Abstract
• Premise of the study: To complement existing sets of primarily dinucleotide microsatellite loci from noncoding sequences of date palm, we developed primers for tri- and hexanucleotide microsatellite loci identified within genes. Due to their conserved genomic locations, the primers should be useful in other palm taxa, and their utility was tested in seven other Phoenix species and in Chamaerops, Livistona, and Hyphaene.
• Methods and Results: Tandem repeat motifs of 3–6 bp were searched using a simple sequence repeat (SSR)–pipeline package in coding portions of the date palm draft genome sequence. Fifteen loci produced highly consistent amplification, intraspecific polymorphisms, and stepwise mutation patterns.
• Conclusions: These microsatellite loci showed sufficient levels of variability and transferability to make them useful for population genetic, selection signature, and interspecific gene flow studies in Phoenix and other Coryphoideae genera.
Keywords: Arecaceae, Coryphoideae, microsatellite/SSR mining, Phoenix dactylifera, transferability
The date palm (Phoenix dactylifera L.) is a monocotyledon species belonging to the Arecaceae family, and is widely cultivated in North Africa, the Sahel (from the Atlantic to the Red Sea), the Middle East, and eastward to the Indus Valley. The date palm is well adapted to cultivation in arid and semiarid areas, and it has been introduced in warm and dry regions worldwide. Mainly grown for its fruits, the date palm represents an important ecological and socioeconomic resource.
Despite the increasing number of studies on date palm, there are still not enough molecular markers available for a number of applications. Most published microsatellite or simple sequence repeat (SSR) markers are dinucleotide loci from unknown noncoding regions of the genome, generally isolated from microsatellite-enriched DNA libraries (Billotte et al., 2004; Arabnezhad et al., 2012). The increasing amount of available genome sequence data offers new prospects for microsatellite marker development through in silico mining, a promising approach for date palm (Cherif et al., 2013), based on the recently published date palm genome sequence (Al-Dous et al., 2011) and expressed sequence tags (ESTs) (Zhao et al., 2012). Our aim was to develop new markers from coding sequences to ensure clear stepwise mutation patterns usable for genetic diversity, dating, and selection signature analyses, and also to facilitate transferability to other species.
METHODS AND RESULTS
In silico microsatellite mining and primer design were performed on the date palm genome draft sequence version 2 (Al-Dous et al., 2011), with the Perl script SSR_pipeline-v2.pl (Poncet et al., 2006), which incorporates three free software programs: Tandem Repeats Finder (Benson, 1999), Primer3 (Rozen and Skaletsky, 2000), and BLAST (Altschul et al., 1990). The multi-FASTA file of all 19,414 predicted genes (full and partial; PDK20.mRNA.fsa) and the multi-FASTA file with all scaffold sequences (PDK20.fsa) from version 2 of the date palm genome research program at Weill Cornell Medical College in Qatar were downloaded from http://qatar-weill.cornell.edu/research/datepalmGenome/download.html. The search identified 204 genes containing coding sequences with microsatellites, 150 of which were suitable for primer design, but only 103 had nonduplicated primer annealing sites. Among them, we retained loci having perfect trinucleotide motifs with six (excluding those without annotation) or more (with or without annotations) repeats, and hexanucleotide motifs with at least four repeats (with or without annotation).
Of the 47 primer pairs finally retained, 33 generated expected PCR amplification patterns in a preliminary test with eight P. dactylifera individuals (Table 1). The 33 loci were further tested on 16 individuals representing P. dactylifera (7), P. reclinata Jacq. (2), P. roebelenii O’Brien (2), P. rupicola T. Anderson (2), P. theophrasti Greuter (2), and the interspecific hybrid P. canariensis × P. sylvestris (Table 2). Among these loci, 15 showed consistent amplification and promising polymorphisms across the sample and were further investigated in a variable number of individuals (80–1000) of the aforementioned species, including population samplings of P. dactylifera and P. reclinata. The transferability of 10 loci was also evaluated in Chamaerops humilis L., resulting in 100% positive amplification, with eight polymorphic loci displaying two to 12 alleles among seven to 51 individuals (Table 3). Moreover, the amplification of one Hyphaene thebaica Mart. individual and one Livistona carinensis (Chiov.) J. Dransf. & N.W. Uhl individual was tested for five loci, with both species giving positive amplification results in three loci (mPdIRD25, mPdIRD31, and mPdIRD33).
