Abstract
• Premise of the study: A set of microsatellite markers were developed to characterize the level of genetic diversity and gene flow in two plant species endemic to the Qinghai–Tibet Plateau, Spiraea alpina and S. mongolica.
• Methods and Results: Using the Fast Isolation by AFLP of Sequences COntaining repeats (FIASCO) method, 16 microsatellite loci showed polymorphisms in both species. In two populations of each species, the number of alleles per locus ranged from three to 18 in S. alpina and from four to 30 in S. mongolica.
• Conclusions: These microsatellite markers provide an efficient tool for population genetic studies and will be used to assess the genetic diversity and spatial genetic structure of S. alpina and S. mongolica.
Keywords: gene flow, genetic diversity, microsatellite markers, population genetics, Qinghai–Tibet Plateau, Spiraea
Spiraea alpina Pall. and S. mongolica Maxim. (Rosaceae subfam. Spiraeoideae) are perennial shrubs, found in western China and some areas of Mongolia and Siberia. The two alpine plants usually grow on sunny slopes or ridges. They are widespread across the Qinghai–Tibet Plateau and adjacent highlands, at altitudes of 2000–4500 m (Lu et al., 2003). Due to high levels of morphological variation, the genus Spiraea L. has been classified in several ways by different authors into various subgenera, sections, and series (Lu et al., 2003; Potter et al., 2007). A recent phylogeographic analysis of cpDNA variations in S. alpina indicated that this alpine shrub survived in multiple refugia during the Last Glacial Maximum and that earlier glaciations may have triggered deep intraspecific divergence (Zhang et al., 2012). However, the phylogeographic analysis based on one uniparentally inherited cpDNA fragment may only partly recover the phylogeographic history of a species. Biparentally inherited simple sequence repeat (SSR) markers with more polymorphism and information are necessary for a better understanding of the genetic structure and phylogeographic history of S. alpina and S. mongolica. In this study, we isolated 16 polymorphic microsatellite primers to facilitate the investigation in further studies for these two species.
METHODS AND RESULTS
Total genomic DNA was extracted from silica gel–dried leaves of S. alpina following the cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle, 1987). Microsatellite loci from an enriched (AG)n library were isolated using the Fast Isolation by AFLP of Sequences COntaining Repeats (FIASCO) method with minor modifications (Zane et al., 2002). Approximately 300 ng of genomic DNA were completely digested with MseI (New England Biolabs, Beverly, Massachusetts, USA), and then ligated to an MseI AFLP adapter (5′-TACTCAGGACTCAT-3′/5′-GACGATGAGTCCTGAG-3′) using T4 DNA ligase (New England Biolabs). The diluted digestion-ligation mixture (1:10) was amplified with adapter-specific primers (5′-GATGAGTCCTGAGTAAN-3′). For enrichment, the PCR products were denatured at 95°C for 5 min, then hybridized with two 5′-biotinylated probes, (AC)15 and (AG)15, respectively, in a 250-μL hybridization solution (4× saline sodium citrate [SSC], 0.1% sodium dodecyl sulfate [SDS], 0.5 μmol/L probe) at 48°C for 2 h. Streptavidin-coated magnetic beads (New England Biolabs) were used to separate and capture the DNA fragments hybridized to the probe at room temperature for 20 min, followed by two washing steps: three times in TEN100 (10 mM Tris-HCl, 1 mM EDTA, 100 mM NaCl [pH 7.5]) for 8 min and three times in TEN1000 (10 mM Tris-HCl, 1 mM EDTA, 1 M NaCl [pH 7.5]) for 8 min. The separated single-stranded DNA fragments were amplified with adapter-specific primers as described above. The PCR products, after purification using a CASpure PCR Purification Kit (Sangon, Shanghai, China), were ligated into the pGEM-T Easy Vector (Promega Corporation, Madison, Wisconsin, USA) according to the manufacturer’s instructions, then transformed into Escherichia coli TOP10 competent cells (Trans Gen Biotech, Beijing, China). Transformants were plated, and insert-containing clones were selected by blue-white screening with ampicillin, X-Gal, and isopropyl-β-d-1-thiogalactopyranoside (IPTG). Positive clones were tested by PCR using (AC)10/(AG)10 and M13+/ M13− as primers.
Sequencing reactions and analysis of 120 positive clones were carried out with an ABI 3730xl DNA sequencer (Applied Biosystems, Foster City, California, USA), again following the manufacturer’s instructions. These sequences were analyzed for repeat motif regions of microsatellites using the software SSRHunter (Li and Wang, 2005). Of these, 78 clones had microsatellite motifs, and primers were designed with Primer3 software (Rozen and Skaletsky, 2000). Polymorphisms of all loci with designed primer pairs were assessed with 92 individuals in two populations of each species from Nangqian in Qinghai Province (population code: NQ) and Hongyuan in Sichuan Province (population code: HY), People’s Republic of China (Appendix 1). The PCR reactions were performed in a 15-μL reaction volume containing 0.8 μL of template DNA (10–100 ng), 1.5 μL of 10× buffer, 0.15 μL of dNTPs (10 mM each), 0.5 μL of each primer (10 mM), 5 U of Taq (TaKaRa Biotechnology Co., Dalian, China), and 11.4 μL of ddH2O. The PCR cycling profile included an initial step of 5 min at 95°C; followed by 30 cycles of 50 s at 94°C, 50 s at annealing temperature for each primer (Table 1), and extension for 30 s at 72°C; followed by a final extension step at 72°C for 7 min. PCR products were then electrophoresed by QIAxcel Advanced System (QIAGEN, Hilden, Germany). Out of the 60 primer pairs, 21 pairs generated amplification products of the expected sizes in which 16 primer pairs displayed polymorphisms among the populations of the two species (Table 1).
Table 1.
Characteristics of 16 microsatellite loci developed in Spiraea alpina and S. mongolica.
| Ta (°C) | ||||||
| Locus | Primer sequences (5′–3′) | Repeat motif | Fragment size (bp) | S. alpina | S. mongolica | GenBank accession no. |
| SA1 | F: ATGGCACGAACTATTGAATG | (GA)29 | 220–292 | 52 | 53 | KC894821 |
| R: GAATGACACGCAATCTATCC | ||||||
| SA2 | F: TCCACCACAAGCCCAGTC | (AG)17 | 128–168 | 53 | 53 | KC894833 |
| R: GAGTAACCCAATCACCACAG | ||||||
| SA3 | F: GTCAGCGTAATGCGGATG | (AG)20 | 234–280 | 53 | 53 | KC894822 |
| R: CACAAGGCACCACATAGG | ||||||
| SA4 | F: GGAGATCGGCTGAAGAAG | (AG)16 | 116–164 | 53 | 53 | KC894823 |
| R: CCACACCCAATCACAACT | ||||||
| SA5 | F: TTCACATCCAAGCAGTTCA | (GA)15 | 248–256 | 52 | 53 | KC894824 |
| R: GGTAAGCATCCAAGTCCAT | ||||||
| SA6 | F: GGACTTCTGTTCATACCATAC | (TC)40 | 280–320 | 51 | 51 | KC894825 |
| R: GTCAGCGTAATGCGAATG | ||||||
| SA7 | F: TCAATCGCACGACAATCC | (CT)8 | 120–160 | 53 | 53 | KC894834 |
| R: TCAAACCTCAAACCCTAAT | ||||||
| SA8 | F: GCGTCCAAGACTAATCCA | (TC)10 | 119–209 | 53 | 53 | KC894835 |
| R: ACCGCCTCAGAACTCACC | ||||||
| SA9 | F: ACGGACCTGCGGAGAATG | (GA)5 | 137–173 | 53 | 53 | KC894836 |
| R: CGCTCACAAACCCAACTAACA | ||||||
| SA10 | F: GTGAAACGAGCTGAAGGT | (AG)27 | 331–381 | 50 | 52 | KC894826 |
| R: GCCATCTTGGAGATATACGA | ||||||
| SA11 | F: CGAGGTGCTTCAAATTACAA | (AG)30 | 214–238 | 53 | 51 | KC894827 |
| R: ATGGAGGAGGATGCTTAGT | ||||||
| SA12 | F: CAATCGAAGAGTGAAGAAGAG | (AG)15 | 240–302 | 52 | 53 | KC894828 |
| R: CCTGGTTACTATAGCAATGGA | ||||||
| SA13 | F: CTGTTCAACCTACAATCCAA | (AG)30 | 172–228 | 51 | 54 | KC894830 |
| R: CCAGATCCTAACTACTATCGT | ||||||
| SA14 | F: AGAATGCTCGCTACCTGC | (TG)8 | 180–220 | 53 | 53 | KC894832 |
| R: GATGTTCGGGCTTGCTAC | ||||||
| SA15 | F: GCTTGGACGGATGGAGAT | (AG)18 | 160–250 | 52 | 54 | KC894829 |
| R: TCGCCAGTCTACTTGCTT | ||||||
| SA16 | F: CAGAGGGAAGGAGAAGTCA | (GA)20 | 186–250 | 50 | 50 | KC894831 |
| R: TCCGTCCAAAGTCATCGT | ||||||
Note: Ta = annealing temperature.
MICRO-CHECKER version 2.2.3 (van Oosterhout et al., 2004) was used to assess null alleles and scoring errors. The number of alleles per locus (A), observed (Ho) and expected heterozygosities (He), deviations from Hardy–Weinberg equilibrium (HWE), and linkage disequilibrium (LD) between all pairs of polymorphic loci were calculated with GENEPOP version 4.0.10 (Rousset, 2008). Across the two populations of S. alpina, A ranged from three to 18, Ho ranged from 0.043 to 0.870, and He ranged from 0.126 to 0.950. In S. mongolica, A ranged from four to 30, Ho ranged from 0.040 to 1.000, and He ranged from 0.544 to 0.968. Some loci showed significant deviation from HWE (Table 2)
Table 2.
Results of initial primer screening in four populations of Spiraea alpina and S. mongolica.a
| S. alpina | S. mongolica | |||||||||||||
| Population NQ (N = 22) | Population HY (N = 23) | Population NQ (N = 20) | Population HY (N = 27) | |||||||||||
| Locus | A | Ho | He | A | Ho | He | Null alleles | A | Ho | He | A | Ho | He | Null alleles |
| SA1 | 15 | 0.600 | 0.810 | 10 | 0.570 | 0.800 | No | 6 | 0.250 | 0.740 | 7 | 0.518 | 0.630 | Yes |
| SA2 | 3 | 0.000 | 0.250 | 4 | 0.087 | 0.126* | Yes | 18 | 1.000 | 0.833* | 25 | 0.700 | 0.940 | No |
| SA3 | 14 | 0.860 | 0.830* | 8 | 0.870 | 0.740 | No | 13 | 0.650 | 0.900 | 10 | 0.040 | 0.814 | No |
| SA4 | 4 | 0.000 | 0.318 | 3 | 0.000 | 0.240 | No | 14 | 0.800 | 0.900* | 19 | 0.788 | 0.888* | No |
| SA5 | 18 | 0.681 | 0.950 | 17 | 0.570 | 0.900 | No | 4 | 0.000 | 0.544 | 10 | 0.410 | 0.666 | No |
| SA6 | 13 | 0.863 | 0.830* | 12 | 0.600 | 0.863 | No | 10 | 0.650 | 0.824* | 10 | 0.260 | 0.814* | No |
| SA7 | 10 | 0.681 | 0.818 | 7 | 0.820 | 0.776 | No | 11 | 0.800 | 0.850* | 13 | 0.741 | 0.810 | No |
| SA8 | 9 | 0.045 | 0.809 | 8 | 0.130 | 0.420 | No | 15 | 0.850 | 0.863 | 22 | 0.518 | 0.883 | No |
| SA9 | 9 | 0.409 | 0.796 | 10 | 0.570 | 0.857 | No | 22 | 0.900 | 0.912* | 22 | 0.700 | 0.841 | No |
| SA10 | 13 | 0.455 | 0.763 | 8 | 0.470 | 0.590* | No | 25 | 1.000 | 0.968* | 30 | 1.000 | 0.963* | No |
| SA11 | 8 | 0.600 | 0.730 | 11 | 0.470 | 0.880 | No | 9 | 0.950 | 0.765* | 19 | 1.000 | 0.888* | No |
| SA12 | 18 | 0.410 | 0.825 | 13 | 0.520 | 0.862 | No | 15 | 0.800 | 0.810* | 14 | 0.666 | 0.800* | No |
| SA13 | 18 | 0.860 | 0.936 | 16 | 0.870 | 0.904 | No | 13 | 1.000 | 0.866* | 18 | 1.000 | 0.880* | No |
| SA14 | 4 | 0.000 | 0.568* | 4 | 0.000 | 0.652 | No | 17 | 0.866 | 0.913* | 25 | 1.000 | 0.954 | No |
| SA15 | 9 | 0.230 | 0.630 | 8 | 0.280 | 0.674 | No | 18 | 0.800 | 0.950* | 21 | 0.630 | 0.910 | No |
| SA16 | 3 | 0.000 | 0.248 | 3 | 0.043 | 0.270* | No | 18 | 0.700 | 0.900 | 20 | 0.333 | 0.764 | No |
| Mean | 10.50 | 0.418 | 0.694 | 8.87 | 0.430 | 0.659 | 14.25 | 0.751 | 0.846 | 17.80 | 0.644 | 0.840 | ||
Note: A = total number of alleles per locus; He = expected heterozygosity; Ho = observed heterozygosity; N = sample size for each population.
Locality information: NQ = Nangqian, Qinghai Province; HY = Hongyuan, Sichuan Province. See Appendix 1 for geographic coordinates and voucher information.
Significant departure from Hardy–Weinberg equilibrium at P < 0.01.
CONCLUSIONS
The SSR markers developed here are efficient to estimate genetic diversity in S. alpina and S. mongolica. Their use at larger spatial scales will provide detailed information about the distribution of genetic diversity in both species. Fine-scale genetic structure studies will enable us to estimate levels of historical gene flow in these species. Such information is useful for building and testing hypotheses on the history of the Qinghai–Tibet Plateau in response to climatic and geologic changes. The markers are also expected to be helpful in future studies of genetic variation and population ecology in these and other species in the subfamily Spiraeoideae.
Appendix 1.
Locality information for populations of Spiraea alpina and S. mongolica used in the study. The voucher specimens are deposited in the Herbarium of the Northwest Institute of Plateau Biology (HNWP), Xining, Qinghai Province, People’s Republic of China.
| Species | Population code | Population locality | Voucher no. | Geographic coordinates | Altitude (m) |
| S. alpina | NQ | Nangqian, Qinghai Province, China | Chensl6037 | 31°58′N, 96°30′E | 4320 |
| HY | Hongyuan, Sichuan Province, China | Chensl6099 | 32°46′N, 102°21′E | 3654 | |
| S. mongolica | NQ | Nangqian, Qinghai Province, China | Chensl6291 | 31°58′N, 96°30′E | 4320 |
| HY | Hongyuan, Sichuan Province, China | Chensl6109 | 31°58′N, 96°30′E | 3654 |
LITERATURE CITED
- Doyle J. J., Doyle J. L. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf material. Phytochemical Bulletin 19: 11–15 [Google Scholar]
- Li Q., Wang J. M. 2005. SSRHunter: Development of local searching software for SSR sites. Hereditas 27: 808–810 [PubMed] [Google Scholar]
- Lu L. D., Gu C. Z., Li C. L., Alexander C., Bartholomew B., Anthony R. B., Davide E. B., et al. 2003. Rosaceae. In Z. Y. Wu and P. H. Raven [eds.], Flora of China, vol. 9, 46–434. Science Press, Beijing, China, and Missouri Botanical Garden Press, St. Louis, Missouri, USA. [Google Scholar]
- Potter D., Eriksson T., Evans R. C., Oh S., Smedmark J. E. E., Morgan D. R., Kerr M., et al. 2007. Phylogeny and classification of Rosaceae. Plant Systematics and Evolution 266: 5–43 [Google Scholar]
- Rousset F. 2008. GENEPOP’007: A complete reimplementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103–106 [DOI] [PubMed] [Google Scholar]
- Rozen S., Skaletsky H. J. 2000. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
- van Oosterhout C., Hutchinson W. F., Wills D. P. M., Shipley P. 2004. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535–553 [Google Scholar]
- Zane L., Bargelloni L., Patarnello T. 2002. Strategies for microsatellite isolation: A review. Molecular Ecology 11: 1–16 [DOI] [PubMed] [Google Scholar]
- Zhang F. Q., Gao Q. B., Zhang D. J., Duan Y. Z., Li Y. H., Fu P. C., Xing R., et al. 2012. Phylogeography of Spiraea alpina (Rosaceae) in the Qinghai–Tibetan Plateau inferred from chloroplast DNA sequence variations. Journal of Systematics and Evolution 50: 276–283 [Google Scholar]