Transcriptomics identified a critical role for Th2 cell-intrinsic miR-155 in mediating allergy and antihelminth immunity

Significance

The rising prevalence of allergic diseases throughout the world demands new approaches to treat this inflammatory disorder. CD4⁺ Th2 cells orchestrate the allergic cascade, stimulating IgE production, activating innate cells, and stimulating local tissue. This study took a comprehensive approach to identify the unique transcriptional features of pathogenic Th2 cells with the aim of identifying novel molecular regulators. Highly purified Th1, Th2, Th9, Th17, and Treg cells isolated from mice with allergy, infection, and autoimmunity identified unique mRNA and microRNAs (miRNAs) expressed in Th2 cells. Functional and mechanistic studies using miRNA-deficient mice, luciferase assays, miRNA inhibitors, and siRNA in combination with state-of-the-art adoptive transfer systems, identified a critical role for miR-155–regulated S1pr1 in the pathogenesis of Th2-mediated allergy.

Abstract

Allergic diseases, orchestrated by hyperactive CD4⁺ Th2 cells, are some of the most common global chronic diseases. Therapeutic intervention relies upon broad-scale corticosteroids with indiscriminate impact. To identify targets in pathogenic Th2 cells, we took a comprehensive approach to identify the microRNA (miRNA) and mRNA transcriptome of highly purified cytokine-expressing Th1, Th2, Th9, Th17, and Treg cells both generated in vitro and isolated ex vivo from allergy, infection, and autoimmune disease models. We report here that distinct regulatory miRNA networks operate to regulate Th2 cells in house dust mite-allergic or helminth-infected animals and in vitro Th2 cells, which are distinguishable from other T cells. We validated several miRNA (miR) candidates (miR-15a, miR-20b, miR-146a, miR-155, and miR-200c), which targeted a suite of dynamically regulated genes in Th2 cells. Through in-depth studies using miR-155^−/− or miR-146a^−/− T cells, we identified that T-cell–intrinsic miR-155 was required for type-2 immunity, in part through regulation of S1pr1, whereas T-cell–intrinsic miR-146a was required to prevent overt Th1/Th17 skewing. These data identify miR-155, but not miR-146a, as a potential therapeutic target to alleviate Th2-medited inflammation and allergy.

CD4⁺ T cells can differentiate into various Th subsets characterized by distinct molecular programs and cytokine production, e.g., IFN-γ–secreting Th1 cells, IL-4–secreting Th2 cells, and IL-17A–secreting Th17 cells. Specifically, IL-4 signaling in naive T cells activates STAT6 and GATA3 (1), promoting a Th2 differentiation pathway by activating transcription at the Il4, Il5, and Il13 loci (2). Characteristically, Th2 cells have a detrimental role in allergies, which are becoming one of the most common global chronic diseases (3). In contrast, Th2 cells are essential for antihelminth immunity (4). Despite a good understanding of the signals required for Th2 differentiation (1), our knowledge of the molecular mechanisms involved in the posttranscriptional regulatory events that govern Th2 cell differentiation and effector function remain unclear.

microRNAs (miRNAs), encoded within the genome and cleaved by two ribonuclease-III enzymes, Dicer and Drosha (5), regulate mRNA translation by inhibiting and degrading mRNA (6). miRNAs critically shape immune cell development and function (7, 8) with targeted deletion of Dicer in T cells resulting in diminished peripheral CD8 and CD4 T cells (9). Among the ∼2,000 identified mammalian miRNAs (miRbase v20) (10), several T-cell–associated miRNAs have been identified that regulate development (11), differentiation (12–14), and effector function (15–19). For example, miR-29 and miR-21 regulate Th1-mediated immunity (13, 17, 18), whereas miR-326 (20), miR-10a (21), miR-155 (22), and miR-132/212 (23) influence Th17 cell differentiation and effector function. Treg cells, which provide a critical brake on effector responses, also are governed by miRNAs (24, 25), with miR-182, miR-10a (21, 26), miR-155 (27), and miR-146a (16) required for proficient Treg development and suppressive capacity. Several studies have identified miRNAs, including miR-126 (28), miR-106a (29), miR-145 (32), miR-221, and miR-155/205/498/Let-7e (30), in murine (28, 29) and human (30) allergic diseased tissue (31); however, there is a scarcity of studies specifically identifying miRNA-mediated regulation of Th2 cell differentiation and effector function. Correlations of elevated miR-181a, miR-146a, and miR-146b expression in distal, splenic CD4⁺ cells during experimental ovalbumin (OVA)-induced airway inflammation have been reported (33) but have not been tested. To date, only miR-155 has been implicated in Th2 differentiation in vitro (34), leaving a significant gap in our understanding of miRNAs involved in Th2 cell differentiation and in vivo effector function.

In this study we took a systematic and comprehensive approach to identify the miRNAome of all Th cells, using highly purified cytokine or transcription factor reporter systems to identify Th2-specific miRNAs. Using a subtractive comparative analysis, we established distinct transcriptomes, miRNAs, and their targets in Th2 cells generated in vitro and isolated ex vivo from house dust mite (HDM)- or helminth (Heligmosomoides polygyrus)-induced inflammation that were distinct from other Th subsets. Functionally restricting miR-155 or miR-146a deficiency to T cells by using mixed bone marrow chimeras or miRNA inhibitors and adoptive transfer systems, we identified opposing roles for miR-155 and miR-146a in respectively promoting and regulating Th2-driven immunity. Collectively these data identify critical roles for miR-155 and miR-146a in Th2-mediated immunity and suggest that targeting miR-155, but not miR-146a, may alleviate Th2-mediated inflammation and asthma.

Results

Using Purified Cytokine/Transcription Factor Reporter-Positive Cells, Rather than Whole T-Cell Cultures, Increases Sensitivity and Resolution of Transcriptional Profiling.

To identify differentially regulated miRNAs in differentiated T cells, we initially used the well-studied in vitro T-cell activation and differentiation system (35) (Fig. 1A and SI Appendix, Figs. S1 and S2A). In the absence of supraphysiological restimulation with phorbol12-myristate13-acetate (PMA) and ionomycin, we obtained ∼75% of cells committed to a Th2 phenotype as determined using Il4^gfp expression. However, the percentage of other in vitro polarized cells varied [∼70% Th1, ∼27% Th17, 70% Th9, and 85% induced Treg (iTreg)]. Thus, between 73–15% of cells within each bulk population were not polarized or committed (SI Appendix, Fig. S2A). Therefore we used the transcriptional reporter mice (Ifnγ^yfp, Il4^gfp, Il9^CreR26^eYFP, Il17a^CreR26^FP635, and Foxp3^rfp) to purify live, unfixed, and nonpermeabilized reporter-positive cells, eliminating the influence of nonpolarized cells and avoiding the use of PMA and ionomycin in our transcriptional analysis. Purified reporter-positive cells revealed dramatically more differentially expressed genes and miRNAs with a greater dynamic range (fold change), than the bulk cultures (SI Appendix, Fig. S1 A and B). In particular, in Il4gfp⁺ Th2 cells we identified 4,644 differentially regulated genes and 137 miRNAs (an increase of more than twofold relative to naive T cells), compared with 1,926 genes and 46 miRNAs in bulk Th2 polarized cells (SI Appendix, Fig. S2B and Table 1), with many genes involved in IL-4 signaling that were undetected in bulk Th2 polarized cells (SI Appendix, Fig. S2 B and C). In all subsets, Th cell-associated transcription factors [Tbx21 (Th1), Rorγt (Th17), Foxp3 (Treg), and Irf4 and E4bp4 (Th2)] were up-regulated to a greater degree in purified cells than in bulk Th2 polarized cells.

