.10190. [DOI] [PubMed] [Google Scholar]
- Gonzalez C, Almaraz L, Obeso A, Rigual R. Carotid body chemoreceptors: from natural stimuli to sensory discharges. Physiological Reviews. 1994;74:829–898. doi: 10.1152/physrev.1994.74.4.829. [DOI] [PubMed] [Google Scholar]
- Gray BA. Response of the perfused carotid body to changes in pH and PCO2. Respiration Physiology. 1968;4:229–245. doi: 10.1016/0034-5687(68)90054-6. [DOI] [PubMed] [Google Scholar]
- Guellaen G, Mahu JL, Mavier P, Berthelot P, Hanoune J. RMI 12330 A, an inhibitor of adenylate cyclase in rat liver. Biochimica et Biophysica Acta. 1977;484:465–475. doi: 10.1016/0005-2744(77)90102-4. [DOI] [PubMed] [Google Scholar]
- Halls M, Cooper DM. Regulation by Ca2+-signaling pathways of adenylyl cyclases. Cold Spring Harbour Perspectives in Biology. 2011;3:a004143. doi: 10.1101/cshperspect. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hess KC, Jones BH, Marquez B, Chen Y, Ord TS, Kamenetsky M, Miyamoto C, Zippin JH, Kopf GS, Suarez SS, Levin LR, Williams CJ, Buck J, Moss SB. The “soluble” adenylyl cyclase in sperm mediates multiple signaling events required for fertilization. Developmental Cell. 2005;9:249–259. doi: 10.1016/j.devcel.2005.06.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Iturriaga R, Mokashi A, Lahiri S. Dynamics of carotid body responses in vitro in the presence of CO2–HCO3−: role of carbonic anhydrase. Journal of Applied Physiology. 1993;75:1587–1594. doi: 10.1152/jappl.1993.75.4.1587. [DOI] [PubMed] [Google Scholar]
- Iturriaga R, Rumsey WL, Lahiri S, Spergel D, Wilson DF. Intracellular pH and oxygen chemoreception in the cat carotid body in vitro. Journal of Applied Physiology. 1992;72:2259–2266. doi: 10.1152/jappl.1992.72.6.2259. [DOI] [PubMed] [Google Scholar]
- Iturriaga R, Lahiri S, Mokashi A. Carbonic anhydrase and chemoreception in the cat carotid body. American Journal of Physiology. 1991;261:C565–C573. doi: 10.1152/ajpcell.1991.261.4.C565. [DOI] [PubMed] [Google Scholar]
- Kamenetsky M, Middelhaufe S, Bank EM, Levin LR, Buck J, Steegborn C. Molecular details of cAMP generation in mammalian cells: a tale of two systems. Journal of Molecular Biology. 2006;362:623–639. doi: 10.1016/j.jmb.2006.07.045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Karege F, Lambercy C, Schwald M, Steimer T, Cissé M. Differential changes of cAMP-dependent protein kinase activity and 3H-cAMP binding sites in rat hippocampus during maturation and aging. Neuroscience Letters. 2001;315:89–92. doi: 10.1016/s0304-3940(01)02358-8. [DOI] [PubMed] [Google Scholar]
- Kholwadwala D, Donnelly DF. Maturation of carotid chemoreceptor sensitivity to hypoxia: in vitro studies in the newborn rat. Journal of Physiology. 1992;453:461–473. doi: 10.1113/jphysiol.1992.sp019239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim I, Yang DJ, Donnelly DF, Carroll JL. Fluoresceinated peanut agglutinin (PNA) is a marker for live O(2) sensing glomus cells in rat carotid body. Advances in Experimental Medicine and Biology. 2009;648:185–190. doi: 10.1007/978-90-481-2259-2_21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kumar P, Prabhakar NR. Peripheral chemoreceptors: function and plasticity of the carotid body. Comprehensive Physiology. 2012;2012:141–219. doi: 10.1002/cphy.c100069. http://dx.doi.org/10.1002/cphy.c100069. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lahiri S, Roy A, Baby SM, Hoshi T, Semenza GL, Prabhakar NR. Oxygen sensing in the body. Progress in Biophysics and Molecular Biology. 2006;91:249–286. doi: 10.1016/j.pbiomolbio.2005.07.001. [DOI] [PubMed] [Google Scholar]
- Lahiri S, Forster RE. CO2/H(+) sensing: peripheral and central chemoreception. International Journal of Biochemistry and Cell Biology. 2003;35:1413–1435. doi: 10.1016/s1357-2725(03)00050-5. [DOI] [PubMed] [Google Scholar]
- Lahiri S, Iturriaga R, Mokashi A, Botré F, Chugh D, Osanai S. Adaptation to hypercapnia vs intracellular pH in cat carotid body: responses in vitro. Journal of Applied Physiology. 1996;80:1090–1099. doi: 10.1152/jappl.1996.80.4.1090. [DOI] [PubMed] [Google Scholar]
- Nunes AR, Monteiro EC, Johnson SM, Gauda EB. Bicarbonate-regulated soluble adenylyl cyclase (sAC) mRNA expression and activity in peripheral chemoreceptors. Advances in Experimental Medicine and Biology. 2009;648:235–241. doi: 10.1007/978-90-481-2259-2_27. http://dx.doi.org/10.1007/978-90-481-2259-2_27. [DOI] [PubMed] [Google Scholar]
- Pastor-Soler N, Beaulieu V, Litvin TN, Da Silva N, Chen Y, Brown D, Buck J, Levin LR, Breton S. Bicarbonate-regulated adenylyl cyclase (sAC) is a sensor that regulates pH-dependent V-ATPase recycling. Journal of Biological Chemistry. 2003;278:49523–49529. doi: 10.1074/jbc.M309543200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peréz-García MT, Almaraz L, González C. Effects of different types of stimulation on cyclic AMP content in the rabbit carotid body: functional significance. Journal of Neurochemistry. 1990;55:1287–1293. doi: 10.1111/j.1471-4159.1990.tb03137.x. [DOI] [PubMed] [Google Scholar]
