Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2014 Jul 9;111(30):10933–10938. doi: 10.1073/pnas.1403510111

Intracellular Ca-carbonate biomineralization is widespread in cyanobacteria

Karim Benzerara a,1, Feriel Skouri-Panet a, Jinhua Li a, Céline Férard a, Muriel Gugger b, Thierry Laurent b, Estelle Couradeau a,c, Marie Ragon a,c, Julie Cosmidis a, Nicolas Menguy a, Isabel Margaret-Oliver a, Rosaluz Tavera d, Purificación López-García c, David Moreira c
PMCID: PMC4121779  PMID: 25009182

Significance

Cyanobacteria are known to promote the precipitation of Ca-carbonate minerals by the photosynthetic uptake of inorganic carbon. This process has resulted in the formation of carbonate deposits and a fossil record of importance for deciphering the evolution of cyanobacteria and their impact on the global carbon cycle. Though the mechanisms of cyanobacterial calcification remain poorly understood, this process is invariably thought of as extracellular and the indirect by-product of metabolic activity. Here, we show that contrary to common belief, several cyanobacterial species perform Ca-carbonate biomineralization intracellularly. We observed at least two phenotypes for intracellular biomineralization, one of which shows an original connection with cell division. These findings open new perspectives on the evolution of cyanobacterial calcification.

Keywords: calcification, amorphous calcium carbonate, polyphosphate

Abstract

Cyanobacteria have played a significant role in the formation of past and modern carbonate deposits at the surface of the Earth using a biomineralization process that has been almost systematically considered induced and extracellular. Recently, a deep-branching cyanobacterial species, Candidatus Gloeomargarita lithophora, was reported to form intracellular amorphous Ca-rich carbonates. However, the significance and diversity of the cyanobacteria in which intracellular biomineralization occurs remain unknown. Here, we searched for intracellular Ca-carbonate inclusions in 68 cyanobacterial strains distributed throughout the phylogenetic tree of cyanobacteria. We discovered that diverse unicellular cyanobacterial taxa form intracellular amorphous Ca-carbonates with at least two different distribution patterns, suggesting the existence of at least two distinct mechanisms of biomineralization: (i) one with Ca-carbonate inclusions scattered within the cell cytoplasm such as in Ca. G. lithophora, and (ii) another one observed in strains belonging to the Thermosynechococcus elongatus BP-1 lineage, in which Ca-carbonate inclusions lie at the cell poles. This pattern seems to be linked with the nucleation of the inclusions at the septum of the cells, showing an intricate and original connection between cell division and biomineralization. These findings indicate that intracellular Ca-carbonate biomineralization by cyanobacteria has been overlooked by past studies and open new perspectives on the mechanisms and the evolutionary history of intra- and extracellular Ca-carbonate biomineralization by cyanobacteria.


Cyanobacteria are a phylogenetically and ecologically diverse phylum of Gram-negative bacteria that have impacted the global cycle of carbon on the Earth for billions of years and induced the oxygenation of the atmosphere (1–3). By performing oxygenic photosynthesis—a unique capability that appeared only once in evolution—in this particular group of bacteria, cyanobacteria have contributed significantly to the primary production on the past and present Earth (4). Moreover, cyanobacteria have received great attention from geologists as major players in the formation of carbonate sedimentary deposits such as stromatolites (5, 6), the oldest ones formed by cyanobacteria possibly as old as 2.98 billion years (Ga) (7). Fossils of Ca-carbonate–encrusted cyanobacterial cells (calcimicrobes) have been looked for extensively. The temporal distribution of calcimicrobes in the geological record dating back as far as the early Proterozoic (∼2.5–2.3 Ga) (8) has been interpreted as the result of paleoenvironmental and/or evolutionary changes (9, 10). Despite the importance of carbonate biomineralization by cyanobacteria in the formation of calcimicrobes and sedimentary deposits, the involved mechanisms are still poorly understood (11, 12). Some authors have proposed that cyanobacterial calcification might be promoted by CO2-concentrating mechanisms (CCMs) that possibly developed in the late Proterozoic to accommodate photosynthetic carbon limitation under low CO2 fugacity (10). This model states that bicarbonates are actively imported into the cells, transformed to CO2 within carboxysomes for fixation by ribulose-1,5-bisphosphate carboxylase/oxygenase. The resulting alkalinity is transferred outside the cells, which raises the external pH and thus induces CaCO3 precipitation (13). Other authors have stressed the importance of cell-surface properties of some cyanobacteria for the nucleation of CaCO3 minerals and did not observe notable effects of photosynthesis on CaCO3 precipitation (14). In any case, precipitation of CaCO3 by cyanobacteria has been invariably considered a noncontrolled and extracellular process.

This paradigm has been questioned recently by the discovery of a new deep-branching cyanobacterial species, Candidatus Gloeomargarita lithophora, enriched from the hyperalkaline Lake Alchichica (Mexico) and forming amorphous carbonates intracellularly (15). However, many studies characterized the ultrastructure of cyanobacteria (16, 17) and explored their impact on calcification (11, 18, 19), but none of them reported the presence of intracellular carbonates. Here, we investigated whether intracellular carbonate biomineralization is restricted to one particular species and/or specific environmental condition or whether it exists in other diverse cyanobacteria; this is essential to assess the evolution of intracellular carbonate biomineralization and its significance at geological timescales. For this purpose, we screened 68 cyanobacterial strains scattered throughout the phylogenetic tree of cyanobacteria (Fig. 1) to search for intracellular carbonates.

Fig. 1.

Fig. 1.

Bayesian phylogenetic tree of 16S rRNA gene sequences of the cyanobacterial strains observed by electron microscopy. Strains forming intracellular Ca-carbonates are shown in color (green for those with Ca-carbonate inclusions at the cell poles and red for those with inclusions scattered in the cytoplasm). The tree is based on 1,292 conserved sites; numbers at branches are posterior probabilities (only those >0.75 are shown).

Results and Discussion

Sixty-eight strains of cyanobacteria were imaged by SEM using an angle-selective backscattered electron (AsB) detector, which provides a chemical contrast; their elemental composition was further analyzed by energy dispersive X-ray spectrometry (EDXS) coupled with SEM. Names of the strains, their geographic origin, and the culture medium in which they were cultured are provided in Table S1. Most of the strains were obtained from culture collections [notably, the Pasteur Culture Collection (PCC) of cyanobacteria], but we also studied a few other strains, in particular two strains that were isolated recently from microbialites from the alkaline Lake Alchichica in Mexico: Ca. G. lithophora (15) and a new species distantly related to Thermosynechococcus elongatus BP-1, which we have provisionally called Candidatus Synechococcus calcipolaris strain G9. Cyanobacteria have been classically grouped by subsections, defined on the basis of morphological and cell division features (20, 21). We covered all of the subsections, with 26 strains belonging to subsection I, 5 to subsection II, 23 to subsection III, 10 to subsection IV, and 4 to subsection V.

All but eight of the tested strains showed intracellular inclusions as detected by SEM with a size range from ∼100 to 800 nm in diameter (Table S1 and Fig. S1). Some strains contained numerous inclusions (e.g., PCC 73106, PCC 6308), whereas others had only one (PCC 7376) or two (PCC 7421) inclusions per cell. In some cases, these inclusions were preferentially located at the poles or showed alignments (PCC 7002, PCC 7429). These inclusions were in most cases composed of P as the major element with some Mg and K and sometimes Ca (Fig. S2). According to their size, chemical composition, and distribution patterns, they were interpreted as polyphosphate (PolyP) granules. In the past, PolyP granules have been identified by microscopy in many bacterial species, including some of the cyanobacterial strains analyzed in the present study (22, 23). Such granules have sometimes been named metachromatic granules or “volutin” (17) and constitute a storage form of P for the cells or as a source of energy under P-limited or stress conditions (24).

The most striking result of this systematic survey was the discovery of seven cyanobacterial strains forming spherical and poorly crystalline intracellular carbonates (Figs. 2–4 and Table S2) in addition to Ca. G. lithophora, which was recently described (15). These strains were further analyzed by scanning transmission electron microscopy (STEM) in the high-angular annular dark field (HAADF) mode, which provides a chemical contrast with a higher spatial resolution compared with SEM. All these strains formed Mg- and K-containing PolyP granules as described above, but they also contained P-free, Ca-rich inclusions measuring between 60 and 870 nm in diameter and appearing as amorphous by electron diffraction, that we interpreted as Ca-carbonates based also on X-ray absorption near-edge structure (XANES) spectroscopy analyses (Figs. S2 and S3). The presence of Ca-carbonate inclusions was not dependent on the medium in which the strains were grown: first, several strains without Ca-carbonate inclusions were grown in BG11 similarly to the strains forming intracellular Ca-carbonates. Moreover, Ca. G. lithophora D10 and Ca. S. calcipolaris G9 showed intracellular Ca-carbonate inclusions when grown in the different culture media (e.g., BG11o or ASNIII) used for the other PCC strains screened in the present study (Figs. S4 and S5).

Fig. 2.

Fig. 2.

Electron microscopy images of cyanobacteria forming intracellular carbonates scattered throughout the cells. (A and B) SEM images in AsB detection mode of Chroococcidiopsis thermalis PCC 7203. (B) A baeocyte filled with Ca-carbonate inclusions. (C) STEM-EDX map of a vegetative cell of PCC 7203. (D and E) STEM-HAADF images of Cyanothece sp. PCC 7425. Ca-carbonate inclusions appear as bright round-shaped objects. PolyP granules are darker, sometimes shapeless forms (arrows). (F) STEM-EDX map of PCC 7425. (G and H) STEM-HAADF images of Ca. G. lithophora strain D10. Ca-carbonates appear as brighter round-shaped inclusions, whereas PolyP granules are darker, sometimes bigger globules. PolyP granules sometimes seem to partly surround Ca-carbonate inclusions (arrows). (I) STEM-EDX map of D10. The color code is the same for all STEM-EDX maps (C, F, and I): calcium, green; phosphorus, red; carbon, blue. As a result, Ca-carbonates appear in green and PolyP granules in red.

Fig. 4.

Fig. 4.

STEM-HAADF images of Synechococcus sp. PCC 6312. Ca-carbonate inclusions were always observed at the poles of the cells and sometimes at the same location where septation occurs (arrows). Inclusions at the septum are usually smaller than at the poles. Division as observed in A, B, and D seems to partition the Ca-carbonate inclusions between the daughter cells, resulting in the polar distribution observed in all of the cells. STEM-EDX map is shown in C. Calcium, green; phosphorus, red; carbon, blue.

Two Types of Spatial Distributions of the Ca-Carbonate Inclusions Were Observed.

Ca. G. lithophora D10, Cyanothece sp. PCC 7425, and Chroococcidiopsis thermalis PCC 7203 formed calcium carbonate inclusions scattered throughout the cell cytoplasm (Fig. 2). In Cyanothece sp. PCC 7425, most of the cells contained between 2 and 20 Ca-carbonate inclusions measuring between 130 and 700 nm. Few PolyP granules with no specific shape were observed, sometimes in very close spatial association with the Ca-carbonate inclusions (Fig. 2D). Ca. G. lithophora D10 cells contained between 3 and 19 Ca-carbonate inclusions measuring between 60 and 380 nm in diameter; they also contained PolyP granules larger and in higher number than Cyanothece sp. PCC 7425 cells (Fig. 2G). As a comparison, Ca. G. lithophora cells observed by Couradeau et al. (15) in laboratory aquaria that contained highly alkaline, Mg-rich solutions with Ca, Sr, and Ba contained no PolyP granule and a relatively higher number of carbonate inclusions enriched in Mg, Sr, and Ba. The absence or presence of PolyP granules in Ca. G. lithophora cells can be explained by the very low vs. high orthophosphate contents of the laboratory aquaria vs. the BG11 medium, respectively, as shown previously for other strains (24). In contrast, Ca. G. lithophora formed Ca-carbonate inclusions in laboratory aquaria as well as BG11 medium with some variations in their chemical composition (Mg, Sr, and Ba content), likely depending on the concentration of these elements in the solutions. In Chroococcidiopsis thermalis PCC 7203, only few cells (baeocytes and vegetative cells) showed between 8 and 20 Ca-carbonate inclusions per cell, measuring between 350 and 870 nm in diameter (Fig. 2A).

In contrast, Synechococcus sp. strains PCC6716, PCC6717, and PCC6312, Ca. S. calcipolaris G9, and Thermosynechococcus elongatus BP-1 all showed Ca-carbonate inclusions clustered at the cell poles and sometimes also in the middle of the cells (Figs. 3 and 4). The five strains showed very similar characteristics in terms of size, number, and distribution patterns of the Ca-carbonate inclusion within the cells (Figs. 3 and 4). Cells contained between 5 and 40 inclusions at each pole, measuring between 90 and 300 nm in diameter. Inclusions in the middle of the cells were usually smaller, measuring between 50 and 150 nm in diameter. Overall, the numerous images that were acquired suggested that the formation of the Ca-carbonate inclusions is concomitant with the formation of the cell division septum (Fig. 4). After cell division, Ca-carbonate inclusions are therefore located preferentially at the poles of the cells. Controlled internal organizations of inclusions in cyanobacterial cells have been evidenced previously by several studies. For example, PolyP granules are aligned in Synechococcus OS-B′ (24), similar to what was observed for many PCC strains here. Similarly, carboxysomes were shown to arrange along a similar linear organization in Synechococcus elongatus PCC 7942 (25) and to partition evenly between daughter cells. This nonrandom segregation and spatial organization is controlled and involves specific cytoskeletal proteins (25). Such a linear organization controlled by cytoskeletal proteins has also been observed in bacteria biomineralizing magnetites intracellularly (26). Here, Ca-carbonate inclusions within the T. elongatus BP-1 group have a specific distribution within the cells as well, suggesting the possibility of an original nucleation mechanism involving the cell cytoskeleton. Whether cytoskeletal proteins play a role will need to be confirmed by cryo-EM tomography similar to the approach developed by previous studies on magnetotactic bacteria (26); this will help decipher whether intracellular Ca-carbonate formation can be viewed as a biologically controlled mineralization process (27). The present study shows that intracellular calcification at the poles is heritable and linked with phylogeny.

Fig. 3.

Fig. 3.

Electron microscopy images of Synechococcus sp., Ca. S. calcipolaris, and Thermosynechococcus elongatus strains forming intracellular carbonates; all of them form intracellular Ca-carbonates (brightest spots in STEM-HAADF images) located at the septum and the poles of the cells. (A) STEM-HAADF image and (B) EDX map of Synechococcus sp. PCC 6716. Four aligned PolyP granules measuring ∼500 nm in diameter can be observed in the top cell (arrows). Clusters of 20–30 Ca-carbonate inclusions can be observed at both poles of the cell. (C) STEM-HAADF image and (D) STEM-EDX map of strain PCC 6717 cell. (E) STEM-HAADF image and (F) STEM-EDX map of Ca. S. calcipolaris G9 (Lake Alchichica). (G) STEM-HAADF image and (H) STEM-EDX map of Thermosynechococcus elongatus BP1. The color code is the same for all STEM-EDX maps: calcium, green; phosphorus, red; carbon, blue.

It is interesting to note that PolyP granules were also observed in cells forming intracellular Ca-carbonate inclusions, sometimes in very close association with the Ca-carbonate inclusions (Fig. 2). Formation of PolyP granules by PolyP kinases requires the sequestration of relatively high amounts of orthophosphate residues (28), which have a strong inhibiting role on Ca-carbonate formation (29). Moreover, there is a marked partitioning of Mg and K in the PolyP granules vs. Ca in the carbonate inclusions. These observations show that strong chemical disequilibria or gradients are recorded within the cells by these mineral assemblages, suggesting high confinement in the cytoplasm of the cells at the few-nanometer scale; whether this involves membrane vesicles remains to be determined.

Moreover, intracellular Ca-carbonate biomineralization has been overlooked in the past, even for strains that have been kept in culture collections for decades, perhaps due to the association of PolyP granules with Ca-carbonate inclusions in cells cultured in orthophosphate-rich culture media such as BG11 and the difficulty distinguishing between different types of inclusions without analytical tools such as EDXS mapping. Several past studies have analyzed thoroughly the ultrastructure of some of the intracellularly calcifying strains studied here. For example, Porta et al. (16) used a combination of confocal laser scanning microscopy and TEM to describe the ultrastructure of Cyanothece sp. PCC 7425; interestingly, they mentioned the unusually high content of light refractile inclusions when viewed by phase-contrast microscopy but did not conclude on their chemical composition. Similarly, T. elongatus BP-1 has been used as a model for crystallographic studies of protein complexes such as photosystems, but intracellular Ca-carbonates had never been discussed for this strain. Therefore, there is a need for a systematic reassessment of the presence/absence of Ca-carbonate inclusions in all cyanobacterial strains following a procedure similar to that shown here. In our study, cyanobacterial strains that do not form intracellular Ca-carbonates represent the majority. However, we show that intracellular Ca-carbonate biomineralization is not a rare capability; it is performed by strains isolated from diverse environments in various geographical sites, including German soil, a rice field in Senegal, an alkaline lake in Mexico, and hot springs in Japan and the United States (Oregon and Yellowstone; Table S2).

Because the genome sequences of some of the strains analyzed here—in particular, some intracellular Ca-carbonate–forming strains (PCC 6716, 6717, D10, and G9)—are not yet available, we used 16S rDNA sequences to study the phylogeny of these strains (Fig. 1). It is known that phylogenomic approaches provide a higher phylogenetic resolution than 16S rDNA-based methods, but Shih et al. (20) noted the relatively good congruency between the two methods in the case of cyanobacteria. Based on Fig. 1 and Shih et al. (20) multigene phylogeny, it can be noted that intracellular Ca-carbonate biomineralization is phylogenetically fairly widespread in some (but not all) early diverging phyla. For example, all five members of the T. elongatus BP-1 clade, which appears as an early branch of the cyanobacterial phylum (30), form intracellular Ca-carbonate inclusions, suggesting that their ancestor had this capability as well. Reconstructing the timing of cyanobacteria evolution remains a challenge, in particular because of the existence of lateral gene transfers (31) and the lack of reliable fossil evidence to date increasingly old nodes within the group (1), but some tentative ages can be found in the literature. For example, the ancestor of the T. elongatus BP-1 clade was dated between ∼2 and 2.5 Ga by Blank and Sanchez-Baracaldo (32). Although this is still speculative, intracellular Ca-carbonate biomineralization may therefore have been an important biomineralization route in ancient cyanobacteria. The presence of Ca-carbonate inclusions in the very deep-branching species Ca. G. lithophora can be considered an additional support for this idea.

Interestingly, whereas the pattern of Ca-carbonate inclusions limited to the cell poles is restricted to the Thermosynechococcus BP-1 clade, the three species containing inclusions scattered within the cell cytoplasm (Ca. G. lithophora, Cyanothece sp. PCC 7425, and C. thermalis PCC 7203) occupy very distant branches of the cyanobacterial tree (Fig. 1). There are two possibilities to explain this phylogenetic distribution: either this type of biomineralization was extremely ancient in cyanobacteria and was lost in many lineages or it evolved several times independently in these three lineages. Moreover, phylogenomic analyses (20) supported that the T. elongatus BP-1 clade is sister to Cyanothece sp. PCC 7425 (their separation in our tree is most likely due to the limited phylogenetic signal of the 16S rDNA); if this is confirmed, a single group would exhibit the two patterns of intracellular Ca-carbonate distribution. Because the cellular mechanism responsible for this formation of Ca-carbonates remains unknown, it is difficult to distinguish between the hypotheses implying a single or several independent origins for this biomineralization capacity.

The relationship between intracellular and extracellular Ca-carbonate biomineralization will have to be investigated in the future. The formation of amorphous Ca-carbonate inclusions requires relatively high supersaturation conditions (33), suggesting that relatively high concentrations of Ca2+ and/or CO32- must prevail in the cytoplasm of intracellularly Ca-carbonate biomineralizing cyanobacteria. In general, some local increase in the concentration of CO32- may be expected close to carboxysomes from which OH− are released to the cytoplasm by the conversion of HCO3− to CO2 by carboxysomal carbonic anhydrases (34). Intracellular calcification may occur in cyanobacteria regulating less efficiently their intracellular pH. Alternatively, regarding Ca2+, it has been shown that free Ca2+ is highly regulated in the cytoplasm of living bacterial cells at a low concentration, including in some cyanobacteria (35); some variations can, however, occur (e.g., in response to stress) (35), and it has been noted that they may have a physiological role and that cell division in particular appears very sensitive to the level of intracellular Ca2+ in Escherichia coli (36). Interestingly, the present observations suggest that an increase of Ca2+ and/or CO32− concentrations may occur specifically during cell division and locally near the septum in the strains of the T. elongatus BP-1 lineage as shown by the presence of Ca-carbonate inclusions. Whether some local Ca2+ influx related to cell division occurs in these strains will have to be tested. Finally, the possible existence of (specific or not) nucleation sites, and/or molecules stabilizing the amorphous Ca-carbonates, and/or molecules inhibiting further Ca-carbonate growth after nucleation can be postulated to explain (i) the discrete locations of Ca-carbonate inclusions, (ii) the persistence of these unstable amorphous phases, and (iii) the fact that the cytoplasm does not get eventually fully mineralized. In any case, such an intracellular biomineralization may lower at least partly the export outside the cell of the alkalinity generated by the photosynthetic activity and hence be detrimental to extracellular Ca-carbonate biomineralization. By sequestering at least transiently cytosolic inorganic carbon in solids, intracellular biomineralization may also interfere with the physiology of the cells. Recent studies of Ca-carbonate precipitation in cyanobacteria have been restricted to relatively few model strains—namely, Synechocystis sp. PCC 6803 (12, 37), Synechococcus elongatus PCC 7942 (38), Synechococcus sp. PCC 8806, and Synechococcus sp. PCC 8807 (18, 19). As shown here, Synechocystis sp. PCC 6803 does not form intracellular Ca-carbonate inclusions in BG11. Synechococcus elongatus PCC 7942 and Synechococcus sp. PCC 8806, previously observed using appropriate techniques (19, 38), do not form intracellular Ca-carbonate inclusions as well and can thus be considered as good models to study extracellular biomineralization of Ca-carbonate. Here, alternatively, new models for the study of intracellular biomineralization of Ca-carbonate are provided, offering a key to better understand the mechanisms governing the interactions between cyanobacteria and calcification by elucidating the molecular differences between these different patterns of biomineralization. Finally, many eukaryotic phyla have been shown to form intracellular amorphous minerals, some of which are involved, for example, in the production of the crystalline part of exoskeletons (39). The possibility that at least part of the biochemical apparatus involved in this process has a unique evolutionary origin in cyanobacteria and eukaryotes will have to be explored in the future.

Materials and Methods

Strains and Culture Conditions.

Sixty-four axenic strains were available from the Pasteur Culture Collection of cyanobacteria (PCC strains) (20); they were axenic and have been described and studied by Rippka et al. (21) and Shih et al. (20). Culture media used for the different strains are reported in Table S1. Strains isolated from freshwater, soil, or thermal environments were cultured in medium BG-11 and its variants, and marine strains were cultured in the more saline medium ASN-III and its variants (Table S1) (21). Recipes of the culture media are available on http://cyanobacteria.web.pasteur.fr/. All PCC cultures were grown at 22 °C except PCC 6716, 6717, 9339, 9431, and 9605, which were grown at 37 °C. An axenic Thermosynechococcus elongatus strain BP-1, isolated from a hot spring in Beppu (Japan), was provided by Alain Boussac (Commissariat à l'Énergie Atomique et aux Énergies Alternatives Saclay, Gif-sur-Yvette, France) and was cultured at 37 °C in BG11. One nonaxenic strain was an enrichment from Yellowstone. Two nonaxenic strains were enriched from Lake Alchichica. Ca. G. lithophora D10 was previously enriched and described in Couradeau et al. (15). A second strain was enriched following the same protocol; because this strain was phylogenetically relatively distant from Synechococcus sp. PCC 6312, PCC 6716, and PCC 6717, and because it was enriched from a mesophilic environment on the contrary to Thermosynechococcus elongatus BP-1, we propose the following status for this new strain enriched from Lake Alchichica: order Chroococcales, Ca. S. calcipolaris sp. nov. Both cultures of Ca. G. lithophora D10 and Ca. S. calcipolaris G9 were grown in BG11 at 22 °C.

Microscopy Sample Preparation.

A total of 0.5 mL of cultures was centrifuged at 8,000 × g for 10 min. Pellets were rinsed three times in Milli-Q (mQ) water (Millipore). After the final centrifugation, pellets were resuspended in 200 μL of mQ water. A drop of 5 μL was deposited on a carbon-coated 200-mesh copper grid and let dry at ambient temperature.

Electron Microscopy Analyses.

SEM observations were performed on a Zeiss Supra 55 SEM microscope at a 10-kV working voltage with a working distance of 7.5 mm, an aperture of 60 μm, and at high current. SEM images were collected with the AsB detector. Elemental maps of Ca, P, and C were retrieved from hyperspectral images (HyperMap) in an EDXS analysis for each pixel of the image. Some strains, especially those forming intracellular Ca-carbonates, were further analyzed by TEM using a JEOL-2100F microscope operating at 200 kV, equipped with a field emission gun, a JEOL detector with an ultrathin window allowing detection of light elements, and a STEM device, which allows Z-contrast imaging in the HAADF mode. Compositional mapping was acquired by performing EDXS analysis in the STEM HAADF mode.

Scanning Transmission X-ray Microscopy Analyses.

STXM analyses were performed at the carbon K-edge and at the Ca L2,3-edges. Cultures were resuspended in distilled water and deposited on silicon nitride windows. STXM and XANES analyses were performed on beamline 11.0.2.2 of the Advanced Light Source (Lawrence Berkeley National Laboratory). Energy calibration was achieved using the well-resolved 3p Rydberg peak of gaseous CO2 at 294.96 eV. A 25-nm zone plate was used. Cell proteins, polyphosphate, and carbonate inclusions were discriminated based on their different spectral signatures at the C K-edge and the Ca L2,3-edges following the approach detailed by Cosmidis et al. (40).

Phylogenetic Analysis.

Genomic DNA was extracted from an enriched culture of Ca. S. calcipolaris with the PowerBiofilm DNA Isolation Kit (MoBio) and used for 16S rRNA gene PCR amplification with the specific cyanobacterial primers CYA106F (CGGACGGGTGAGTAACGCGTGA) and 23S30R (CTTCGCCTCTGTGTGCCTAGGT). PCR reactions were carried out with 30 cycles (each one including denaturation at 94 °C for 15 s, annealing at 55 °C for 30 s, and extension at 72 °C for 2 min), preceded by 2-min denaturation at 94 °C, and followed by 7-min extension at 72 °C. PCR products were directly sequenced by Beckman Coulter Genomics using the Cya106F forward primer and the 1492R (GGTTACCTTGTTACGACTT) as reverse universal primer for bacteria. The other cyanobacterial 16S rRNA gene sequences were retrieved directly from GenBank (http://ncbi.nlm.nih.gov/). Sequences were aligned using MAFFT (41), and the conserved sites were identified using gBlocks (42). Bayesian phylogenetic analysis was done using MrBayes 3.2.2 (43) with the general time-reversible model of sequence evolution, and taking among-site rate variation into account by using an eight-category discrete approximation of a Γ distribution and a proportion of invariant sites. Two parallel MCMC runs with four chains each (three hot and one cold) were performed for 10 million generations and sampled every 10,000 generations, discarding a burn-in of 25% before constructing a consensus tree. The 16S rRNA gene sequence of Ca. S. calcipolaris has been submitted to GenBank under accession no. KJ566932.

Supplementary Material

Supporting Information

Acknowledgments

Funding for this work was provided by the European Research Council under European Community’s Seventh Framework Programme FP7/2007-2013 Grant 307110, ERC CALCYAN; the Pasteur Culture Collection of cyanobacteria supported by the Institut Pasteur (M.G. and T.L.); the SEM facility at L’Institut de Minéralogie, de Physique des Matériaux et de Cosmochimie (IMPMC) purchased by Région Ile de France Grant SESAME 2006 I-07-593/R; the transmission electron microscopy facility at IMPMC purchased by Region Ile de France Grant SESAME 2000 E 1435; and Advanced Light Source Molecular Environmental Science beamline 11.0.2 supported by the Office of Science, Office of Basic Energy Sciences, Division of Chemical Sciences, Geosciences, and Biosciences and Materials Sciences Division, US Department of Energy at Lawrence Berkeley National Laboratory.

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1403510111/-/DCSupplemental.

References

  • 1.Tomitani A, Knoll AH, Cavanaugh CM, Ohno T. The evolutionary diversification of cyanobacteria: Molecular-phylogenetic and paleontological perspectives. Proc Natl Acad Sci USA. 2006;103(14):5442–5447. doi: 10.1073/pnas.0600999103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Rosing MT, Bird DK, Sleep NH, Glassley W, Albarede F. The rise of continents—An essay on the geologic consequences of photosynthesis. Palaeogeogr Palaeoclimatol Palaeoecol. 2006;232(2-4):99–113. [Google Scholar]
  • 3.Buick R. When did oxygenic photosynthesis evolve? Philos Trans R Soc Lond B Biol Sci. 2008;363(1504):2731–2743. doi: 10.1098/rstb.2008.0041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Jansson C, Northen T. Calcifying cyanobacteria—the potential of biomineralization for carbon capture and storage. Curr Opin Biotechnol. 2010;21(3):365–371. doi: 10.1016/j.copbio.2010.03.017. [DOI] [PubMed] [Google Scholar]
  • 5.Golubic S, Lee SJ. Early cyanobacterial fossil record: Preservation, palaeoenvironments and identification. Eur J Phycol. 1999;34(4):339–348. [Google Scholar]
  • 6.Altermann W, Kazmierczak J, Oren A, Wright DT. Cyanobacterial calcification and its rock-building potential during 3.5 billion years of Earth history. Geobiology. 2006;4(3):147–166. [Google Scholar]
  • 7.Bosak T, Knoll AH, Petroff AP. The meaning of stromatolites. Annu Rev Earth Planet Sci. 2013;41(5):21–44. [Google Scholar]
  • 8.Klein C, Beukes NJ, Schopf JW. Filamentous microfossils in the early Proterozoic Transvaal Supergroup: Their morphology, significance, and paleoenvironmental setting. Precambrian Res. 1987;36(1):81–94. [Google Scholar]
  • 9.Arp G, Reimer A, Reitner J. Photosynthesis-induced biofilm calcification and calcium concentrations in Phanerozoic oceans. Science. 2001;292(5522):1701–1704. doi: 10.1126/science.1057204. [DOI] [PubMed] [Google Scholar]
  • 10.Riding R. Cyanobacterial calcification, carbon dioxide concentrating mechanisms, and Proterozoic–Cambrian changes in atmospheric composition. Geobiology. 2006;4(4):299–316. [Google Scholar]
  • 11.Kamennaya NA, Ajo-Franklin CM, Northen T, Jansson C. Cyanobacteria as biocatalysts for carbonate mineralization. Minerals. 2012;2(2):338–364. [Google Scholar]
  • 12.Jiang HB, Cheng HM, Gao KS, Qiu BS. Inactivation of Ca(2+)/H(+) exchanger in Synechocystis sp. strain PCC 6803 promotes cyanobacterial calcification by upregulating CO(2)-concentrating mechanisms. Appl Environ Microbiol. 2013;79(13):4048–4055. doi: 10.1128/AEM.00681-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Merz M. The biology of carbonate precipitation by cyanobacteria. Facies. 1992;26(1):81–101. [Google Scholar]
  • 14.Obst M, Wehrli B, Dittrich M. CaCO3 nucleation by cyanobacteria: Laboratory evidence for a passive, surface-induced mechanism. Geobiology. 2009;7(3):324–347. doi: 10.1111/j.1472-4669.2009.00200.x. [DOI] [PubMed] [Google Scholar]
  • 15.Couradeau E, et al. An early-branching microbialite cyanobacterium forms intracellular carbonates. Science. 2012;336(6080):459–462. doi: 10.1126/science.1216171. [DOI] [PubMed] [Google Scholar]
  • 16.Porta D, Rippka R, Hernández-Mariné M. Unusual ultrastructural features in three strains of Cyanothece (cyanobacteria) Arch Microbiol. 2000;173(2):154–163. doi: 10.1007/s002039900126. [DOI] [PubMed] [Google Scholar]
  • 17.Allen MM. Cyanobacterial cell inclusions. Annu Rev Microbiol. 1984;38:1–25. doi: 10.1146/annurev.mi.38.100184.000245. [DOI] [PubMed] [Google Scholar]
  • 18.Lee BD, Apel WA, Walton MR. Calcium carbonate formation by Synechococcus sp. strain PCC 8806 and Synechococcus sp. strain PCC 8807. Bioresour Technol. 2006;97(18):2427–2434. doi: 10.1016/j.biortech.2005.09.028. [DOI] [PubMed] [Google Scholar]
  • 19.Liang A, Paulo C, Zhu Y, Dittrich M. CaCO3 biomineralization on cyanobacterial surfaces: Insights from experiments with three Synechococcus strains. Colloids Surf B Biointerfaces. 2013;111C(11):600–608. doi: 10.1016/j.colsurfb.2013.07.012. [DOI] [PubMed] [Google Scholar]
  • 20.Shih PM, et al. Improving the coverage of the cyanobacterial phylum using diversity-driven genome sequencing. Proc Natl Acad Sci USA. 2013;110(3):1053–1058. doi: 10.1073/pnas.1217107110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Rippka R, Deruelles J, Waterbury JB, Herdman M, Stanier RY. Generic assignments, strain histories and properties of pure cultures of cyanobacteria. J Gen Microbiol. 1979;111(3):1–61. [Google Scholar]
  • 22.Morohoshi T, et al. Accumulation of inorganic polyphosphate in phoU mutants of Escherichia coli and Synechocystis sp. strain PCC6803. Appl Environ Microbiol. 2002;68(8):4107–4110. doi: 10.1128/AEM.68.8.4107-4110.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Jacobson L, Halmann M. Polyphosphate metabolism in the blue-green alga Microcystis aeruginosa. J Plankton Res. 1982;4(3):481–488. [Google Scholar]
  • 24.Gomez-Garcia MR, Fazeli F, Grote A, Grossman AR, Bhaya D. Role of polyphosphate in thermophilic Synechococcus sp. from microbial mats. J Bacteriol. 2013;195(15):3309–3319. doi: 10.1128/JB.00207-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Savage DF, Afonso B, Chen AH, Silver PA. Spatially ordered dynamics of the bacterial carbon fixation machinery. Science. 2010;327(5970):1258–1261. doi: 10.1126/science.1186090. [DOI] [PubMed] [Google Scholar]
  • 26.Scheffel A, et al. An acidic protein aligns magnetosomes along a filamentous structure in magnetotactic bacteria. Nature. 2006;440(7080):110–114. doi: 10.1038/nature04382. [DOI] [PubMed] [Google Scholar]
  • 27.Weiner S, Dove PM. An overview of biomineralization processes and the problem of the vital effect. Rev Mineral Geochem. 2003;54:1–29. [Google Scholar]
  • 28.Omelon SJ, Grynpas MD. Relationships between polyphosphate chemistry, biochemistry and apatite biomineralization. Chem Rev. 2008;108(11):4694–4715. doi: 10.1021/cr0782527. [DOI] [PubMed] [Google Scholar]
  • 29.Dove PM, Hochella F., Jr Calcite precipitation mechanisms and inhibition by orthophosphate: In situ observations by scanning force microscopy. Geochim Cosmochim Acta. 1993;57(3):705–714. [Google Scholar]
  • 30.Robertson BR, Tezuka N, Watanabe MM. Phylogenetic analyses of Synechococcus strains (cyanobacteria) using sequences of 16S rDNA and part of the phycocyanin operon reveal multiple evolutionary lines and reflect phycobilin content. Int J Syst Evol Microbiol. 2001;51(Pt 3):861–871. doi: 10.1099/00207713-51-3-861. [DOI] [PubMed] [Google Scholar]
  • 31.Szöllosi GJ, Boussau B, Abby SS, Tannier E, Daubin V. Phylogenetic modeling of lateral gene transfer reconstructs the pattern and relative timing of speciations. Proc Natl Acad Sci USA. 2012;109(43):17513–17518. doi: 10.1073/pnas.1202997109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Blank CE, Sánchez-Baracaldo P. Timing of morphological and ecological innovations in the cyanobacteria—a key to understanding the rise in atmospheric oxygen. Geobiology. 2010;8(1):1–23. doi: 10.1111/j.1472-4669.2009.00220.x. [DOI] [PubMed] [Google Scholar]
  • 33.Wang D, et al. Revisiting geochemical controls on patterns of carbonate deposition through the lens of multiple pathways to mineralization. Faraday Discuss. 2012;159:371–386. [Google Scholar]
  • 34.Rae BD, Long BM, Badger MR, Price GD. Functions, compositions, and evolution of the two types of carboxysomes: Polyhedral microcompartments that facilitate CO2 fixation in cyanobacteria and some proteobacteria. Microbiol Mol Biol Rev. 2013;77(3):357–379. doi: 10.1128/MMBR.00061-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Barrán-Berdón AL, Rodea-Palomares I, Leganés F, Fernández-Piñas F. Free Ca2+ as an early intracellular biomarker of exposure of cyanobacteria to environmental pollution. Anal Bioanal Chem. 2011;400(4):1015–1029. doi: 10.1007/s00216-010-4209-3. [DOI] [PubMed] [Google Scholar]
  • 36.Holland IB, Jones HE, Campbell AK, Jacq A. An assessment of the role of intracellular free Ca2+ in E. coli. Biochimie. 1999;81(8-9):901–907. doi: 10.1016/s0300-9084(99)00205-9. [DOI] [PubMed] [Google Scholar]
  • 37.Han Z, et al. Precipitation of calcite induced by Synechocystis sp. PCC6803. World J Microbiol Biotechnol. 2013;29(10):1801–1811. doi: 10.1007/s11274-013-1341-1. [DOI] [PubMed] [Google Scholar]
  • 38.Obst M, et al. Precipitation of amorphous CaCO3 (aragonite-like) by cyanobacteria: A STXM study of the influence of EPS on the nucleation process. Geochim Cosmochim Acta. 2009;73(14):4180–4198. [Google Scholar]
  • 39.Addadi L, Raz S, Weiner S. Taking advantage of disorder: Amorphous calcium carbonate and its roles in biomineralization. Adv Mater. 2003;15:959–970. [Google Scholar]
  • 40.Cosmidis J, Benzerara K. Soft X-ray scanning transmission micro-spectroscopy. In: Gower L, DiMasi E, editors. Handbook of Biomineralization. London: Taylor & Francis; 2014. [Google Scholar]
  • 41.Katoh K, Misawa K, Kuma K, Miyata T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002;30(14):3059–3066. doi: 10.1093/nar/gkf436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Castresana J. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol. 2000;17(4):540–552. doi: 10.1093/oxfordjournals.molbev.a026334. [DOI] [PubMed] [Google Scholar]
  • 43.Ronquist F, et al. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol. 2012;61(3):539–542. doi: 10.1093/sysbio/sys029. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Information

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES