Skip to main content
PLOS One logoLink to PLOS One
. 2014 Aug 4;9(8):e104204. doi: 10.1371/journal.pone.0104204

Efficient Production of (R)-2-Hydroxy-4-Phenylbutyric Acid by Using a Coupled Reconstructed d-Lactate Dehydrogenase and Formate Dehydrogenase System

Binbin Sheng 1, Zhaojuan Zheng 2, Min Lv 1, Haiwei Zhang 1, Tong Qin 1, Chao Gao 1,*, Cuiqing Ma 1, Ping Xu 1,¤
Editor: John R Battista3
PMCID: PMC4121320  PMID: 25089519

Abstract

Background

(R)-2-Hydroxy-4-phenylbutyric acid [(R)-HPBA] is a key precursor for the production of angiotensin-converting enzyme inhibitors. However, the product yield and concentration of reported (R)-HPBA synthetic processes remain unsatisfactory.

Methodology/Principal Findings

The Y52L/F299Y mutant of NAD-dependent d-lactate dehydrogenase (d-nLDH) in Lactobacillus bulgaricus ATCC 11842 was found to have high bio-reduction activity toward 2-oxo-4-phenylbutyric acid (OPBA). The mutant d-nLDHY52L/F299Y was then coexpressed with formate dehydrogenase in Escherichia coli BL21 (DE3) to construct a novel biocatalyst E. coli DF. Thus, a novel bio-reduction process utilizing whole cells of E. coli DF as the biocatalyst and formate as the co-substrate for cofactor regeneration was developed for the production of (R)-HPBA from OPBA. The biocatalysis conditions were then optimized.

Conclusions/Significance

Under the optimum conditions, 73.4 mM OPBA was reduced to 71.8 mM (R)-HPBA in 90 min. Given its high product enantiomeric excess (>99%) and productivity (47.9 mM h−1), the constructed coupling biocatalysis system is a promising alternative for (R)-HPBA production.

Introduction

(R)-2-hydroxy-4-phenylbutyric acid [(R)-HPBA] and ethyl (R)-2-hydroxy-4-phenylbutyrate [(R)-HPBE] can be used as the key precursors for the production of angiotensin-converting enzyme (ACE) inhibitors [1][5]. ACE inhibitors such as benazepril, enalapril, lisinopril, ramipril, and quinapril are widely used in the first-line therapy of hypertension and congestive heart failure [6][9]. Owing to the substantial demand for these drugs, various chemical or biological processes have been developed to produce (R)-HPBA or (R)-HPBE. In recent years, great success has been achieved in asymmetric synthesis of (R)-HPBE catalyzed by recombinant reductases [10], [11]. For example, whole cells of a recombinant Escherichia coli strain harboring CgKR2 and glucose dehydrogenase (GDH) were applied in preparing (R)-HPBE with high concentration, desirable enantiomeric excess (ee) (>99%) and yield [10]. Compared with that of (R)-HPBE, the product yield and concentration of the reported (R)-HPBA synthesis processes remained unsatisfactory [1], [12].

In previous studies, enzymatic resolution and asymmetric reduction were used in the biological production of (R)-HPBA. Compared with enzymatic resolution catalyzed by hydrolases, especially lipases [4], [9], [13], asymmetric bio-reduction of 2-oxo-4-phenylbutyric acid (OPBA) by dehydrogenases is more desirable because of its excellent stereoselectivity and high theoretical yield up to 100% [1], [14]. For practical production of (R)-HPBA from OPBA through bio-reduction, highly efficient reductases and cofactor regeneration systems are needed.

In contrast to the (R)-HPBE preparation processes, which often utilize a specific carbonyl reductase, the production of (R)-HPBA from OPBA is catalyzed by 2-ketoacid reductases, especially NAD-dependent d-lactate dehydrogenase (d-nLDH) [12], [15]. However, as an unnatural substrate of d-nLDH, OPBA could not be efficiently catalyzed by the biocatalyst because of its large aromatic group at C-4.On the other hand, cofactor regeneration systems that utilize glucose as a co-substrate in (R)-HPBE production may not be the proper choice in the (R)-HPBA production. The addition of glucose to the reaction system may result in the production of organic acids (such as gluconic acid and lactic acid) as byproducts and increase the complexity of the (R)-HPBA separation process [16], [17]. In a previous study, a partially purified d-nLDH was used to transform OPBA to (R)-HPBA. The cofactor NADH was regenerated by formate dehydrogenase (FDH) present in whole cells of Candida boidinii ATCC 32195. Although this NADH regeneration system produced CO2 as the only byproduct, which facilitated the isolation of (R)-HPBA, the whole cells of C. boidinii should be pre-treated with toluene to make them permeable [12].