- Pepper DR, Landauer RC, Kumar P. Postnatal development of CO2 –O2 interaction in the rat carotid body in vitro. Journal of Physiology. 1995;485:531–541. doi: 10.1113/jphysiol.1995.sp020749. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ramos LS, Zippin JH, Kamenetsky M, Buck J, Levin LR. Glucose and GLP-1 stimulate cAMP production via distinct adenylyl cyclases in INS-1E insulinoma cells. Journal of General Physiology. 2008;132:329–338. doi: 10.1085/jgp.200810044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ridderstråle Y, Hanson MA. Histochemical localization of carbonic anhydrase in the cat carotid body. Annals of the New York Academy of Sciences. 1984;429:398–400. doi: 10.1111/j.1749-6632.1984.tb12363.x. [DOI] [PubMed] [Google Scholar]
- Rigual R, Lopez-Lopez JR, Gonzalez C. Release of dopamine and chemoreceptor discharge induced by low pH and high PCO2 stimulation of the cat carotid body. Journal of Physiology. 1991;433:519–531. doi: 10.1113/jphysiol.1991.sp018441. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rocher A, Caceres AL, Almaraz L, Gonzalez C. EPAC signalling pathways are involved in low PO2 chemoreception in carotid body chemoreceptor cells. Journal of Physiology. 2009;587:4015–4027. doi: 10.1113/jphysiol.2009.172072. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rocher A, Obeso A, Gonzalez C, Herreros B. Ionic mechanisms for the transduction of acidic stimuli in rabbit carotid body glomus cells. Journal of Physiology. 1991;433:533–548. doi: 10.1113/jphysiol.1991.sp018442. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sadana R, Dessauer CW. Physiological roles for G protein-regulated adenylyl cyclase isoforms: insights from knockout and overexpression studies. Neurosignals. 2009;17:5–22. doi: 10.1159/000166277. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schmid A, Sutto Z, Nlend MC, Horvath G, Schmid N, Buck J, Levin LR, Conner GE, Fregien N, Salathe M. Soluble adenylyl cyclase is localized to cilia and contributes to ciliary beat frequency regulation via production of cAMP. Journal of General Physiology. 2007;130:99–109. doi: 10.1085/jgp.200709784. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Summers BA, Overholt JL, Prabhakar NR. CO(2) and pH independently modulate L-type Ca(2+) current in rabbit carotid body glomus cells. Journal of Neurophysiology. 2002;88:604–612. doi: 10.1152/jn.2002.88.2.604. [DOI] [PubMed] [Google Scholar]
- Sun XC, Cui M, Bonanno JA. [HCO3−]-regulated expression and activity of soluble adenylyl cyclase in corneal endothelial and Calu-3 cells. BMC Physiology. 2004;4:8. doi: 10.1186/1472-6793-4-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tan ZY, Lu Y, Whiteis CA, Benson CJ, Chapleau MW, Abboud FM. Acid-sensing ion channels contribute to transduction of extracellular acidosis in rat carotid body glomus cells. Circulation Research. 2007;101:1009–1019. doi: 10.1161/CIRCRESAHA.107.154377. [DOI] [PubMed] [Google Scholar]
- Thomas JA, Buchsbaum RM, Zimniack A, Racker A. Intracellular pH measurements in Ehrlich ascites tumor cells utilizing spectroscopic probes generated in situ. Biochemistry. 1976;18:2210–2218. doi: 10.1021/bi00578a012. [DOI] [PubMed] [Google Scholar]
- Townsend PD, Holliday PM, Fenyk S, Hess KC, Gray MA, Hodgson DR, Cann MJ. Stimulation of mammalian G-protein-responsive adenylyl cyclases by carbon dioxide. Journal of Biological Chemistry. 2009;284:784–791. doi: 10.1074/jbc.M807239200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Travis DM. Molecular CO2 is inert on carotid chemoreceptor: demonstration by inhibition of carbonic anhydrase. Journal of Pharmacology and Experimental Therapeutics. 1971;178:529–540. [PubMed] [Google Scholar]
- Wang GP, Xu CS. Reference gene selection for real-time RT-PCR in eight kinds of rat regenerating hepatic cells. Molecular Biotechnology. 2010;46:49–57. doi: 10.1007/s12033-010-9274-5. [DOI] [PubMed] [Google Scholar]
- Wilding TJ, Cheng B, Roos A. pH regulation in adult rat carotid body glomus cells. Importance of extracellular pH, sodium, and potassium. Journal of General Physiology. 1992;100:593–608. doi: 10.1085/jgp.100.4.593. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang M, Nurse CA. CO2/pH chemosensory signaling in co-cultures of rat carotid body receptors and petrosal neurons: role of ATP and Ach. Journal of Neurophysiology. 2004;92:3433–3445. doi: 10.1152/jn.01099.2003. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.