Fig. 1.

Transcriptional analysis of FACS-purified reporter-positive T cells reveals overlap with ex vivo cells and identifies significant diversity between Th2 populations. Naive CD4 T cells were polarized in vitro, as described in Materials and Methods, with mRNA and miRNA transcriptional profiles used for comparative analysis. (A) Heat maps showing expression of mRNA (Left) and miRNAs (Right) in in vitro-derived T-cell subsets. Each heatmap lane represents the mean of three to five biological replicates per T-cell subset. (B) Heat maps showing expression of mRNA (Left) and miRNAs (Right) in ex vivo-derived T-cell subsets. Each heatmap lane represents the mean of three to five biological replicates per T-cell subset. (C) Comparative analysis showing common and unique mRNA (Left) and miRNA (Right) transcripts in each T-cell subset (greater than a fivefold change). Unique transcripts in ex vivo HDM-derived Th2 cells are highlighted in the red square. (D) Selection of HDM-derived Th2-enriched mRNAs (Left) and miRNAs (Right). (E) Venn diagrams showing comparative analysis of common and unique mRNA (Left) and miRNA (Right) transcripts in the in vitro and ex vivo T-cell subsets (greater than a fivefold change). The percentage of overlap is shown in blue. (F) Venn diagrams showing comparative analysis of common and unique Th2-enriched mRNA (Left) and miRNA (Right) transcripts in the in vitro and ex vivo T-cell subsets (greater than a fivefold change). The percentage of overlap is shown in blue. (G) Heat maps showing expression of mRNA (Left) and miRNAs (Right) in Th2 cell subsets from allergic HDM-challenged mice and mice susceptible (H.p. 1°) and resistant (H.p. 2°) to H. polygyrus. (H) (Left) Total number of differentially regulated mRNA transcripts (greater than a fivefold change) in different Th2 samples. (Right) Number of differentially regulated miRNA transcripts (greater than fivefold change) in different Th2 samples. Each heatmap lane represents the mean of three to five biological replicates per T-cell subset. (I) Four-way Venn diagrams showing comparative analysis of common and unique mRNA and miRNA transcripts in Th2 subsets. Numbers on Venn diagram are the number of transcripts; letters refer to the bar chart in SI Appendix, Fig. S7.

An miRNA and mRNA Signature Distinguishes Th2 Cells from Other Th and Treg Subsets.

Comparing the transcriptomes across all five purified reporter-positive T-cell subsets generated in vitro (Th1, Th2, Th9, Th17, and iTreg), we identified a suite of 285 Th2-enriched genes including Ccr1, Fosb, Ccr2, Socs1, and Il10rα, that were unchanged in other T-cell subsets (SI Appendix, Fig. S3 A and B and Table 2). We also applied an increasing fold-change filter (a two-, five-, or 10-fold change, relative to naive T cells) to identify highly abundant transcripts that distinguished Th2 cells from the other T-cell subsets (SI Appendix, Fig. S4). We identified 38 Th2-enriched miRNAs, including miR-146a, miR-200c, miR-15a, and miR-1931, that were unchanged in other T-cell subsets (Fig. 1A and SI Appendix, Fig. S3 A and B and Table 3). It was reported recently that upon T-cell activation in vitro there is a down-regulation in global miRNA and miRNA biogenesis pathways (36). We observed a similar down-regulation (SI Appendix, Fig. S5A) along with reduced Argonaute, Dicer, and Dgcr8 transcripts (SI Appendix, Fig. S5B). Taken together, this strategy allowed us to identify more accurately transcripts that were differentially regulated in highly purified Th2 cells, and the broad, comprehensive approach allowed us to distinguish more accurately unique features of Th2 cells.

Transcriptional Diversity Between in Vitro-Differentiated and ex Vivo Th2 (Il4^gfp+) Cells from Helminth-Infected and HDM-Challenged Mice.

To determine how similar in vitro-generated T cells were to their in vivo counterparts, we purified reporter-positive cells from various inflammatory settings: Th1 cells (CD4⁺Ifnγ^yfp+) from Plasmodium chabaudi-infected mice, Th2 cells (CD4⁺Il4^gfp+) from mice with HDM-induced airway inflammation, Th17 cells (CD4⁺Il17a^Cre;R26e^FP635+) from mice with experimental autoimmune encephalomyelitis (EAE), and natural Treg cells (nTregs) (CD4⁺Foxp3^rfp+) from naive mice (Fig. 1B). We could not isolate sufficient Th9 cells ex vivo under any conditions. Using this suite of highly purified ex vivo T cells, we performed genomewide transcriptional analysis and identified distinct mRNA and miRNA expression profiles in ex vivo Th2 cells with 247 Th2-enriched genes, including Il2, Pros1, Il13, Traip, S1pr1, and five miRNAs (miR-22, -202, -494, -18a, and -20a) (Fig. 1C and SI Appendix, Fig. S6 and Table 4).

Strikingly, when we compared purified in vitro-generated Th2 cells with ex vivo HDM-elicited Th2 cells, we observed very little overlap, with only 20% (267 transcripts) of differentially regulated genes in common (Fig. 1E). Similar percentages were observed for other Th subsets, with even lower concordance (5.4%) between iTreg and nTreg cells (Fig. 1E). When we compared Th2-enriched genes (i.e., genes that were differentially regulated in Th2 cells but not in other T cells) in the in vitro-generated (285 genes) and in the ex vivo HDM-elicited (247 genes) Th2 cells, we observed an overlap of less than 1%, with only one gene in common, the polycomb family histone methyltransferase, Ezh2 (Fig. 1F), previously implicated in Il4 and Il13 gene regulation (37). We did not find any overlap in Th2-enriched miRNAs between the in vitro and ex vivo Th2 cells. These data highlight the great discrepancy between in vitro-generated and ex vivo-isolated T-cell subsets and particularly the poor concordance between in vitro and ex vivo Th2 cells.

To investigate Th2 cell diversity further and to determine how transcriptionally different other Th2 cells were, we isolated Th2 cells from mice susceptible (primary infection, H.p. 1°) or resistant (drug-cured and reinfected, H.p. 2°) to infection with the intestinal helminth H. polygyrus. Genomewide transcriptional analysis showed that mRNA and miRNA transcripts in these ex vivo samples were distinct from in vitro Th2 cells and also were distinct from HDM-elicited Th2 cells (Fig. 1G). A four-way comparison of all Th2 populations (in vitro, HDM-elicited, H.p. 1°, and H.p. 2°) using all differentially regulated genes identified only 82 genes and 14 miRNAs in common (Fig. 1I and SI Appendix, Figs. S7–S10). Together, these data indicate that Il4^gfp+ Th2 cells generated in vitro or isolated ex vivo are largely heterogeneous, with more unique than overlapping mRNA and miRNA transcripts.

miRNA Target Prediction Identifies Putative miRNA-Mediated Regulation of Metabolic, Signaling, and Migration Pathways in Th2 Cells.