In our previous studies, the d-nLDH in Lactobacillus bulgaricus ATCC 11842 was rationally re-designed and then used for the bio-reduction of substrates with large aliphatic or aromatic groups at C-3 [14]. In this study, the activities of different d-nLDH mutants toward OPBA (2-oxo carboxylic acids with an aromatic group at C-4) were assayed. The most active reconstructed d-nLDH was co-expressed with FDH from C. boidinii NCYC 1513 in E. coli BL21 (DE3). Then, a novel process utilizing whole cells of recombinant E. coli was developed for efficient production of (R)-HPBA from OPBA (Fig. 1).

Figure 1. Scheme for (R)-HPBA production from OPBA by using a coupled system of reconstructed d-nLDH and FDH.

Figure 1

Materials And Methods

Materials

OPBA was purchased from Gracia Chemical Technology Co., Ltd. Chengdu (China). Isopropyl-β-d-1-thiogalactopyranoside (IPTG), phenylmethanesulfonyl fluoride (PMSF), and (R)-HPBA were purchased from Sigma-Aldrich. (S)-HPBA was purchased from J&K Chemical. All other chemicals in this study were of reagent grade.

Microorganisms And Growth Conditions

The bacterial strains, plasmids, and oligonucleotide primers used in this study are listed in Table 1. E. coli DH5α and BL21 (DE3) were used for general cloning and expression procedures, respectively. E. coli WD, E. coli D1, and E. coli D2 were used to express wild d-nLDH, d-nLDHF299Y, and d-nLDHY52L/F299Y, respectively [14]. E. coli PD containing the vector pETDuet-1 was used as a control. The plasmid pETDuet-ldhD Y52L/F299Y-fdh was constructed as follows: the ldhD Y52L/F299Y gene was amplified using primers D.f and D.r with plasmid pETDuet-ldhD Y52L/F299Y as a template. The fdh gene was amplified using primers F.f and F.r with genomic DNA of C. boidinii NCYC 1513 as a template. The resulting PCR products ldhD Y52L/F299Y and fdh were digested with NcoI-BamHI and NdeI-XhoI, respectively, and cloned into MCS1 and MCS2 of pETDuet-1 successively to construct pETDuet-ldhD Y52L/F299Y-fdh. The plasmid pETDuet-ldhD Y52L/F299Y-fdh was then transformed into E. coli BL21 (DE3) to construct E. coli DF. All of the E. coli strains were grown in Luria-Bertani (LB) medium, and ampicillin was added at a concentration of 100 µg m1−1 if necessary.

Table 1. Strains, plasmids, and oligonucleotide primers used in this study.

Strain, plasmid, or primer Relevant characteristics Source or reference
Strain
E. coli DH5α φ80 lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17 supE44λ-thi-1 Invitrogen
E. coli BL21(DE3) F ompT gal dcm lon hsdS B(rB mB ) λ(DE3) Novagen
C. boidinii NCYC 1513 Wild-type, source of fdh gene NCYCa
E. coli PD E. coli BL21(DE3) containing vector pETDuet-1 This study
E. coli WD E. coli BL21(DE3) expressing wild type d-nLDH [14]
E. coli D1 E. coli BL21(DE3) expressing d-nLDHF299Y [14]
E. coli D2 E. coli BL21(DE3) expressing d-nLDHY52L/F299Y [14]
E. coli DF E. coli BL21(DE3) expressing d-nLDHY52L/F299Y and FDH This study
Plasmid
pETDuet-1 Expression vector, Ampr Novagen
pETDuet-ldhD Y52L/F299Y N-terminal His-tagged ldhD Y52L/F299Y gene in pETDuet-1 [14]
pETDuet-ldhD Y52L/F299Y-fdh Both ldhD Y52L/F299Y and fdh without His-tag in pETDuet-1 This study
Oligonucleotide primer Sequence (5′→3′)
D.f CCATGGTGACTAAAATTTTTGCTTACGCA (NcoI)
D.r GGATCCTTAGCCAACCTTAACTGGAGTTT (BamHI)
F.f CATATGAAGATCGTTTTAGTCTTATATGATGCTGGTA (NdeI)
F.r CTCGAGTTATTTCTTATCGTGTTTACCGTAAGCTTTG (XhoI)
a

NCYC, National Collection of Yeast Cultures.

doi:10.1371/journal.pone.0104204.t001

Biocatalyst Preparation

The recombinant strains of E. coli PD, E. coli WD, E. coli D1, E. coli D2, and E. coli DF were all cultured in LB medium (100 µg ml−1 ampicillin) at 37°C to an optical density of 0.6 at 600 nm. IPTG (1 mM) was then added to induce protein expression, and cultures were grown at 16°C for a further 12 h. Cells were harvested by centrifugation at 6,000 rpm for 10 min, washed twice with 67 mM phosphate buffer solution (pH 7.4), and then subjected to successive biotransformation.

Optimization Of Biocatalysis Conditions

To optimize the biotransformation conditions, 5-ml reaction mixtures were incubated at 37°C and 120 rpm in a 25-ml flask. The pH was adjusted from 5.5 to 8.5. The concentrations of OPBA and formate were 25–175 mM. The concentration of the whole cells was 1–8 g dry cell weight (DCW) l−1. Samples (0.2 ml) were collected periodically and centrifuged at 12,000 rpm. The concentrations of OPBA and (R)-HPBA in the supernatant were analyzed by a high-performance liquid chromatography (HPLC) system (Agilent 1100 series, Hewlett-Packard, USA).

Analytical Procedures

Cells of E. coli PD, E. coli WD, E. coli D1, E. coli D2, and E. coli DF were harvested, suspended in 67 mM phosphate buffer solution (pH 7.4) containing 1 mM PMSF, and then disrupted by sonication (Sonics 500 W; 20 KHz) for 5 min in an ice bath. Thereafter, intact cells and cell debris were removed by centrifugation, and the resultant crude extracts were subjected to successive d-nLDH activity assays. The reduction activities of d-nLDH wild-type and mutants toward OPBA were assayed at 37°C in 1 ml of 50 mM Tris-HCl buffer (pH 7.5) containing 0.2 mM NADH, 10 mM OPBA, and the crude extracts of E. coli PD, E. coli WD, E. coli D1, E. coli D2, and E. coli DF. The rate of NADH decrease was determined by measuring the absorbance change at 340 nm [14],[18],[19]. One unit of d-nLDH activity was defined as the amount that catalyzed the oxidation of 1 µmol of NADH per minute. The protein concentration was determined by the Lowry procedure by using bovine serum albumin as the standard [20].

OPBA and (R)-HPBA were measured by HPLC (Agilent 1100 series) equipped with an Agilent Zorbax SB-C18 column (150×4.6 mm, 5 µm) and a variable-wavelength detector at 210 nm. The mobile phase consisted of 1 mM H2SO4 and acetonitrile with a ratio of 85∶15 (v/v) at a flow rate of 0.7 ml min−1 at 30°C. Stereoselective assays for (R)-HPBA and (S)-HPBA were performed by HPLC analysis by using a chiral column (MCI GEL CRS10W, Japan) and a tunable UV detector at 254 nm. The mobile phase was 2 mM CuSO4 and acetonitrile with a ratio of 85∶15 (v/v) at a flow rate of 0.5 ml min−1 and a temperature of 25°C. The ee of (R)-HPBA was defined as [((R)-HPBA−(S)-HPBA)/((R)-HPBA+(S)-HPBA)]×100%.