Table 1.
Characteristics of 33 microsatellite markers developed for Phoenix species. The putative annotation was done using the BLASTX program and the UniProtKB/Swiss-Prot protein database with an E-value cutoff of 10−5.
| Locus | Primer sequences (5′–3′)a | Repeat motif | Size range (bp)b | Scaffold ID | Start | Stop | Gene annotation | E-value | Organism |
| mPdIRD01 | F: CTCGGAAGGGTATGGACAAA | (AAG)3 | 200 | PDK_20s1306691 | 24393 | 24401 | Putative pectinesterase/pectinesterase inhibitor 28 | 4.00E-87 | Arabidopsis thaliana |
| R: TTGCCTTCGACGTGGTAGTA | |||||||||
| mPdIRD03 | F: CATTGATCCAACACCACCAC | (CCT)6 | 192–198 | PDK_20s1315791 | 3431 | 3448 | Cysteine-rich receptor-like protein kinase 2 | 1.00E-166 | Arabidopsis thaliana |
| R: GCCAAAACCAGCTCTGGTAAC | |||||||||
| mPdIRD04 | F: TTGGTGGCCTTTCTCAGAGT | (AGC)6 | 255–261 | PDK_20s13282911 | 9405 | 9422 | S-adenosylmethionine synthase 10 | 6.00E-77 | Oryza sativa |
| R: TGGGATCAAAGTAGGGTTGG | |||||||||
| mPdIRD05 | F: CTATCAGGATGGGGGTGATG | (GAT)6 | 301–302 | PDK_20s1366071 | 11666 | 11683 | DEAD-box ATP-dependent RNA helicase ISE2, chloroplastic | 3.00E-09 | Arabidopsis thaliana |
| R: ACCCATCTGCATAGCTCCAG | |||||||||
| mPdIRD07 | F: TGCAATACGATGGCAGAGTC | (TGG)6 | 182–212 | PDK_20s1387131 | 3737 | 3754 | No hit | – | – |
| R: CCTTGCAAGTTTTCCACACC | |||||||||
| mPdIRD08 | F: CTATTGGGTCCCTTGGTGAG | (GAT)6 | 202 | PDK_20s1402051 | 10945 | 10962 | No hit | – | – |
| R: TGACTGCTCGTCATCAGGTC | |||||||||
| mPdIRD10 | F: ATGCGTTCATCTCCCTTGAG | (CAG)6 | 194–214 | PDK_20s1405881 | 31976 | 31993 | No hit | – | – |
| R: GCTGCAAACATCATCCTCAC | |||||||||
| mPdIRD11 | F: GAGTTGGAGGCAAAACCAGA | (GAT)6 | 309–317 | PDK_20s1422271 | 4385 | 4402 | Two-component response regulator-like APRR9 | 5.00E-18 | Arabidopsis thaliana |
| R: CCACAAAACCCTTGTCTTCC | |||||||||
| mPdIRD13 | F: GCGGAGACAGGAGATGGTAA | (CAC)6 | 198–227 | PDK_20s1496731 | 12538 | 12555 | Trihelix transcription factor GT-2 | 8.00E-62 | Arabidopsis thaliana |
| R: CTTGACTGCTTCTGCTGCTG | |||||||||
| mPdIRD14 | F: GAGGGGTTCACGTTTGTGTC | (GCG)6 | 163 | PDK_20s1505351 | 9121 | 9138 | Probable ascorbate-specific transmembrane electron transporter 1 | 1.00E-82 | Oryza sativa |
| R: GCACCAAGCACAAGAGCAAT | |||||||||
| mPdIRD15 | F: CCGAGTCTGGCGAAGTAAAC | (GAA)6 | 406–408 | PDK_20s1507261 | 2378 | 2395 | Eukaryotic translation initiation factor 2 subunit beta | 1.00E-22 | Wheat |
| R: CTCCCCTTCCTCATCCTCTC | |||||||||
| mPdIRD16 | F: CTGTCCGATCGAATTCTGC | (CAG)6 | 197–214 | PDK_20s1521921 | 7038 | 7055 | Probable WRKY transcription factor 41 | 3.00E-47 | Arabidopsis thaliana |
| R: GGACATCTCTTTGCGGTCAT | |||||||||
| mPdIRD17 | F: GTGGGAGAAACCCGAAGAAT | (AGC)6 | 199–202 | PDK_20s1549911 | 54838 | 54855 | Flowering time control protein FCA | 3.00E-38 | Arabidopsis thaliana |
| R: CTGCTGCCTCATCTGCATT | |||||||||
| mPdIRD20 | F: TTGAATGGTCCCCTGTAGGT | (AGT)6 | 341–373 | PDK_20s1640771 | 6702 | 6719 | Transcription factor bHLH62 | 7.00E-57 | Arabidopsis thaliana |
| R: GTCCCAGCATGATTGCAGTA | |||||||||
| mPdIRD22 | F: GGCTGTATGGGAAAGACCTG | (GAA)6 | 231–271 | PDK_20s1726541 | 2878 | 2895 | Probable peptide/nitrate transporter At1g59740 | 4.00E-40 | Arabidopsis thaliana |
| R: CCTGCTGCATATTCTTCGTG | |||||||||
| mPdIRD24 | F: GCTCCTGCAGAACCTGAAAC | (AAG)6 | 184 | PDK_20s1762671 | 5194 | 5211 | Probable nucleolar protein 5-1 | 2.00E-46 | Arabidopsis thaliana |
| R: GGACATCACCGTCCAATTCT | |||||||||
| mPdIRD25 | F: CACTGGAAATTCAGGGCCTA | (AGG)6 | 193–205 | PDK_20s1831761 | 4692 | 4709 | Heat stress transcription factor A-2c | 8.00E-135 | Oryza sativa |
| R: CCCAATTTCTCAGCCAAGAC | |||||||||
| mPdIRD26 | F: CCTCCAGTTCATGCTTCTCC | (ACC)7 | 189–192 | PDK_20s130094114 | 13441 | 13461 | Protein transport protein Sec24-like At3g07100 | 4.00E-99 | Arabidopsis thaliana |
| R: GAGCAGACCCGACAGACAAT | |||||||||
| mPdIRD28 | F: GAAACGGTATCGGGATGATG | (TGA)7 | 299–306 | PDK_20s1327431 | 28753 | 28773 | Nuclear cap-binding protein subunit 2 | 3.00E-82 | Arabidopsis thaliana |
| R: TTAACGACGCCGTTTCCT | |||||||||
| mPdIRD29 | F: GGCTCCACCATCATTGACA | (CCA)7 | 205–217 | PDK_20s1359471 | 804 | 824 | Putative pectinesterase 14 | 1.00E-34 | Arabidopsis thaliana |
| R: AACAGCATCGACTGCCTTCT | |||||||||
| mPdIRD30 | F: GCAGATGGTTGAAAGCTCCT | (TCA)7 | 218–224 | PDK_20s1398581 | 15353 | 15373 | No hit | ||
| R: CCCCATTAACAGGATCAACG | |||||||||
| mPdIRD31 | F: GCAGGTGGACTGCAAAATCT | (CCA)7 | 343–372 | PDK_20s1419261 | 29072 | 29092 | Flowering time control protein FY | 4.00E-76 | Arabidopsis thaliana |
| R: CTATTGGGGTGCTGATCCAT | |||||||||
| mPdIRD32 | F: AAGAAGACATTCCGGCTGGT | (ATC)7 | 148–163 | PDK_20s1457341 | 3172 | 3192 | Probable alpha-glucosidase Os06g0675700 | 0.0 | Oryza sativa |
| R: GCGGGTGTGTGATATTGATG | |||||||||
| mPdIRD33 | F: GGAGCATACAGTGGGTTTGC | (CAG)7 | 189–213 | PDK_20s1569281 | 5206 | 5226 | Putative clathrin assembly protein At4g25940 | 6.00E-133 | Arabidopsis thaliana |
| R: CAGCCTGGGAATGAGGATAG | |||||||||
| mPdIRD35 | F: CAGCCCCTTACTCAGACTGG | (GCA)7 | 209 | PDK_20s1690511 | 5056 | 5076 | No hit | ||
| R: CCCATAAGCTGATTGTGCTG | |||||||||
| mPdIRD36 | F: GACACGTTGACGATGTGGAA | (TCA)8 | 162–177 | PDK_20s1457341 | 3210 | 3233 | Probable alpha-glucosidase Os06g0675700 | 0.0 | Oryza sativa |
| R: CCATTGCTGTTGAGGAGGAG | |||||||||
| mPdIRD37 | F: TTTCCTGCTCGAAAGACACC | (AGC)9 | 171–191 | PDK_20s1521781 | 15593 | 15619 | Hydroxyphenylpyruvate reductase | 3.00E-71 | Solenostemon scutellarioides |
| R: CTTAGCCAGCCTCCACACTC | |||||||||
| mPdIRD40 | F: GAGAGATGCGTCAGGGAATC | (CCAGTG)4 | 175–211 | PDK_20s1327401 | 16193 | 16216 | No hit | ||
| R: CCAGAATCTTCCAAGCAAGC | |||||||||
| mPdIRD42 | F: GAGGCAAAACTATGGGAAGC | (CCAGCA)4 | 82–86 | PDK_20s1397171 | 13789 | 13812 | Histone-lysine N-methyltransferase SUVR2 | 6.00E-04 | Arabidopsis thaliana |
| R: TTCACTGGAGCAAGGGTAGG | |||||||||
| mPdIRD43 | F: GCAGCCATTGCTTACAGTGA | (AACCCT)4 | 202–208 | PDK_20s1411101 | 2862 | 2885 | Chaperone protein ClpB1 | 2.00E-05 | Arabidopsis thaliana |
| R: TAAACTGCTGCCTTCCTTGG | |||||||||
| mPdIRD44 | F: CAGATCCGGGAGATGATGAA | (TGGTGC)4 | 263 | PDK_20s1467201 | 3121 | 3144 | Two-component response regulator ARR2 | 2.00E-06 | Arabidopsis thaliana |
| R: AGCAGGAGCAGCTGCATAA | |||||||||
| mPdIRD45 | F: TAGCCTGTGCATGTTCGTTG | (AGCATC)4 | 197 | PDK_20s1473281 | 13788 | 13811 | No hit | ||
| R: AACAGCAGCTGATGGTGATG | |||||||||
| mPdIRD46 | F: ATGGGTCCATTGGAGGAACT | (CAGGCA)4 | 173–197 | PDK_20s1677871 | 3983 | 4006 | Protein spotted leaf 11 | 0.0 | Oryza sativa |
| R: GACGGAGACCTTGACTGCTC |
Annealing temperature for all primers is 60°C.
Size ranges were compiled from all amplification experiments conducted on seven Phoenix species.
Table 2.
Test of functionality of the 33 loci across the Phoenix genus.a
| Locus | Pdac (7) | Prec (2) | Proe (2) | Prup (2) | Pthe (2) | Phyb (1) | All (16) | SMb | Locus comment |
| mPdIRD01 | M | M | M | M | M | M | M | — | 100% amplification, monomorphic |
| mPdIRD03 | P | M | M | M | Failed | Failed | P | 3 | Partial amplification, intra- or interspecific polymorphism |
| mPdIRD04 | M | M | M | M | M | M | P | 3 | 100% amplification, interspecific polymorphism |
| mPdIRD05 | M | M | M | M | M | M | P | No | 100% amplification, interspecific polymorphism |
| mPdIRD07 | M | M | M | M | P | M | P | 3 | Partial amplification, intra- or interspecific polymorphism |
| mPdIRD08 | M | Failed | Failed | Failed | Failed | Failed | M | — | Partial amplification, monomorphic |
| mPdIRD10 | P | P | M | Failed | M | Failed | P | 3 | Partial amplification, intra- or interspecific polymorphism |
| mPdIRD11 | P | P | P | M | M | M | P | 3 | 100% amplification, intra- or interspecific polymorphism |
| mPdIRD13 | P | P | P | M | P | M | P | 3 | 100% amplification, intra- or interspecific polymorphism |
| mPdIRD14 | M | Failed | Failed | Failed | Failed | Failed | M | — | Partial amplification, monomorphic |
| mPdIRD15 | M | M | M | M | M | P | P | No | 100% amplification, interspecific polymorphism |
| mPdIRD16 | P | M | M | M | M | M | P | 3 | 100% amplification, intra- or interspecific polymorphism |
| mPdIRD17 | M | M | M | M | M | P | P | 3 | 100% amplification, interspecific polymorphism |
| mPdIRD20 | M | P | M | M | P | M | P | 3 | 100% amplification, intra- or interspecific polymorphism |
| mPdIRD22 | M | M | M | P | M | M | P | 3 | 100% amplification, intra- or interspecific polymorphism |
| mPdIRD24 | M | M | M | M | M | M | M | — | 100% amplification, monomorphic |
| mPdIRD25 | P | P | M | M | M | M | P | 3 | 100% amplification, intra- or interspecific polymorphism |
| mPdIRD26 | P | M | M | M | M | M | P | 3 | Partial amplification, intra- or interspecific polymorphism |
| mPdIRD28 | P | M | P | M | M | M | P | No | 100% amplification, intra- or interspecific polymorphism |
| mPdIRD29 | P | P | M | Failed | Failed | Failed | P | 3 | Partial amplification, intra- or interspecific polymorphism |
| mPdIRD30 | P | P | Failed | Failed | M | Failed | P | 3 | Partial amplification, intra- or interspecific polymorphism |
| mPdIRD31 | P | P | M | M | M | M | P | 3 | 100% amplification, intra- or interspecific polymorphism |
| mPdIRD32 | M | P | M | M | M | P | P | 3 | 100% amplification, intra- or interspecific polymorphism |
| mPdIRD33 | P | P | M | M | M | M | P | 3 | 100% amplification, intra- or interspecific polymorphism |
| mPdIRD35 | M | M | M | M | M | M | M | — | 100% amplification, monomorphic |
| mPdIRD36 | M | P | M | M | M | P | P | 3 | 100% amplification, intra- or interspecific polymorphism |
| mPdIRD37 | P | P | P | P | M | P | P | 3 | Partial amplification, intra- or interspecific polymorphism |
| mPdIRD40 | P | P | M | M | P | P | P | 3 | 100% amplification, intra- or interspecific polymorphism |
| mPdIRD42 | P | Failed | Failed | Failed | Failed | Failed | P | No | Partial amplification, intra- or interspecific polymorphism |
| mPdIRD43 | P | M | M | M | M | M | P | 6 | 100% amplification, intra- or interspecific polymorphism |
| mPdIRD44 | P | Failed | Failed | Failed | Failed | Failed | P | No | Partial amplification, intra- or interspecific polymorphism |
| mPdIRD45 | M | Failed | Failed | Failed | Failed | Failed | M | — | Partial amplification, monomorphic |
| mPdIRD46 | P | P | P | P | P | P | P | 6 | 100% amplification, intra- and interspecific polymorphism |
Note: M = monomorphic; P = polymorphic; Pdac = Phoenix dactylifera; Prec = Phoenix reclinata; Proe = Phoenix roebelenii; Prup = Phoenix rupicola; Pthe = Phoenix theophrasti; Phyb = Phoenix canariensis × Phoenix sylvestris; SM = stepwise mutation pattern.
Species abbreviations are presented with the number of samples tested in parentheses. Herbarium voucher information: Pdac = dac1: cultivated, Kew, United Kingdom, MWC 1395 (K); dac2: cultivated, Elche, Spain, cv. ‘Zahidi’, MWC 1800/Barrow 77 (K); dac3: cultivated, Kew, MWC 1891 (K); dac4: cultivated, Kew, MWC 1398/Kew 1987-3379 (K); dac5: cultivated, Kew, MWC 1164 (K); dac6: feral, Gran Canaria, Pintaud 636 (G); dac7: cultivated Faisalabad, Pakistan, cv. ‘Khadrawy’, Pintaud 648 (G); Prec = rec1: Djibouti, Pintaud 642 (G); rec2: Zimbabwe, MWC 1874/Wilkin 724 (K); Proe = roe1: cultivated, Thailand, MWC 1161/Barrow 26 (K); roe2: cultivated, United Kingdom, MWC 1400/Kew 1987-530; Prup = rup1: cultivated, United Kingdom (from India), Pintaud 586 (G); rup2: Samchi, Bhutan, MWC 1162/Grierson and Long 3414 (K); Pthe = the1: cultivated, Sanremo, Italy, Pintaud 646 (G); Phyb = cultivated, Sanremo, Italy, no. 91005.
In cases where stepwise mutation occurs, the number of base pairs of the repeat unit is given.
Table 3.
Polymorphism characterization for 15 loci in Phoenix and 10 loci in Chamaerops.
| Phoenix all/Pdac/Prec | Phoenix dactylifera | Chamaerops humilis | |||||
| Locus | N | A | Ho | He | FIS | N | A |
| mPdIRD11 | 18/9/2 | 2/2/2 | — | — | — | — | — |
| mPdIRD13 | 700/560/25 | 10/2/4 | — | — | — | 7 | 4 |
| mPdIRD16 | 100/87/2 | 3/2/1 | — | — | — | 7 | 2 |
| mPdIRD20 | 100/87/2 | 5/1/2 | — | — | — | 7 | 5 |
| mPdIRD22 | 100/87/2 | 5/1/1 | — | — | — | — | — |
| mPdIRD25 | 300/108/60 | 5/4/2 | 0.29 | 0.42 | 0.31* | 51 | 3 |
| mPdIRD28 | 184/108/15 | 9/4/3 | 0.06 | 0.44 | 0.85* | — | — |
| mPdIRD30 | 83/28/15 | 4/3/2 | 0.11 | 0.10 | −0.04 | — | — |
| mPdIRD31 | 850/573/85 | 12/4/4 | 0.19 | 0.20 | 0.03 | 51 | 3 |
| mPdIRD32 | 186/108/15 | 6/1/4 | — | — | — | 51 | 2 |
| mPdIRD33 | 1000/618/85 | 12/4/8 | 0.19 | 0.23 | 0.16* | 51 | 12 |
| mPdIRD36 | 186/108/15 | 5/1/3 | — | — | — | 51 | 1 |
| mPdIRD40 | 1000/645/85 | 11/8/6 | 0.47 | 0.53 | 0.11* | 51 | 2 |
| mPdIRD43 | 100/87/2 | 2/2/1 | — | — | — | 7 | 1 |
| mPdIRD46 | 80/32/5 | 6/3/3 | — | — | — | — | — |
Note: A = number of alleles; FIS = fixation index for inbreeding within populations; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals tested; Pdac = Phoenix dactylifera; Phoenix all = all individuals of seven Phoenix species; Prec = Phoenix reclinata.
*Significant departure from Hardy–Weinberg equilibrium.
DNA from these individuals was extracted from freeze-dried or silica-dried leaf tissue. Samples were reduced into a fine powder using either an IKA A10 analytical grinder (IKA-Werke, Staufen, Germany) or a QIAGEN TissueLyser and QIAGEN DNeasy Plant Mini, Maxi, or 96-well kits (QIAGEN, Courtaboeuf, France). PCR reactions were performed in a thermocycler (Biometra GmbH, Göttingen, Germany, or Eppendorf AG, Hamburg, Germany) in a total reaction mixture of 25 μL, containing: 10 ng of total genomic DNA, 1× PCR buffer, 2 mM MgCl2, 200 μM dNTP, 0.5 U of Taq DNA polymerase, 0.4 pmol of the forward primer labeled with a 5′ M13 tail, 2 pmol of the reverse primer, and 2 pmol of the fluorochrome-marked M13 tail, plus sterile water to reach the final volume. The fluorochromes used were either 6-FAM, HEX, or TAMRA. The PCR parameters were as follows: denaturation for 2 min at 94°C; followed by six cycles at 94°C for 45 s, 60°C for 1 min, and 72°C for 1 min; then 30 cycles at 94°C for 45 s, 55°C for 1 min, and 72°C for 1.5 min; then 10 cycles at 94°C for 45 min, 53°C for 1 min, 72°C for 1.5 min; and a final elongation step at 72°C for 10 min.
The PCR products were processed on an ABI 3130XL Genetic Analyzer (Applied Biosystems, Foster City, California, USA). Allele size scoring was performed with respect to a noncommercial ladder using GeneMapper version 3.7 software (Applied Biosystems).
Genetic analyses (number of alleles, observed and expected heterozygosities, Wright’s fixation index [FIS] and its significance calculated using the permutation test) were conducted with GENETIX version 4.05 software (Belkhir et al., 2004).
Each of the 15 loci tested were polymorphic in at least one Phoenix species (Tables 2 and 3). The loci mPdIRD25, mPdIRD30, mPdIRD31, mPdIRD33, and mPdIRD40 were particularly suitable in P. dactylifera with three to eight alleles, having a clear stepwise mutation pattern in accordance with the microsatellite motif (tri- or hexanucleotide), and showing little to moderate heterozygosity deficit. The loci mPdIRD13, mPdIRD25, mPdIRD31, and mPdIRD33 were useful in Chamaerops humilis with three to 12 alleles, confirming good intergeneric transferability. In addition, mPdIRD25, mPdIRD31, and mPdIRD33 were amplified in Livistona carinensis and Hyphaene thebaica.
CONCLUSIONS
The loci described here are a useful addition to previously published microsatellite markers for palms. Their interspecific allelic differentiation makes them particularly suitable for hybrid and gene flow analysis within Phoenix. The most polymorphic loci can be added to other SSR loci to create marker sets for genetic diversity analysis in P. dactylifera and other species. Their transferability within the Coryphoideae subfamily will facilitate the study of species with limited molecular resources, such as Chamaerops humilis.
LITERATURE CITED
- Al-Dous E. K., George B., Al-Mahmoud M. E., Al-Jaber M. Y., Wang H., Salameh Y. M., Al-Azwani E. K., et al. 2011. De novo genome sequencing and comparative genomics of date palm (Phoenix dactylifera). Nature Biotechnology 29: 521–527 [DOI] [PubMed] [Google Scholar]
- Altschul S. F., Gish W., Miller W., Myers E. W., Lipman D. J. 1990. Basic local alignment search tool. Journal of Molecular Biology 215: 403–410 [DOI] [PubMed] [Google Scholar]
- Arabnezhad H., Bahar M., Mohammadi H. R., Latifian M. 2012. Development, characterization and use of microsatellite markers for germplasm analysis in date palm (Phoenix dactylifera L.). Scientia Horticulturae 134: 150–156 [Google Scholar]
- Belkhir K., Borsa P., Chikhi L., Raufaste N., Bonhomme F. 2004. GENETIX 4.05, logiciel sous WindowsTM pour la génétique des populations. Laboratoire Génome, Populations, Interactions, Université de Montpellier II, Montpellier, France [Google Scholar]
- Benson G. 1999. Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Research 27: 573–580 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Billotte N., Marseillac N., Brottier P., Noyer J.-L., Jacquemoud-Collet J.-P., Moreau C., Couvreur T., et al. 2004. Nuclear microsatellite markers for the date palm (Phoenix dactylifera L.): Characterization and utility across the genus Phoenix and in other palm genera. Molecular Ecology Notes 4: 256–258 [Google Scholar]
- Cherif E., Zehdi S., Castillo K., Chabrillange N., Abdoulkader S., Pintaud J.-C., Santoni S., Salhi-Hannachi A., et al. 2013. Male-specific DNA markers provide genetic evidence of an XY chromosome system, a recombination arrest and allow the tracing of paternal lineages in date palm. New Phytologist 197: 409–415 [DOI] [PubMed] [Google Scholar]
- Poncet V., Rondeau M., Tranchant C., Cayrel A., Hamon S., de Kochko A., Hamon P. 2006. SSR mining in coffee tree EST databases: Potential use of EST–SSRs as markers for the Coffea genus. Molecular Genetics and Genomics 276: 436–449 [DOI] [PubMed] [Google Scholar]
- Rozen S., Skaletsky H. J. 2000. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
- Zhao Y., Williams R., Prakash C. S., He G. 2012. Identification and characterization of gene-based SSR markers in date palm (Phoenix dactylifera L.). BMC Plant Biology 12: 237. [DOI] [PMC free article] [PubMed] [Google Scholar]