Given the diversity in each Th2 population, we analyzed each Th2 population separately to identify Th2-associated miRNAs and their mRNA targets. We used several in silico analyses to screen for putative functional miRNA–mRNA interactions. First we used an expression-pairing analysis (asking specifically whether up-regulated miRNAs were predicted to target down-regulated mRNAs, and vice versa). We then combined this analysis with a series of fold-change filters (two-, five-, or 10-fold change) in each Th2 population to identify transcripts that were more prominently changed in each Th2 subset. Finally, for each putative miRNA, we assessed the target abundance (i.e., the number of mRNAs targeted by any given miRNA, which would indicate an miRNA regulatory hub). For example, using in vitro-generated Th2 cells with a twofold filter, we identified seven miRNAs (SI Appendix, Fig. S11A, Left) that both were predicted to target and had expression patterns opposing 46 mRNAs (SI Appendix, Fig. S11, Top Right). Of these seven miRNAs, miR-214-3p (which was increased 3.6-fold from the level in naive T cells) was predicted to target 21 mRNAs. By increasing the fold-change filter to five- and 10-fold change, we lost miR-214-3p but identified several other miRNAs, including miR-15a, which was down-regulated 70-fold from levels in naive T cells and was predicted to target 22 (fivefold) and 14 (10-fold) Th2-enriched mRNAs, respectively (boldface in SI Appendix, Fig. S11A). Of note, miR-15a was down-regulated by 2.3-fold in both Th1 and iTreg cells, explaining why we did not identify miR-15a in the twofold-cutoff filter.

Combining these analyses from the in vitro-generated Th2 cells (SI Appendix, Fig. S11A), HDM-induced Th2 cells (SI Appendix, Fig. S11B), and helminth-elicited Th2 cells (SI Appendix, Fig. S11C), we selected five candidate miRNAs for further analysis: miR-15a, miR-20b, miR-146a, miR-155, and miR-200c (SI Appendix, Fig. S11E). In line with the diversity of in vitro and ex vivo Th2 populations, not all candidate miRNAs were regulated in a similar manner. For example, both miR-146a and miR-15a were down-regulated in Th2 cells generated in vitro but were up-regulated in ex vivo HDM- or helminth-elicited Th2 cells (SI Appendix, Fig. S11F), again highlighting the disparity between in vitro and ex vivo Th2 populations.

We identified several mRNA targets of the candidate miRNAs that have been implicated in Th2 cell biology. For example, miR-146a was predicted to target the IL-4–regulated genes Abl2, Kdm6B, and Mtdh (38) in both helminth-derived (H.p.1°) and in vitro-derived Th2 samples. miR-146a also was predicted to target Itch (39), Stat1 (40), and Smad4 (41) in all ex vivo Th2 cells (SI Appendix, Fig. S13). miR-15a was predicted to target the antiapoptotic gene Bcl2 and TGF-β–associated Smad5 in all Th2 samples and, along with miR-155, was predicted to target the metabolic regulators Sgk3 (42) and Rictor (43), suggesting that these genes are tightly controlled in Th2 cells by two independent miRNAs (SI Appendix, Fig. 13B). miR-155 also was predicted to target Il6r, S1pr1, and Tia-1, all of which have critical roles in Th2 cell biology (44–46). For the down-regulated miRNA candidates (miR-200c and miR-20b), we identified a significant number of common mRNA targets, including Gfi1, Maf, Egr2, Hif1α, Lif, Map3k8, Rorα, and Tnfsf11 (SI Appendix, Fig. S13C), all of which have reported roles in Th2 cells.

Spatial and Temporal Expression of miRNAs and Their mRNA Targets in Th2 Cells.

We hypothesized that the discrepancy between miRNA expression patterns in the in vitro-generated and ex vivo Th2 cells reflected different stages of differentiation or maturation. Therefore we analyzed the temporal expression of the five candidate miRNAs in FACS-purified, Th2-commited IL4^gfp+ cells at early (day 2, 3, and 7) and late (day 10 and 14) stages of Th2 differentiation in vitro (SI Appendix, Fig. S12A). At day 2, the expression of miR-155 was elevated, but the expression of miR-146a, miR-15a, miR-20b, and miR-200c was down-regulated relative to naive T cells (SI Appendix, Fig. S12B). By day 7, miR-155 declined, but other miRNAs increased, peaking at day 10. Th2-associated genes (Gata3, Stat6, Il4, Il5, and Il13) were prominent from day 2 onwards. Concomitantly, several predicted targets of miR-155 (Sgk3, Il6r, Rictor, and S1pr1), miR-15a (Tia1), miR-146a (Itch, Stat1, and Smad4), and miR-20b (Egr2, Lif, Rorα, and Tnfaip3) had an inverse expression pattern at several time points (SI Appendix, Fig. S12B), supporting a functional interaction. Focusing on miR-155 and miR-146a, we also observed a temporal relationship between miRNA and mRNA target expression in purified ex vivo Th2 cells from the inflammatory site [airspaces, obtained by bronchoalveolar lavage (BAL)] and local lung-draining lymph nodes (tLN)] of mice with HDM-induced airway inflammation. Higher relative levels of miR-155 in the tLN correlated with lower S1pr1 and Rictor levels relative to Th2 cells from the BAL, whereas higher miR-146a in BAL Th2 cells correlated with lower Stat1 and Itch levels than found in tLN Th2 cells (SI Appendix, Fig. S12C).

To test formally whether miR-155 or miR-146a regulate their predicted targets in Th2 cells, we transfected FACS-purified 7-d polarized IL4^gfp+ Th2 cells (Fig. 2A) either with miR-155 hairpin inhibitors to reduce the elevated levels of miR-155 or with miR-146a miRNA mimics to increase the down-regulated levels of miR-146a (SI Appendix, Fig. S12A). miR-155 inhibitors reduced miR-155 expression without compromising cell viability (Fig. 2B) and resulted in elevated S1pr1 and Rictor expression (Fig. 2C). Furthermore, miR-155 inhibitors also reduced IL-13 and IL-5 protein secretion from Th2 cells (Fig. 2E), suggesting that miR-155 contributes to Th2 effector function. miR-146a mimicked elevated miR-146a expression and reduced Itch and Stat1 (Fig. 2D) and slightly increased Il5 and Il13 mRNA expression (Fig. 2 E and F) but did not impact IL-5 or IL-13 secretion significantly. This discrepancy in mRNA and protein secretion may be caused by the timing of miRNA treatment and differential impact on translation and mRNA decay (47). Taken together, these data reveal the dynamic expression pattern of several miRNAs and their mRNA targets in vitro and from different tissues ex vivo and suggest that miR-155 and miR-146a promote and regulate Th2 cells, respectively.

Fig. 2.

miR-155 and miR-146a regulate discrete targets in differentiated Th2 cells. (A) In vitro-generated IL4^gfp+ Th2 cells were FACS purified at day 7 of culture in vitro and were transfected with miR-155 short hairpin inhibitors or miR-146a mimics (100 nM) to reverse the expression profile observed at day 7. (B) Cell viability at day 10 of culture in vitro, determined by AlamarBlue fluorescence. (C) Expression of miR-155 and miR-155 target genes at day 10, expressed relative to mock-treated cells. (D) Expression of miR-146a and miR-146a–target genes at day 10, expressed relative to mock-treated cells. (E) IL-13 secretion (Left) and Il13 mRNA (Right) at day 10. (F) IL-5 secretion (Left) and Il5 mRNA (Right) at day 10. Results from one of three independent experiments are shown.

T-Cell–Intrinsic miR-146a Regulates Th2-Mediated Immunity and Allergy.

miR-146a was regulated dynamically in Th2 cells in vitro (SI Appendix, Fig. S12A) but was elevated consistently in ex vivo Th2 cells (SI Appendix, Fig. S11F). To test formally whether miR-146a is required for Th2-mediated immunity in vivo, we generated T-cell chimeras using miR-146a–deficient bone marrow, restricting miR-146a deficiency to T cells (Fig. 3A). miR-146a has been implicated in Treg cells (16); however, in our T-cell chimeras a normal frequency of Treg and Th cells was observed (SI Appendix, Fig. S14B), without any signs of autoimmunity. Following HDM airway challenge, mice with miR-146a^−/− T cells had increased airway infiltrates, with more eosinophils and significantly more neutrophils (Fig. 3B). Elevated eosinophils and neutrophils were accompanied by elevated Il5, Il13, Il17a, and Ifnγ mRNA in the lung (Fig. 3C). Mice with miR-146a^−/− T cells also had elevated Muc5ac expression (Fig. 3C) and greater interstitial and per-vascular inflammation following HDM challenge (Fig. 3D), suggesting that T-cell–intrinsic miR-146a is required to regulate a polarized Th2 response. To determine the phenotype of HDM-elicited miR-146a^−/− T cells, we isolated CD4⁺CD44⁺ miR-146a^−/− and CD4⁺CD44⁺ miR-146a^+/+ T cells from HDM-allergic mice. As predicted, miR-146a^−/− T cells had elevated miR-146a–targeted genes, i.e., Itch, Smad4, and Stat1, relative to their miR-146a–sufficient counterparts (Fig. 3E), again indicating that these genes are miR-146a targets and suggesting that these dysregulated miR-146a targets may contribute to the increased inflammation.

Fig. 3.

T-cell–intrinsic miR-146a regulates the phenotype and magnitude of Th2-driven immunity and inflammation. (A) Schematic representation of the generation of miR-146a mixed T-cell bone marrow chimeric mice. (B) Total number (Left) and composition (Center and Right) of BAL cells following HDM challenge. (C) Expression of Il5, Il13, Il17a, Ifnγ, and Muc5a/c in the lung of HDM-challenged mice. (D) H&E-stained lung of HDM-challenged mice. (E) Expression of miR-146a target genes Itch, Smad4, and Stat1 in WT and miR-146a^−/− CD4⁺CD44⁺ T cells from the lungs of HDM-challenged mice, expressed relative to WT T cells. (F) (Left) Total T. muris worm counts in the colon and large intestine on day 27. (Center and Right) Frequency of IL-17⁺ and IL-13⁺ CD4⁺ T cells in the local lymph nodes of mice infected with T. muris. (G) Frequency of IL-5⁺, IFN-γ⁺, and IL-17⁺CD4⁺ T cells in the local lymph nodes of mice infected with H. polygyrus. (H) Mucus staining (AB-PAS) of small intestine of mice infected with H. polygyrus. (Magnification: 20×.) Five mice per group were used; results of one of three to five experiments are shown. *P < 0.05, using a nonparametric Mann–Whitney test.

Unlike H. polygyrus, expulsion of the intestinal whip worm Trichuris muris is critically dependent on a highly polarized Th2 response (48), and a mixed Th1/2/17 response leads to chronic infection (49). Therefore we tested whether mice with miR-146a^−/− T cells could mount the polarized Th2 response required for proficient antihelminth immunity. In line with observations made in the HDM-allergy model, mice with miR-146a–deficient T cells had a compromised Th2 response following infection with T. muris; reduced IL-13⁺ but elevated IL-17A⁺ T cells resulted in significantly more worms present in the cecum (Fig. 3F). Similarly, mice with miR-146a^−/− T cells had elevated IFN-γ⁺ and IL-17A⁺ and compromised IL-5⁺ CD4⁺ T cells following infection with H. polygyrus (Fig. 3G), resulting in greater intramuscular inflammation and mucus secretion (Fig. 3H). In summary, after HDM challenge or helminth infection the deletion of miR-146a in T cells led to a mixed Th1/Th2/Th17 response, suggesting that miR-146a regulates the polarized differentiation of cells and, importantly, regulates the differentiation of Th1 and Th17 cells in otherwise Th2-dominated environments.

T-Cell–Intrinsic miR-155 Is Required for Th2-Mediated Immunity and Allergy.

miR-155 was elevated in whole-lung tissue from HDM-allergic mice (Fig. 4A) and also was elevated in HDM-elicited and in vitro-generated Th2 cells (SI Appendix, Fig. S11F). Therefore we tested the function of miR-155 in vivo using miR-155^−/− mice and observed dramatically reduced airway inflammation, with reduced eosinophilia (Fig. 4B) and IL-13 production (Fig. 4C). Consequently, IL-13–regulated Gob5 expression (Fig. 4D) and airway mucus production (Fig. 4E) were reduced in miR-155^−/− mice, indicating that miR-155 is essential for Th2-mediated airway allergy. miR-155 also was elevated in the intestinal tissue of H. polygyrus-infected mice (Fig. 4F), specifically within the intestinal lesions around larvae (Fig. 4G), and in H. polygyrus-elicited Th2 cells (SI Appendix, Fig. S11F). In contrast to miR-155–sufficient mice, miR-155^−/− mice were completely susceptible to a challenge infection with H. polygyrus (Fig. 4H) and failed to develop Th2-dependent immunity (IL-13 and IL-5) (Fig. 4I) with reduced goblet cell hyperplasia (Fig. 4J). miR-155^−/− mice were fully capable of mounting a protective Th1 response following blood-stage P. chabaudi infection, indicating that miR-155 is not required for a proficient Th1 response (SI Appendix, Fig. S15). Together, these data indicate that miR-155 is critical for mucosal type-2 immunity in the lung after HDM challenge and in the gut after H. polygyrus infection but is not required for tissue Th1 responses after Plasmodium infection.

Fig. 4.

T-cell–intrinsic miR-155 is required for Th2-dependent antihelminth immunity and Th2-driven airway inflammation. (A) Expression of miR-155 in the lung of PBS- or HDM-challenged mice. (B) Total number (Left) and composition (Right) of cells recovered by BAL from the airways of HDM-challenged mice. (C) IL-13 secretion from HDM-restimulated tLN cells. (D) Expression of Gob5 in HDM-challenged mice. (E) Mucus staining (AB-PAS) of HDM-challenged lungs at 2×, 5×, and 10× magnification. (F) Expression of miR-155 in the small intestine of H. polygyrus-infected mice (day 14) relative to naive mice. (G) FISH showing the presence of miR-155 in gut tissue surrounding H. polygyrus larvae. (H) Total worm burden of mice following drug cure and challenge infection (H.p. 2°). (I) Frequency of IL-13⁺CD4⁺ T cells in local draining lymph nodes of H. polygyrus-infected mice. (J) Mucus staining (AB-PAS) of small intestine following H.p. 2° infection. (K) Schematic representation of the generation of miR-155 mixed T-cell bone marrow chimeric mice. (L) Splenic CD4⁺ T-cell numbers. (M and N) Total BAL cell numbers (M) and composition (N) following HDM challenge of chimeric mice. (O) IL-13 protein levels in culture supernatants of restimulated thoracic lymph nodes. (P) Expression of Il5, Il13, and Gob5 in lungs of chimeric mice following HDM challenge. (Q) Mucus staining (AB-PAS) of HDM-challenged lungs. (R) Total worm burden of mice following drug cure and challenge infection (H.p. 2°). (S) Mucus staining (AB-PAS) of small intestine following H.p. 2° infection. (T) Expression of S1pr1 and Rictor in WT and miR-155^−/− CD4⁺ T cells isolated from H. polygyrus-infected mice. Five mice per group were used. Results of one of three to five experiments are shown. *P < 0.05, using a nonparametric Mann–Whitney test.

To test whether T-cell–intrinsic miR-155 is required for type-2 immunity, we generated T-cell chimeras restricting miR-155 deficiency to T cells (Fig. 4K), similar to the miR-146a studies described above (Fig. 3). Despite comparable T-cell chimerism (Fig. 4L) without any appreciable change in baseline T-cell populations (SI Appendix, Fig. S14), miR-155^−/− T cells failed to orchestrate HDM-induced airway inflammation with reduced airway infiltrates (Fig. 4M), eosinophilia (Fig. 4N), and IL-13 production in the lung (Fig. 4O). Mice with miR-155^−/− T cells also had reduced il5, il13, and Gob5 mRNA in the lung (Fig. 4P) and reduced goblet cell hyperplasia, phenocopying complete miR-155^−/− mice (Fig. 4 A–E). T-cell–intrinsic miR-155 also was required for fully proficient Th2-dependent immunity in the gut, because mice with miR-155^−/− T cells had compromised worm expulsion (Fig. 4R) and goblet cell hyperplasia (Fig. 4S) after H.p. 2° infection [albeit to a much lesser extent than complete miR-155^−/− mice (Fig. 4B)], indicating that non–T-cell–expressed miR-155 also contributes significantly to type-2 immunity. Finally, miR-155^−/− T cells isolated from helminth-infected mice had elevated miR-155 targets, S1pr1 and Rictor, relative to miR-155–sufficient T cells (Fig. 4T), suggesting that dysregulated S1p–S1pr1 interactions (45) or Rictor-associated metabolic pathways (50) in miR-155^−/− T cells may contribute to the compromised Th2 response.

Directly Targeting miR-155 in Th2 Cells Prevents Th2-Mediated Airway Allergy.

Following the observation that miR-155–deficient mice and more specifically mice with miR-155–deficient T cells had a reduced capacity to mount Th2 responses in vivo, we next tested whether miR-155 could be targeted specifically within differentiated Th2 cells and whether such targeting would compromise Th2 effector function. For these tests, we polarized and FACS purified OVA-reactive Il4^gfp+ Th2 cells using CD45.2 C57BL/6 OTII mice backcrossed onto the Il4^gfp background (Fig. 5A). We then knocked down miR-155 in OTII Th2 cells using miR-155 hairpin inhibitors and adoptively transferred these cells into congenic CD45.1 C57BL/6 mice (Fig. 5A). Targeting miR-155 in Th2 cells reduced the capacity of Th2 cells to orchestrate airway inflammation with reduced airway infiltrates (Fig. 5B), airway eosinophilia (Fig. 5C), and IL-13 production (Fig. 5D), thus confirming that miR-155 is required for Th2 effector function in vivo. miR-155–sufficient Th2 cells caused peribronchial inflammation with airway mucus production (Fig. 5E) after OVA challenge. However, OTII Th2 cells with reduced miR-155 caused much less tissue inflammation and mucus secretion (Fig. 5E), with reduced Gob5 and Muc5ac expression in the lung tissue. Similarly, the IL-4– and IL-13–regulated genes Fizz-1 and Arg-1 were reduced significantly when miR-155 was targeted in Th2 cells (Fig. 5F).

Fig. 5.

Targeting miR-155 in Th2 cells prevents Th2-mediated airway allergy. (A) Schematic representation of the adoptive transfer system used. Naive CD4 cells from IL-4^gfpCD45.2 C57BL/6 OTII mice were polarized under Th2 conditions, as described in Materials and Methods, and were FACS sorted on IL4^gfp. Cells then were mock transfected (control) or transfected with 100 nm of miR-155 short hairpin inhibitors before 10⁶ cells were adoptively transferred i.v. into recipient CD45.1 mice. Recipient mice were given OVA i.t. as described in Materials and Methods. Adoptively transferred cells could be found in the lung and local lymph nodes of recipient mice. (B and C) Total BAL cells (B) and BAL eosinophils (C) were enumerated in BAL fluid of mice 1 d after the last OVA challenge. (D) OVA-induced IL-13 was measured in OVA-stimulated local lymph nodes. (E) H&E-stained (Upper row) and AB-PAS–stained (Lower row) lung sections. (Magnification: 20×.) (F) Gene expression in whole-lung tissue following OVA challenge, expressed relative to OVA-challenged mice that did not receive Th2 cells.

miR-155 Regulates S1pr1 in Th2 Cells, Preventing Th2-Mediated Airway Allergy.

Ex vivo and in vitro-generated Th2 cells had an inverse relationship between miR-155 and several mRNA targets, including S1pr1 (SI Appendix, Fig. S12). Similarly, miR-155 inhibition in WT Th2 cells dysregulated S1pr1 expression (Fig. 2), suggesting that miR-155 regulates S1pr1. We confirmed that miR-155 regulates S1pr1 directly using miR-155 miRNA mimics and a dual luciferase reporter assay with the 3′ UTR of S1pr1 (Fig. 6A). Furthermore, unlike WT Th2 cells which down-regulated S1pr1 upon activation in vitro, miR-155^−/− Th2 cells failed to down-regulate S1pr1 following activation (Fig. 6 B and C). These observations all indicate that miR-155 regulates S1pr1 in Th2 cells. To test whether miR-155–regulated S1pr1 contributed to the compromised Th2 responses in vivo, we treated OVA-reactive Th2 cells in vitro with miR-155 inhibitors or with siRNA directed against S1pr1 (SI Appendix, Fig. S16) or with both miR-155 inhibitors and S1pr1 siRNA. Cell viability was not compromised (Fig. 6D) for up to 48 h after treatment. Inhibition of miR-155 in Th2 cells (Fig. 6E) led to up-regulated S1pr1 (Fig. 6F), as observed earlier (Fig. 2). S1pr1 siRNA combined with miR-155 inhibition reduced the elevated levels of S1pr1 (Fig. 6F). We used this strategy to test whether miR-155–regulated S1pr1 is an important downstream target of miR-155 contributing to the reduced airway inflammation that we observed in miR-155^−/− mice (Fig. 4) and more specifically in miR-155–depleted Th2 cells (Fig. 5). We adoptively transferred OVA-reactive Th2 cells into WT mice following inhibition of either miR-155 or S1pr1 siRNA or inhibition of both miR-155 and S1pr1 siRNA. Mice were challenged subsequently by intratracheal (i.t.) delivery of OVA to reactivate OTII cells in the lower airways. Mice given miR-155–inhibited Th2 cells had significantly fewer airway eosinophils (Fig. 6G) and less mucus production (Fig. 6 H and I) after OVA challenge than mice treated with control Th2 cells. However, treatment with S1pr1 siRNA and miR-155 inhibitors significantly reversed the inhibition of airway disease, partially restoring airway eosinophilia, goblet cell hyperplasia, and mucus hypersecretion after OVA challenge. Using congenic and T-cell receptor (TCR) (Vβ5 and Vα2) markers to track adoptively transferred OTII cells, we observed that miR-155 inhibition significantly reduced the recruitment of OTII Th2 cells into the BAL fluid and lungs but not into the local-draining lymph nodes (Fig. 6J). Compromised recruitment of Th2 cells to the lungs again was partially, but significantly, reversed when miR-155 inhibition was combined with S1pr1 siRNA (Fig. 6J), indicating that miR-155–regulated S1pr1 contributes significantly to Th2 cell migration and Th2-mediated airway disease.

Fig. 6.

miR-155 regulates S1pr1 in Th2 cells, preventing Th2-mediated airway allergy. (A) Jurkat T cells were transfected with dual luciferase reporter clones containing 1 nM of either the 3′ UTR of S1pr1 or a control 3′ UTR. Cells also were cotransfected with either miR-155 mimics (100 nM) or a scrambled miRNA control (−). Relative fluorescent units (RFU) were determined after 24 h. (B and C) Seven-day Th2 cells were generated from WT or mir-155^−/− mice and left to rest for a further 48 h. Cells then were stimulated with plate-bound anti-CD3 and anti-CD28 for 12 h before miR-155 and S1pr1 levels were measured by qRT-PCR. (D–F) Naive CD4⁺ cells from IL-4^gfpCD45.2 C57BL/6 OTII mice were polarized under Th2 conditions, as described in Materials and Methods, and were FACS purified using IL4^gfp. Th2 cells then were transfected with either miR-155 inhibitors (+; 100 nM) or scrambled control miRNA (c; 1 nM) and with S1pr1 siRNA (+; 1 nM) or control siRNA (100 nM), as indicated. Cells were cultured for 48 h to determine the impact of transfection on cell viability (D) or for 24 h to determine miR-155 (E) or S1pr1 (F) expression. (G–J) Th2 (Il4^gfp+CD45.2 C57BL/6 OTII) cells transfected with either miR-155 inhibitors (+; 100 nM) or scrambled control miRNA (c; 1 nM) and with S1pr1 siRNA (+;1 nM) or control siRNA (c; 100 nM), as indicated, were adoptively transferred into the tail veil of WT mice (day 1), 1 d after an intratracheal delivery of OVA (day −1). Mice received two further OVA airway challenges on day 2 and day 4. Airway pathology was assessed on day 5. (G) Airway eosinophilia was determined in BAL fluid. (H and I) Lungs were stained with AB-PAS to determine airway goblet cell and mucus secretion (H), and results were quantified using qRT-PCR (I). (J) Single-cell suspensions of lungs and local lung-draining lymph nodes were stained for congenic (CD45.2) and T-cell receptor markers (Vβ5 and Vα2) to identify Th2 OTII cells in the BAL, lung, and lymph nodes.

In summary, these data indicate that T-cell–intrinsic miR-155 is required for Th2-mediated immunity. Mechanistically, miR-155 targeted several genes in Th2 cells, including S1pr1, which contributed significantly to Th2-mediated airway disease. Taken together, these data suggest that targeting miR-155 could alleviate Th2-mediated airway allergy, identifying miR-155 as a putative therapeutic target to treat allergic asthma.

Discussion

Here we present a systematic and comprehensive analysis of miRNAs in purified reporter-positive Th1, Th2, Th17, and Treg cells in vitro and ex vivo from five in vivo disease models. Applying a subtractive comparative analysis, we identified many putative miRNAs and their mRNA targets in pathogenic, protective, and in vitro-generated Th2 cells. These analyses generated two candidate miRNAs, miR-155 and miR-146a, which were expressed dynamically in Th2 cells and targeted a suite of previously unidentified genes. Contrary to in vitro predictions, we provide in vitro and in vivo experimental evidence supporting a T-cell–intrinsic role for miR-155 and miR-146a in promoting and regulating Th2 immunity, respectively. Mechanistically, miR-155–regulated S1pr1 in activated Th2 cells contributes to Th2-mediated airway inflammation.

Purified reporter-positive cells gave significantly greater resolution and contrast to the transcriptome of T-cell subsets as compared with bulk, whole-well analysis. This approach identified several previously reported miRNAs (19) and many more previously unidentified miRNAs in all Th subsets in vitro and ex vivo. Strikingly, in vitro-generated cells had little transcriptional resemblance to ex vivo-isolated cells, which may be influenced by tissue- (gut or lung) or stimuli- (allergen or helminth) specific signals. Thus, therapies targeting Th2 or other T cells may require disease-specific approaches. Despite such heterogeneity, this approach also identified a core set of 82 Th2-associated genes (fivefold change, 5.14%) in common, including genes involved in IL-5 signaling and immune cell trafficking [Egln3, IL1r2 (38), Il2, IL1rl1 (Il33r), Ccl1, Rgs1, and Socs2], and metabolic and environmental sensing (Cst7, stx11, Ahr, Hsp70); IL-4 signaling [Ctla2, Nfil3 (51)] and genes that regulate IL-4, IL-10, and IL-2 secretion [Tnfsf14 (Light), Nfil3, and Socs2 (52)].

miR-146a regulates many functions in innate and adaptive immune cells (53), with miR-146a^−/− mice suffering from a myeloproliferative disorder (54). In vitro-differentiated Th2 cells had decreased miR-146a at day 7, after an initial spike at day 2 (SI Appendix, Fig. S12), similar to a previous report (55). However, all ex vivo Th2 cells had elevated miR-146a, again highlighting the disparity in miRNA expression between in vitro and ex vivo Th2 cells.

Importantly, in vivo we observed a regulatory role for T-cell–intrinsic miR-146a, with miR-146a^−/− T cells giving rise to a mixed and more aggressive type-1/2/17 response following allergen challenge or helminth infection, an observation in line with previous studies (15, 56). Of note, when miR-146a deficiency was restricted to Treg cells, but not Th cells, miR-146a was required for Treg function (16). In our experiments, mice with miR-146a^−/− T cells had a normal frequency of Treg cells and did not display any autoimmunity-associated pathology before infection or allergen challenge. Our in vivo data therefore support a Th cell-intrinsic role for miR-146a, similar to other reports (15), rather than a Treg defect (16).

Several miR-146a targets were inversely expressed with miR-146a in Th2 cells, including Irak2, Traf6 (57), and Stat1 (16). We also identified Itch, an E3 ubiquitin ligase, as a common target of miR-146a in all ex vivo Th2 cells. Itch also was inversely expressed with miR-146a at day 2 and day 7 of Th2 polarization in vitro (SI Appendix, Fig. S12) and was elevated in miR-146a^−/− T cells ex vivo. Itch regulates cytokine production and activation of Th2 cells (39) and is required for Th2 tolerance (58). Here, we propose an additional mechanistic pathway of miR-146a–mediated regulation of Itch, preventing an aggressive Th2 and Th1/17-mediated response. Elevated miR-146a has been observed in T cells from patients with arthritis (59) and T-cell leukemia (60), and polymorphisms in miR-146a are associated with asthma (61). However, as we report here, elevated miR-146a may be regulating rather than contributing to T-cell malignancies and should be therapeutically targeted with caution.

As mentioned above, we observed dynamic miRNA expression in Th2 cells in vitro. These observations, combined with little overlap between in vitro and ex vivo cells, indicate that caution must be taken when translating in vitro miRNA observations to in vivo settings. Indeed, it has been reported that miR-155 regulates Th2 cell differentiation in vitro, with slightly enhanced Th2 differentiation in miR-155^−/− T cells in vitro (34, 62). These observations predicted that miR-155 functions as a negative regulator of Th2-differentiation and Th2 immunity. However, as we report here, in vitro observations of miR-155 in T cells did not predict in vivo function, because miR-155 was required for type-2 responses, and, more specifically, T-cell–intrinsic miR-155 was essential for competent type-2 immunity. Thus, contrary to in vitro predictions, specifically targeting miR-155 may block rather than exacerbate the progression of T-cell–mediated airway allergy and asthma.

Although miR-155 regulates both innate and adaptive responses (63), miR-155 may be a promising target for other hyperinflammatory T-cell–mediated diseases including colitis (64) and autoimmunity (65), with the potential caveat that intestinal Th1/17-mediated immunosurveillance may be compromised (64). miR-155 also is required for optimal Treg proliferation in vivo (66), suggesting that miR-155 may function as a broad regulator of T-cell expansion. This notion is supported by transgenic miR-155 overexpression studies, which led to aggressive and disseminated lymphomas (67), underlining the oncogenic properties of dysregulated miR-155 (68). However, miR-155^−/− mice could mount a sufficient and protective splenic Th1 response after Plasmodium infection (SI Appendix, Fig. S15), suggesting that miR-155 may critically regulate homing, migration, or mucosal T-cell responses, irrespective of T-cell phenotype.

Allergen-exposed peripheral blood mononuclear cells from patients with atopic dermatitis also up-regulated miR-155 (69), which correlated with reduced CTLA-4 and increased proliferation. Whether a miR-155–CTLA-4 axis is responsible for the hyperproliferative role of miR-155 is unclear. We identified several putative targets of miR-155, including the metabolic regulators Sgk3 (42) and Rictor (43) and also Il6r, S1pr1, and Tia-1. Although Rictor is critical for T-cell development (70) and Th2 differentiation in vitro (50), we observed a down-regulation of Rictor in Th2 cells in vitro with a concomitant increase in miR-155. In line with this observation, Rictor was elevated in ex vivo miR-155^−/− T cells from helminth-infected mice (Fig. 4T). These data suggest that low, but not absent, levels of Rictor are sufficient for Th2 cell differentiation and that miR-155–regulated Rictor may be required for proficient Th2 responses.

Following activation, lymphocyte egress from lymphoid tissue requires the down-regulation of S1pr1 (45). We observed a rapid down-regulation of S1pr1 in activated Th2 cells in vitro with a concomitant increase in miR-155 (SI Appendix, Fig. S12), suggesting that miR-155 targets S1pr1. Indeed, miR-155^−/− T cells isolated ex vivo had elevated S1pr1 (Fig. 4), further supporting the notion that miR-155–regulates S1pr1. In vitro, dual luciferase reporter assays confirmed that miR-155 directly regulates S1pr1, whereas in vivo studies using purified Th2 cells confirmed that, although miR-155 targets several genes in Th2 cells, miR-155–regulated S1pr1 is required for Th2-mediated airway inflammation, possibly via controlling Th2 migration to the lung. These data identify a previously unknown function of miR-155 in regulating Th2 cell migration through control of S1pr1 expression and provide an miRNA-mediated upstream mechanistic pathway explaining the importance of S1pr1 in Th2 cell biology (71, 72).

In conclusion, this study provides a comprehensive analysis of miRNA expression in highly purified reporter-positive T cells, highlighting the disparities between in vitro and ex vivo T cells, and functionally demonstrates the opposing roles of miR-155 and miR-146a in Th2-mediated allergic and helminth-induced immunity. The miR-155–mediated pathways regulating Th2 cell activation and egress and fulminant type-2 immunity suggest that targeting miR-155, but not miR-146a, may help shape new strategies targeting specific miRNAs to treat allergic asthma and other Th2-mediated diseases.

Materials and Methods

Animals.

C57BL/6, 129S8.B6 (F1), C57BL/6.Tcra^{tm1 Phi}, Rag2^−/−, Il4^gfp (IL4/GFP-enhanced transcript; 4get) (73), Il9^CreR26^eyfp, Il17a^CreR26^FP635 [kindly provided by Brigitta Stockinger, Medical Research Council, National Institute for Medical Research (NIMR), London], Ifnγ^eyfp (YETI), Foxp3^rfp, and miR-155^−/− and miR-155^+/+ littermates were bred and kept in the specific pathogen-free facility at the NIMR. miR-146a^−/− bone marrow was kindly provided by David Baltimore (Braun Laboratories, California Institute of Technology, Pasadena, CA). Mice were randomly separated into cages containing five mice before the experimental procedure. All animal experiments were approved by local and national ethical review panels at NIMR and were carried out under UK Home Office regulations (Project License no. 80/2506). All mice were 6–8 wk old at the onset of experiments. A minimum of five mice per group was used for each experiment, unless otherwise indicated.

Generation of Mixed T-Cell Bone Marrow Chimeric Mice.

Six- to eight-week-old mice were sublethally irradiated (2×, 450 rad) followed by adoptive transfer of 2–5 × 10⁶ bone marrow cells (20% bone marrow from miR-146a^−/−, miR-155^−/−, or WT donor mice with 80% bone marrow from C57BL/6.Tcra^{tm1 Phi} mice). Mice were given water ad libitum supplemented with Baytril (Bayer) for 3 wk after radiation.

CD4 T-Cell Isolation and Flow Cytometry.

CD4⁺ T cells were isolated from tissues by mechanical disruption followed by red blood cell lysis and Percoll (Sigma Aldrich) gradient separation followed by positive or negative cell enrichment using magnetic beads (L3T4; Miltenyi Biotec). Cells then were stained with anti-mouse CD4 (clone RM4-5), CD44 (clone IM7), CD25 (clone PC61), TCR-β (clone H57-597), Vβ5 (clone MR9-4), and Vα2 (clone B20.1). Dead cells were excluded from sorting and analysis with propidium iodide or Live/Dead stain (Invitrogen). For intracellular cytokine staining, anti–IFN-γ (clone XMG1.2), IL-4 (clone 11B11), IL-5 (clone TRFK5), IL-13 (clone eBio 13A), IL-17 (clone TC11-18H10), and anti-Foxp3 (clone FKJ-16s) (BD and eBioscience) were used after 6 h of stimulation with PMA (50 ng/mL), ionomycin (1 μg/mL), and Golgistop/Golgi plug (10 μg/mL) (BD Biosciences) with Fix/Perm buffer (eBioscience) and Perm/Wash buffer (eBioscience) used according to the manufacturers’ instructions. Anti-CD16/32 was used in all staining. Cells were acquired using a BD LSRII and analyzed with FlowJo software (Treestar). For cell sorting, BD Influx, FACSAria (BD), or MoFlo XDP (Beckman Coulter) sorters were used; the purity of sorted cells was >95%.

In Vitro Th Cell Polarization.

T cells were polarized under the following conditions: Th1: IL-12 (10 ng/mL), anti–IL-4 (10 ug/mL); Th2: IL-4 (10 ng/mL), IL-2 (5 ng/mL), anti–IFN-γ (10 μg/mL); Th17: IL-6 (10 ng/mL), TGF-β (1 ng/mL), IL-1β (10 ng/mL), 6-formylin-dolo (3,2-b) carbazole (250 nm), anti–IL-4, anti–IFN-γ, anti–IL-2 (10 μg/mL); Th9: IL-6 (10 ng/mL), IL-4 (10 ng/mL), TGF-β (5 ng/mL), IL-1β (10 ng/mL), anti–IFN-γ (10 μg/mL); iTreg: TGF-β (5 ng/mL), anti–IL-4, anti–IFN-γ (10 μg/mL). Bulk or FACS purified reporter-positive in vitro Th cells were harvested on day 7, or as indicated. All recombinant cytokines and antibodies were purchased from R&D Research, BioXcell, or Peprotech.

Airway Allergy, EAE, and Infection Models.

H. polygyrus.

Mice were infected with 200 H. polygyrus infective larvae (stage 3) by oral gavage. Primary (H.p. 1°) Il4^gfp+CD4⁺ T cells were FACS sorted on day 14 from mesenteric lymph nodes. Secondary (H.p. 2°) IL4^gfp+ CD4 T cells were recovered from mice on day 42, following drug cure (day 14) and challenge infection (day 28). Th2-mediated immunity to H. polygyrus was determined 14 d after secondary infection, with luminal worms counted in the small intestine.

T. muris.

Mice were infected with 200 T. muris eggs (kindly provided by Richard Grencis, University of Manchester, Manchester, United Kingdom), Worms in the cecum and large intestine were counted on day 27 postinfection.

HDM-induced airway allergy.

For HDM-induced airway inflammation, mice were sensitized by i.p injection of 100 μg HDM (Greer) with 2 mg of Imject Alum (Pearce) followed by i.t. challenge with 100 μg HDM in PBS on day 21 and day 24. Il4^gfp+CD4⁺ T cells were purified from the lung and local lymph nodes by FACS sorting on day 25. Airway infiltrates were determined on stained cytospins of BAL recoveries, performed with 1.5 mL of cold PBS.

OTII-Th2–mediated airway allergy.

For OVA-induced OTII reactivation in the airways, 10⁶ IL-4^gfp+ OTII cells were FACS purified following in vitro Th2 differentiation and were mock transfected or were transfected with 100 nm of miR-155 short hairpin inhibitors, S1pr1 siRNA, or control scrambled miRNA or siRNA, as indicated, and were adoptively transferred into the tail vein of recipient mice. Recipient mice were given an intratracheal delivery of OVA (Sigma Grade V), 1 d before cell transfer (day −1) and 1 and 3 d after cell transfer (day 2 and day 4). Mice were analyzed for evidence of Th2-mediated disease on day 5.

P. chabaudi.

Th1 cells were isolated from Ifnγ^yfp mice that had received 10⁵ P. chabaudi-infected red blood cells i.p. Ifnγ^yfp+CD4⁺ T cells were FACS purified from spleens on day 7 postinfection. In experiments with miR-155^−/− mice, animals were infected with 10⁵ P. chabaudi-infected red blood cells and analyzed for their ability to mount protective Th1 responses on day 8–9 postinfection.

EAE.

Il17a^CreRosa26^FP635+ CD4⁺ T cells were FACS purified from the spinal cord and lymph nodes of mice with EAE on days 9–12 as described previously (74). nTregs (CD4⁺CD25^hiFoxp3^rfp+) were purified from the spleen of naive Foxp3^rfp mice. For histopathology, lung or gut tissue was fixed in 10% neutral-buffered formalin [4% (wt/vol) formaldehyde] for at least 24 h before being transferred to 70% (wt/vol) ethanol. Tissues were stained with Alcian blue periodic acid-Schiff (AB-PAS) stain and H&E stain for detection of mucus production and leukocyte infiltration, respectively. For FISH, tissue was first perfused with 4% paraformaldehyde (PFA) and stored in 30% (wt/vol) sucrose/PBS solution at 4 °C overnight before snap freezing and sectioning (10 μm). Tissue was refixed with 4% (wt/vol) formaldehyde and treated with proteinase K before incubation with digoxigenin-labeled LNA (Exiqon) miRNA probes (miR-155 sequence ACCCCTATCACAATTAGCATTAA; control sequence, GTGTAACACGTCTATACGCCCA) in hybridization buffer.

Transfection and Dual Luciferase Reporter Assays.

T cells were washed, counted, and resuspended in Nucleofector solution (Lonza) with supplements, according to the manufacturer’s recommendations. miRNA mimics or inhibitors (100 nM) (Thermo Scientific, Dharmacon) or S1pr1 siRNA or control siRNA were added to cell suspension, and cells were plated at a density of 2–3 × 10⁵ cells per well in a 96-well Nucleocuvette Plate. Cells were transfected in a 96-well-Shuttle System and left to rest for 3–20 h at 37 °C before analysis or adoptive transfer, as indicated in figure legends. For dual luciferase reporter assays, Jurkat T cells were transfected with firefly/Renilla Duo-Luciferase reporter clones containing 1 nM of either the 3′ UTR of S1pr1 or a control 3′ UTR, using the Nucleofector system (Genecopeia), as above, according to the manufacturer’s instructions. Cells were cotransfected with 100 nM of either miR-155 mimics or a scrambled miRNA control, as indicated. Relative fluorescent units were determined 24 h later.

RNA, Quantitative RT-PCR, and Microarray.

RNA was isolated from tissues and cells using RNAeasy mini-spin columns (Qiagen) according to the manufacturer’s instructions. cDNA was generated from 5 ng of total RNA using the WT-Ovation Pico system (version 1) RNA Amplification System followed by double-stranded cDNA synthesis using the WT-Ovation Exon Module. cDNA quality was determined by the Systems Biology Unit at the NIMR using an Agilent BioAnalyzer and through hybridization performance on Affymetrix GeneChip mouse Genome 430A 2.0 microarray (Affymetrix) and miRNA 3.0 arrays (Affymetrix). Microarray data were quantile-normalized and analyzed using GeneSpring software (Agilent). Differentially expressed genes were determined using ANOVA and t tests. Genes with false discovery rate-corrected P values <0.1 and fold change values ≥1.5 were considered significant, as indicated in figure legends. Three to five biological replicates of each T-cell subset were used. Four-way comparative analyses, expression-pairing analyses, target predictions (miRecords, Tarbase, Targetscan), and target abundance were determined using Ingenuity Pathways Analysis (Ingenuity Systems; www.ingenuity.com). For quantitative RT-PCR (qRT-PCR), RNA was reverse-transcribed using the miScript II RT Kit (Qiagen). Real-time RT-PCR was performed on an ABI Prism 7900HT Sequence Detection System (Applied Biosystems); relative quantities of mRNA or miRNAs were determined using SYBR Green PCR Master Mix (Applied Biosystems) and by the comparative threshold cycle method as described by Applied Biosystems for the ABI Prism 7700/7900HT Sequence Detection Systems. mRNA levels were normalized to hypoxanthine guanine phosphoribosyltransferase (HPRT), and miRNA levels were normalized to the small nucleolar RNA, RNU6B, and were expressed as a relative increase or decrease compared with levels in controls or relative to HPRT or RNU6b, as indicated.

ELISA.

Cytokines and IgE were measured by ELISA. Capture and biotinylated detection antibodies for IL-4, IL-5, IL-13, IFN-γ, IL-17A, and IgE were from R&D Systems. The concentration of analytes in the sample was determined from a serial-fold diluted standard curve with OD read at 405 nm in an ELISA reader (Tecan II Safire).

Statistical Analysis.

Datasets were compared by Mann–Whitney test or one-way ANOVA as specified in the figure legends using GraphPad Prism (V.5.0). Differences were considered significant at P ≤ 0.05.