Results And Discussion

Activity Of d-Nldh Wild-Type And Mutants Toward Opba

To evaluate the possibility of transforming OPBA into (R)-HPBA by d-nLDH, the wild type d-nLDH from L. bulgaricus ATCC 11842 and its mutants were overexpressed in E. coli BL21 (DE3). Crude extracts of E. coli PD, E. coli WD, and E. coli D1 exhibited rather low OPBA reduction activity (Fig. 2A). The Y52L/F299Y mutant of d-nLDH caused the specific activity of the crude extract of E. coli D2 to be 233.2–312.3 fold higher than that in extracts of E. coli PD, E. coli WD, and E. coli D1. These results suggest that the mutant d-nLDHY52L/F299Y is rather active toward OPBA and may have the potential to efficiently produce (R)-HPBA from OPBA.

Figure 2. Feasibility of (R)-HPBA production through cofactor regeneration by reconstructed d-nLDH and FDH.

Figure 2

(A) OPBA reduction activities in the crude extract of different E. coli strains. (B) Asymmetric reduction of OPBA by whole cells of different E. coli strains. For E. coli PD, E. coli WD, E. coli D1, and E. coli D2, NADH regeneration was conducted by the direct addition of 50 mM glucose. For E. coli DF, formate of 50 mM was added in the reaction broth for NADH regeneration.

Feasibility Of (R)-Hpba Production Through The Cofactor Regeneration System

Asymmetric reduction of OPBA by whole cells of E. coli PD, E. coli WD, E. coli D1, E. coli D2, and E. coli DF was investigated to further explore the potential by using d-nLDH in the synthesis of (R)-HPBA. OPBA at 50 mM was used as the substrate. Whole cells of E. coli PD, E. coli WD, E. coli D1, and E. coli D2 at a concentration of 8 g DCW l−1 were added to the reaction broth. The reaction was conducted at 37°C for 2 h. Here, NADH was regenerated through the direct addition of 50 mM glucose in the reaction system. Whole cells of E. coli D2 exhibited higher (R)-HPBA producing capability than did cells of E. coli PD, E. coli WD, and E. coli D1(Fig. 2B). However, the (R)-HPBA productivity (3.7 mM h−1) was still rather low because of the low efficiency of the NADH regeneration system. Additionally, organic acids, including pyruvic acid, lactic acid, and acetic acid, accumulated in the reaction broth (Fig. S1).

FDH is a good choice for NADH regeneration in a biocatalysis system because its substrate, formate, has a low cost and its product, carbon dioxide, is easily separated [21][25]. In this work, FDH was coexpressed with d-nLDHY52L/F299Y in E. coli DF and the (R)-HPBA production capability of the novel biocatalyst was investigated. Formate (50 mM) was added to the reaction broth for the regeneration of NADH. Although the activity of d-nLDHY52L/F299Y in the crude extract of E. coli DF was lower than in the extract of E. coli D2, whole cells of E. coli DF exhibited much higher (R)-HPBA producing capability than other biocatalysts (Fig. 2A and Fig. 2B). (R)-HPBA at 49.0 mM was obtained from 50 mM OPBA. The productivity of (R)-HPBA was 24.5 mM h−1. Thus, whole cells of E. coli DF were selected as biocatalysts for (R)-HPBA production in the subsequent experiments.

Optimization Of Biocatalysis Conditions

To achieve a higher product concentration, the biocatalytic conditions for (R)-HPBA production from OPBA by using whole cells of E. coli DF were optimized. The influence of the reaction pH was determined in reaction mixtures containing 13 g DCW l−1 whole cells of E. coli DF, 50 mM OPBA, 50 mM sodium formate, and 200 mM phosphate buffer (pH ranging from 5.5 to 8.5). After bioconversion at 37°C for 15 min, the highest (R)-HPBA production was detected at pH 6.5 (Fig. 3A).

Figure 3. Optimization of the biocatalysis conditions.

Figure 3

(A) pH. (B) Concentration of OPBA.

To determine the effect of the OPBA concentration, reactions with eight different OPBA and sodium formate concentrations (25, 50, 75, 100, 125, 150, and 175 mM) were conducted at pH 6.5 and 37°C for 30 min. The highest (R)-HPBA production was detected when 75 mM OPBA was used (Fig. 3B). The effect of the biocatalyst concentration was also investigated to determine the optimal range. The biotransformation was conducted with 75 mM OPBA, 75 mM sodium formate, 200 mM phosphate buffer (pH 6.5), and whole cells of E. coli DF at six different concentrations (1, 3, 5, 6, 7, and 8 g DCW l−1). When the reactions were conducted to approximate 80% theoretical yield, the highest specific productivity was observed at a biocatalyst concentration of 6 g DCW l−1 (Table 2).

Table 2. Effects of concentration of whole cells on biotransformationa.

Cell concentration (g DCW l−1) 1 3 5 6 7 8
Reaction time (min) 285 140 75 55 50 45
(R)-HPBA concentration (mM) 33.0 61.8 59.9 59.4 60.3 61.1
Productivityb (mM min−1 g−1 DCW) 0.116 0.147 0.160 0.180 0.172 0.170
a

Value is the average value of three separate assays.

b

Productivity was calculated when the reaction was conducted to approximately 80% of the theoretical yield except for the reaction at 1 g DCW l−1 whole cells.

doi:10.1371/journal.pone.0104204.t002

Production Of (R)-Hpba Under Optimal Conditions

On the basis of the results presented above, an optimal bioconversion system for production of optically pure (R)-HPBA from OPBA was developed. Biotransformation was conducted at 37°C in 200 mM phosphate buffer (pH 6.5) with 6 g DCW l−1 whole cells of E. coli DF as the biocatalyst. As shown in Fig. 4A, 71.8 mM (R)-HPBA with a high enantiomeric purity (ee >99%, Fig. S2) was obtained from 73.4 mM OPBA in 90 min. When whole cells of E. coli D2 only expressing d-nLDHY52L/F299Y were used as the biocatalyst, and glucose was added for NADH regeneration, only 44.7 mM (R)-HPBA was produced with a yield of 60.9% after 360 min (Fig. 4B).

Figure 4. Time course of highly optically pure (R)-HPBA production from OPBA under optimal conditions.

Figure 4

(A) Biotransformation using whole cells of E. coli DF as a biocatalyst and formate for cofactor regeneration. (B) Biotransformation using whole cells of E. coli D2 as a biocatalyst and glucose for cofactor regeneration. (▪), OPBA; (▴), (R)-HPBA; (•), ee.

Many biocatalysts have been used in the enantioselective production of (R)-HPBE and (R)-HPBA through bio-reduction [1],[12],[26][28]. Compared with (R)-HPBE production processes, the product concentrations of the reported (R)-HPBA synthesis processes were rather low (Table 3) [1],[10][12],[15],[29],[30]. In the previous study, purified d-LDH from Staphylococcus epidermidis and FDH from Candida boidinii were applied for (R)-HPBA production. (R)-HPBA at a concentration of 182 mM was produced, which is the highest reported yield of (R)-HPBA to date [15]. However, problems concerning the application of the process, such as the complicated enzyme purification and costly cofactor addition, remain. In the present work, mutant d-nLDH and FDH were co-expressed in E. coli DF and used for (R)-HPBA production from OPBA. The productivity (47.9 mM h−1) and ee (>99%) of the product were rather high for (R)-HPBA production. Additionally, given the simple composition of the biocatalytic system, separation of (R)-HPBA from the biocatalytic system would be relatively inexpensive. Therefore, the novel process established in this study could also be used as a promising route for the production of highly optically pure (R)-HPBA.

Table 3. Comparison of recently reported processes for (R)-HPBA or (R)-HPBE production through bio-reduction.

Biocatalyst Product (mM) Productivity (mM h−1) ee (%) Co-substrate References
Whole cells of Candida boidinii CIOC21 20 1.7 99 5% glucose [27]
Whole cells of Bacillus pumilus Phe-C3 29.6 1.1 97.1 2% glucose [28]
Whole cells of Candida krusei SW2026 79.5 5.0 97.4 5% glucose [26]
Saccharomyces cerevisiae pretreated with α-phenacyl chloride 4.8 0.2 92 - [29]
Saccharomyces cerevisiae pretreated with α-phenacyl chloride 167.7 3.5 87.5 1.5% ethanol (v/v) [30]
Lyophilized cells of E. coli BL21/pCgKR 2 and lyophilized GDH powders 1000 140.1 >99 27% glucose [10]
Whole cells of E. coli BL21 coexpressing IolS and GDH 50 3.8 99.5 3.6% glucose [31]
Whole cells of E. coli BL21 coexpressing IolS and GDH 1600 132.1 99.5 20% glucose [11]
d-LDH from Staphylococcus epidermidis and FDH from Candida boidinii * 182 38.2 >99.8 2.2% ammonium formate [15]
Partially purified d-LDH (EC 1.1.1.28) and whole cells of Candida boidinii ATCC 32591 containing FDH* 56.7 49.9 ND 0.8% sodium formate [12]
Whole cells of E. coli BL21 coexpressing YiaE and GDH* 100 4.2 98 3.6% glucose [1]
Whole cells of E. coli DF* 71.8 47.9 >99 0.5% sodium formate This study

*Substrates were OPBA. Substrates of the other processes were OPBE. ND represents no data.

doi:10.1371/journal.pone.0104204.t003

Conclusions

In summary, whole cells of E. coli DF coexpressing d-nLDHY52L/F299Y from L. bulgaricus ATCC 11842 and FDH from C. boidinii NCYC 1513 exhibited catalytic capability for (R)-HPBA production from OPBA. After optimization of the biotransformation conditions, 73.4 mM OPBA was reduced to 71.8 mM (R)-HPBA with a high productivity of 47.9 mM h−1 and an excellent ee (>99%). The constructed coupled biocatalysis system developed in this work may be a promising alternative for the production of the key medical intermediate (R)-HPBA.

Supporting Information

Figure S1

HPLC analysis of the product of the catalytic reaction by using whole cells of E. coli D2 (A) as the biocatalyst and glucose as the substrate for NADH regeneration or whole cells of E. coli DF (B) as the biocatalyst and sodium formate as the substrate for NADH regeneration.

(TIF)

Figure S2

HPLC analysis of the product of the catalytic reaction utilizing the whole cell biocatalyst. (A) HPLC analysis of (R)-HPBA and (S)-HPBA. (B) Product of the catalytic reaction.

(TIF)

Data Availability

The authors confirm that all data underlying the findings are fully available without restriction. Relevant data are included within the paper and its Supporting Information files.

Funding Statement

This work was supported by the National Natural Science Foundation of China (31270856, 31170052, 31270090 and J1103515), the Independent Innovation Foundation of Shandong University (2012GN017) and the Excellent Middle-Aged and Youth Scientist Award Foundation of Shandong Province (BS2013SW025). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Yun H, Choi HL, Fadnavis NW, Kim BG (2005) Stereospecific synthesis of (R)-2-hydroxy carboxylic acids using recombinant E. coli BL21 overexpressing YiaE from Escherichia coli K12 and glucose dehydrogenase from Bacillus subtilis . Biotechnol Prog 21: 366–371. [DOI] [PubMed] [Google Scholar]
  • 2. de Lacerda PSB, Ribeiro JB, Leite SGF, Coelho RB, Lima ELD, et al. (2006) Microbial enantioselective reduction of ethyl-2-oxo-4-phenyl-butanoate. Biochem Eng J 28: 299–302. [Google Scholar]
  • 3. de Lacerda PSB, Ribeiro JB, Leite SGF, Ferrara MA, Coelho RB, et al. (2006) Microbial reduction of ethyl 2-oxo-4-phenylbutyrate. Searching for R-enantioselectivity. New access to the enalapril like ACE inhibitors. Tetrahedron: Asymmetry 17: 1186–1188. [Google Scholar]
  • 4. Chen B, Yin HF, Wang ZS, Liu JY, Xu JH (2010) A new chemo-enzymatic route to chiral 2-hydroxy-4-phenylbutyrates by combining lactonase-mediated resolution with hydrogenation over Pd/C. Chem Commun 46: 2754–2756. [DOI] [PubMed] [Google Scholar]
  • 5. Huang Y, Liu N, Wu X, Chen Y (2010) Dehydrogenases/reductases for the synthesis of chiral pharmaceutical intermediates. Curr Org Chem 14: 1447–1460. [Google Scholar]
  • 6. Iwasaki G, Kimura R, Numao N, Kondo K (1989) A practical and diastereoselective synthesis of angiotensin converting enzyme inhibitors. Chem Pharm Bull 37: 280–283. [Google Scholar]
  • 7. Lin WQ, He Z, Jing Y, Cui X, Liu H, et al. (2001) A practical synthesis of ethyl (R)- and (S)-2-hydroxy-4-phenylbutanoate and d-homophenylalanine ethyl ester hydrochloride from l-malic acid. Tetrahedron: Asymmetry 12: 1583–1587. [Google Scholar]
  • 8. Nakamura K, Yamanaka R, Matsuda T, Harada T (2003) Recent developments in asymmetric reduction of ketones with biocatalysts. Tetrahedron: Asymmetry 14: 2659–2681. [Google Scholar]
  • 9. Larissegger-Schnell B, Glueck SM, Kroutil W, Faber K (2006) Enantio-complementary deracemization of (+/−)-2-hydroxy-4-phenylbutanoic acid and (+/−)-3-phenyllactic acid using lipase-catalyzed kinetic resolution combined with biocatalytic racemization. Tetrahedron 62: 2912–2916. [Google Scholar]
  • 10. Shen ND, Ni Y, Ma HM, Wang LJ, Li CX, et al. (2012) Efficient synthesis of a chiral precursor for angiotensin-converting enzyme (ACE) inhibitors in high space-time yield by a new reductase without external cofactors. Org Lett 14: 1982–1985. [DOI] [PubMed] [Google Scholar]
  • 11. Ni Y, Su Y, Li H, Zhou J, Sun Z (2013) Scalable biocatalytic synthesis of optically pure ethyl (R)-2-hydroxy-4-phenylbutyrate using a recombinant E. coli with high catalyst yield. J Biotechnol 168: 493–498. [DOI] [PubMed] [Google Scholar]
  • 12. Bai Y, Yang ST (2005) Biotransformation of R-2-hydroxy-4-phenylbutyric acid by d-lactate dehydrogenase and Candida boidinii cells containing formate dehydrogenase coimmobilized in a fibrous bed bioreactor. Biotechnol Bioeng 92: 137–146. [DOI] [PubMed] [Google Scholar]
  • 13. Kalaritis P, Regenye RW, Partridge JJ, Coffen DL (1990) Kinetic resolution of 2-substituted esters catalyzed by a lipase ex. Pseudomonas fluorescens . J Org Chem 55: 812–815. [Google Scholar]
  • 14. Zheng Z, Sheng B, Gao C, Zhang H, Qin T, et al. (2013) Highly stereoselective biosynthesis of (R)-α-hydroxy carboxylic acids through rationally re-designed mutation of d-lactate dehydrogenase. Sci Rep 3: 3401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Schmidt E, Ghisalba O, Gygax D, Sedelmeier G (1992) Optimization of a process for the production of (R)-2-hydroxy-4-phenylbutyric acid–an intermediate for inhibitors of angiotensin converting enzyme. J Biotechnol 24: 315–327. [DOI] [PubMed] [Google Scholar]
  • 16. Zheng Z, Ma C, Gao C, Li F, Qin J, et al. (2011) Efficient conversion of phenylpyruvic acid to phenyllactic acid by using whole cells of Bacillus coagulans SDM. PLoS One 6: e19030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Gao C, Zhang L, Xie Y, Hu C, Zhang Y, et al. (2013) Production of (3S)-acetoin from diacetyl by using stereoselective NADPH-dependent carbonyl reductase and glucose dehydrogenase. Bioresour Technol 137: 111–115. [DOI] [PubMed] [Google Scholar]
  • 18. Singhvi M, Jadhav A, Gokhale D (2013) Supplementation of medium with diammonium hydrogen phosphate enhanced the d-lactate dehydrogenase levels leading to increased d-lactic acid productivity. Bioresour Technol 146: 736–739. [DOI] [PubMed] [Google Scholar]
  • 19. Zheng Z, Sheng B, Ma C, Zhang H, Gao C, et al. (2012) Relative catalytic efficiency of ldhL- and ldhD-encoded products is crucial for optical purity of lactic acid produced by Lactobacillus strains. Appl Environ Microbiol 78: 3480–3483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Markwell MAK, Haas SM, Bieber LL, Tolbert NE (1978) A modification of the Lowry procedure to simplify protein determination in membrane and lipoprotein samples. Anal Biochem 87: 206–210. [DOI] [PubMed] [Google Scholar]
  • 21. Bai Y, Yang ST (2007) Production and separation of formate dehydrogenase from Candida boidinii . Enzyme Microb Technol 40: 940–946. [Google Scholar]
  • 22. Schütte H, Flossdorf J, Sahm H, Kula M-R (1976) Purification and properties of formaldehyde dehydrogenase and formate dehydrogenase from Candida boidinii . Eur J Biochem 62: 151–160. [DOI] [PubMed] [Google Scholar]
  • 23. Wang Y, Li L, Ma C, Gao C, Tao F, et al. (2013) Engineering of cofactor regeneration enhances (2S,3S)-2,3-butanediol production from diacetyl. Sci Rep 3: 2643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Fröhlich P, Albert K, Bertau M (2011) Formate dehydrogenase – a biocatalyst with novel applications in organic chemistry. Org Biomol Chem 9: 7941–7950. [DOI] [PubMed] [Google Scholar]
  • 25. Yu S, Zhu L, Zhou C, An T, Jiang B, et al. (2013) Enzymatic production of d-3-phenyllactic acid by Pediococcus pentosaceus d-lactate dehydrogenase with NADH regeneration by Ogataea parapolymorpha formate dehydrogenase. Biotechnol Lett 36: 627–631. [DOI] [PubMed] [Google Scholar]
  • 26. Zhang W, Ni Y, Sun Z, Zheng P, Lin W, et al. (2009) Biocatalytic synthesis of ethyl (R)-2-hydroxy-4-phenylbutyrate with Candida krusei SW2026: A practical process for high enantiopurity and product titer. Process Biochem 44: 1270–1275. [Google Scholar]
  • 27. Chen Y, Lin H, Xu X, Xia S, Wang L (2008) Preparation the key intermediate of angiotensin-converting enzyme (ACE) inhibitors: High enantioselective production of ethyl (R)-2-hydroxy-4-phenylbutyrate with Candida boidinii CIOC21. Adv Synth Catal 350: 426–430. [Google Scholar]
  • 28. He CM, Chang DL, Zhang J (2008) Asymmetric reduction of substituted α- and β-ketoesters by Bacillus pumilus Phe-C3. Tetrahedron: Asymmetry 19: 1347–1351. [Google Scholar]
  • 29. Shi Y, Fang Y, Ren Y, Guan H, Zhang JY (2009) Applying alpha-phenacyl chloride to the enantioselective reduction of ethyl 2-oxo-4-phenylbutyrate with baker's yeast. J Chem Technol Biotechnol 84: 681–688. [Google Scholar]
  • 30. Shi YG, Fang Y, Wu HP, Li F, Zuo XQ (2009) Improved production of ethyl-(R)-2-hydroxy-4-phenylbutyrate with pretreated Saccharomyces cerevisiae in water/organic solvent two-liquid phase systems. Biocatal Biotransfor 27: 211–218. [Google Scholar]
  • 31. Su Y, Ni Y, Wang J, Xu Z, Sun Z (2012) Two-enzyme coexpressed recombinant strain for asymmetric synthesis of ethyl (R)-2-hydroxy-4-phenylbutyrate. Chin J Catal 33: 1650–1660. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

HPLC analysis of the product of the catalytic reaction by using whole cells of E. coli D2 (A) as the biocatalyst and glucose as the substrate for NADH regeneration or whole cells of E. coli DF (B) as the biocatalyst and sodium formate as the substrate for NADH regeneration.

(TIF)

Figure S2

HPLC analysis of the product of the catalytic reaction utilizing the whole cell biocatalyst. (A) HPLC analysis of (R)-HPBA and (S)-HPBA. (B) Product of the catalytic reaction.

(TIF)

Data Availability Statement

The authors confirm that all data underlying the findings are fully available without restriction. Relevant data are included within the paper and its Supporting Information files.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES