Abstract
• Premise of the study: A set of novel expressed sequence tag (EST) microsatellite markers was developed in Pinus sylvestris var. mongolica to promote further genetic studies in this species.
• Methods and Results: One hundred seventy-five EST–simple sequence repeat (SSR) primers were designed and synthesized for 31,653 isotigs based on P. tabuliformis EST sequences. The primer pairs were used to identify 25 polymorphic loci in 48 individuals. The number of alleles ranged from two to eight with observed and expected heterozygosity values of 0.0435 to 0.8125 and 0.0430 to 0.7820, respectively.
• Conclusions: These new polymorphic EST-SSR markers will be useful for assessing genetic diversity, molecular breeding and genetic improvement, and conservation of P. sylvestris var. mongolica.
Keywords: expressed sequence tag, Pinaceae, Pinus sylvestris var. mongolica, polymorphism, primer pairs, transcriptome sequencing
Pinus sylvestris L. var. mongolica Litv. (Pinaceae) is indigenous to the region north of the Greater Khingan Mountains and the Hulunbeier Grassland of the Inner Mongolia Autonomous Region (Zhu et al., 2006). This pine tree can live up to 150–200 yr and grow as tall as 15 m. It has strong cold resistance, enabling it to survive temperatures as low as –40°C, and is highly adaptable to various soil types with good growth on both barren and fertile land (Zhu et al., 2003). Pinus sylvestris var. mongolica is the best evergreen coniferous tree species for establishing windbreaks and providing sand fixation (Zhao et al., 2010). Due to these characteristics, it has economic and ecological benefits, and has been introduced and cultivated in many arid and semiarid regions of China, such as Chengde in Hebei Province (Zhao and Liu, 2007), Zhanggutai in Liaoning Province (Zeng et al., 2005), and Yulin in Shaanxi Province (Wang et al., 2009). This species originated from Honghuaerji in the Inner Mongolia Autonomous Region (Zhu et al., 2006). Molecular genetic studies have been few in number (Li et al., 2005), and no simple sequence repeats (SSRs) have been reported. To optimize the conservation and utilization of P. sylvestris var. mongolica, the development of expressed sequence tag (EST)–SSR markers is very useful for germplasm identification and research into the genetic diversity of this species.
Transcriptome sequencing is an efficient method for acquiring EST sequences. SSRs derived from EST sequences are more convenient and can be isolated with higher efficiency and at lower expense than genomic sequence SSRs (Wang et al., 2012). In a previous study, Niu et al. (2013) analyzed the evolution of genes in Pinus species and showed by clustering analysis that P. sylvestris var. mongolica is more closely related to P. tabuliformis Carrière than to three other Pinus species. Entries in PubMed (http://www.ncbi.nlm.nih.gov/pubmed) on Pinaceae SSRs account for only 0.42% of all entries related to SSRs to date (1 May 2013), and none of them focus on P. sylvestris var. mongolica. Because transcriptome sequence data are not available for P. sylvestris var. mongolica, we used the data available from P. tabuliformis to develop the markers described here. We developed and characterized 25 novel polymorphic EST-SSR markers for this species. These EST-SSR markers provide an important tool for the study of genetic diversity in P. sylvestris var. mongolica.
METHODS AND RESULTS
In total, 31,653 EST-SSR loci were identified in the transcriptome sequence data from the related species P. tabuliformis (SRA accession: SRA056887, http://www.ncbi.nlm.nih.gov/sra). The sequences were analyzed for potential SSRs using Simple Sequence Repeat Identification Tool (SSRIT) software (Temnykh et al., 2001; http://www.gramene.org/db/markers/ssrtool/). A set of 702 SSRs was identified that met a requirement for mono-, di-, tri-, tetra-, penta-, and hexanucleotide sequences with a minimum of 12, 6, 5, 5, 5, and 5 repeats, respectively. Among these, 175 SSRs were selected randomly for primer design, excluding the SSRs located at the loci termini. Primer pairs were designed using Primer Premier 5.0 software (PREMIER Biosoft International, Palo Alto, California, USA) (Wei et al., 2012) with the following criteria: primer lengths of 16–22 bp, GC content of 40–65%, annealing temperature (Ta) ranging from 40°C to 60°C, and a predicted PCR product size ranging from 100 to 500 bp.
Genomic DNA samples were isolated from the needles of 48 P. sylvestris var. mongolica plants using the advanced cetyltrimethylammonium bromide (CTAB) method (Porebski et al., 1997). The samples were collected from a single seed orchard in Qigou, Hebei Province (41°0′13″N, 118°27′38″E) and deposited at the National Engineering Laboratory for Forest Tree Breeding, China (NELFTB). All trees in the seed orchard derived from Honghuaerji in the Inner Mongolia Autonomous Region. PCR amplifications were performed in 20-μL volumes that included 50–80 ng of genomic DNA, 5 μM concentrations of each primer, and 10 μL 2× PCRMaster Mix consisting of 0.1 unit/μL Taq DNA polymerase, 4 mM MgCl2, and 0.4 mM dNTP (Aidlab Co. Ltd., Beijing, China). The PCR reactions were performed in a Veriti Dx 96-well Thermal Cycler (Applied Biosystems, Foster City, California, USA) under the following conditions: initial denaturation at 95°C for 5 min followed by 35 cycles at 95°C for 30 s, annealing for 45 s at the optimal temperature for each primer pair, and 72°C for 30 s, with a final extension of 10 min at 72°C (Table 1). PCR products were resolved on 6% polyacrylamide denaturing gels using an HT-CX01 gel sequencing cell (Hongtao Jiye Technology Development Co. Ltd., Beijing, China). SSR patterns were visualized by silver staining. The SSR fragment sizes were estimated by comparison with DNA marker I (Aidlab Co. Ltd.).
Table 1.
Characteristics of 25 EST-SSRs developed in Pinus sylvestris var. mongolica.
| Locus | Primer sequences (5′–3′) | Repeat motif | Expected size (bp) | Ta (°C) | GenBank accession no. |
| lw_isotig00542 | F: AACAGGAGCATATCAATCAA | (T)40 | 257 | 55 | KF501186 |
| R: GTGGCATTCTACAAGCAATT | |||||
| lw_isotig04204 | F: CTCCGTTTGGGTTGTGTTTG | (CGGCT)5 | 230 | 55 | KF501187 |
| R: ATCCTTGCCGCCAGATTTGT | |||||
| lw_isotig04600 | F: TCAGGGAAAATGTAGGAAAATG | (CAG)10 | 305 | 55 | KF501188 |
| R: AATCTGTTGTTGTGGGACTTGA | |||||
| lw_isotig06440 | F: GGGACAAGGGACATCG | (AGGTTG)5(AGGCTG)6 | 298 | 55 | KF501189 |
| R: TGGAGACTTCGGGTGC | |||||
| lw_isotig07383 | F: CAAACAAAAAACAGTCTGCA | (GAT)8 | 191 | 55 | KF501190 |
| R: ATCGTCATCATCATCGTCAC | |||||
| lw_isotig10603 | F: CAAAATCGTCTACTTCTCCCCC | (CAG)7 | 196 | 55 | KF501191 |
| R: CAAAGCAAAAGAACTCCAACGA | |||||
| lw_isotig17679 | F: TTGTTTGCCACATTGTTGCC | (TTAA)5 | 277 | 55 | KF501192 |
| R: CAAACCACCGCTGCTTCTAA | |||||
| lw_isotig21953 | F: ATGGTGTGTTTGAAGCGGAA | (ATGGG)7 | 208 | 55 | KF501193 |
| R: ATTGCAGCCACTGGTGTCTT | |||||
| lw_isotig26230 | F: GGGCATTACATAAACACGGG | (TA)10 | 260 | 55 | KF501194 |
| R: TGCCCTTGAGCATTTGATTA | |||||
| lw_isotig27940 | F: GCAGGCAACAACAAAAGTGACA | (TGGA)5 | 231 | 55 | KF501195 |
| R: AGCAATCGAGTGGCAAATCTTC | |||||
| lw_isotig00080 | F: CGGGCAAAATGACCGAAG | (CCG)6 | 177 | 55 | KF501196 |
| R: TGGAGGAGGTAGAGGGGG | |||||
| lw_isotig00081 | F: TGCGGAAGGCGTGAGTAG | (CCG)6 | 290 | 58 | KF501197 |
| R: TGGAGGAGGTAGAGGGGG | |||||
| lw_isotig01420 | F: TCCGTGACCCTATTACGT | (CTG)5 | 174 | 50 | KF501198 |
| R: CGATTAGTTGCTTGCCTT | |||||
| lw_isotig02138 | F: ATGCATCTTGTCCTCTCT | (AG)6 | 124 | 42 | KF501199 |
| R: TTCCTGATTCACACTCCC | |||||
| lw_isotig02347 | F: CTCGTCCTTCTTGTCCGC | (TG)7 | 198 | 50 | KF501200 |
| R: GCTATTGCTCCACTTGCC | |||||
| lw_isotig03088 | F: CATTTGGTTGACTTTGTT | (GA)6 | 235 | 45 | KF501201 |
| R: TTGTAGTGAGATCTGTGC | |||||
| lw_isotig04931 | F: TAGACCTCATCACAAACT | (AC)6 | 132 | 40 | KF501202 |
| R: ACAAAAACGAATACAAAT | |||||
| lw_isotig02842 | F: GTGATGGTGTGGTGGCTGTA | (AGA)5 | 229 | 55 | KF501203 |
| R: TCCTTTGTGGGAGATTGGTG | |||||
| lw_isotig04195 | F: GAGATCACCGAAACAACAAAA | (GAG)5 | 189 | 55 | KF501204 |
| R: TACAAGTCCCAGCAAAACAAT | |||||
| lw_isotig04306 | F: GCCATTTTTTTCTTCTCTCCT | (TCC)7 | 196 | 55 | KF501205 |
| R: GGTCGGTTTCTGAATTTCTAA | |||||
| lw_isotig05123 | F: TGTGCGTATAGGAGGTGGAG | (GAG)6 | 166 | 55 | KF501206 |
| R: ATGAAAGGTGACAAAGCGGT | |||||
| lw_isotig06215 | F: TCAGGTGCTTACCCCTTTTC | (CAA)5 | 275 | 55 | KF501207 |
| R: TGGCAGCTATTCCAGTCTTT | |||||
| lw_isotig11166 | F: ACACACACTGAGCTCCAATTT | (TA)7 | 137 | 55 | KF501208 |
| R: AGTCCCACCTCTGCTGATACA | |||||
| lw_isotig12667 | F: CCAAGGTGAAAAGGAAATGA | (CA)6 | 199 | 55 | KF501209 |
| R: TTCTGACAGGGAGCGACTGA | |||||
| lw_isotig20215 | F: AGAGGTGATCGCAGTCAAAGA | (TA)7 | 186 | 55 | KF501210 |
| R: TTCAAAAAGACCAAACCGTAG |
Note: Ta = annealing temperature.
One hundred seventy-five EST-SSR primer pairs were synthesized (Shanghai Sangon Co. Ltd., Beijing, China). Fifty-six primer pairs were identified that yielded stable, clear, and repeatable amplicons in P. sylvestris var. mongolica. The other primer pairs were unstable or gave no product. The 56 primers corresponded to 31 loci that were monomorphic (data not shown) and 25 loci that were polymorphic (Table 1). The polymorphic SSR loci were analyzed with POPGENE version 1.32 software (Yeh et al., 1999) for the number of alleles per locus (A), observed heterozygosity (Ho), expected heterozygosity (He), and fixation index (FIS). Detailed data are shown in Table 2. The A values ranged from two to eight with a mean of 3.12. The Ho and He values were 0.0435–0.8125 and 0.0430–0.7820 with averages of 0.3412 and 0.4027, respectively. The FIS values ranged from –0.2877 to 0.6773 with an average of 0.1175. Hardy–Weinberg equilibrium (HWE) and linkage disequilibrium using Bonferroni correction were tested for every locus. The following loci deviated significantly (P < 0.002) from HWE: lw_isotig27940, lw_isotig02138, lw_isotig04931, lw_isotig02842, lw_isotig11166, and lw_isotig12667. No linkage disequilibrium (P < 0.002) was detected among any loci.
Table 2.
Allelic diversity of 25 polymorphic EST-SSR loci in Pinus sylvestris var. mongolica.
| Locus | A | Ho | He | FIS |
| lw_isotig00542 | 2 | 0.4348 | 0.4816 | 0.0873 |
| lw_isotig04204 | 2 | 0.4375 | 0.3454 | −0.2800 |
| lw_isotig04600 | 3 | 0.1053 | 0.1021 | −0.0447 |
| lw_isotig06440 | 3 | 0.2083 | 0.1932 | −0.0897 |
| lw_isotig07383 | 3 | 0.3696 | 0.4728 | 0.2097 |
| lw_isotig10603 | 2 | 0.4375 | 0.4086 | −0.0821 |
| lw_isotig17679 | 3 | 0.4375 | 0.4432 | 0.0025 |
| lw_isotig21953 | 7 | 0.6250 | 0.7820 | 0.1924 |
| lw_isotig26230 | 3 | 0.3958 | 0.4629 | 0.1360 |
| lw_isotig27940 | 3 | 0.1778 | 0.5571 | 0.6773 |
| lw_isotig00080 | 3 | 0.2979 | 0.2919 | −0.0313 |
| lw_isotig00081 | 3 | 0.2128 | 0.2276 | 0.0553 |
| lw_isotig01420 | 3 | 0.7872 | 0.6179 | −0.2877 |
| lw_isotig02138 | 2 | 0.0571 | 0.1590 | 0.6354 |
| lw_isotig02347 | 2 | 0.0435 | 0.0430 | −0.0222 |
| lw_isotig03088 | 2 | 0.4545 | 0.5057 | 0.0909 |
| lw_isotig04931 | 4 | 0.4348 | 0.6350 | 0.3078 |
| lw_isotig02842 | 2 | 0.1250 | 0.3789 | 0.6667 |
| lw_isotig04195 | 4 | 0.4468 | 0.4221 | −0.0699 |
| lw_isotig04306 | 3 | 0.5000 | 0.4781 | −0.0569 |
| lw_isotig05123 | 2 | 0.1458 | 0.1366 | −0.0787 |
| lw_isotig06215 | 2 | 0.0625 | 0.0612 | −0.0323 |
| lw_isotig11166 | 5 | 0.2917 | 0.6252 | 0.5286 |
| lw_isotig12667 | 2 | 0.2292 | 0.4998 | 0.5366 |
| lw_isotig20215 | 8 | 0.8125 | 0.7371 | −0.1140 |
| Average | 3.12 | 0.3412 | 0.4027 | 0.1175 |
Note: A = number of alleles; FIS = fixation index; He = expected heterozygosity; Ho = observed heterozygosity.
To identify potential functions of the 25 SSR-associated unigenes, the sequences were aligned with the GenBank database using the BLASTX program (http://blast.ncbi.nlm.nih.gov/Blast.cgi) (Yang et al., 2012). The E-value was limited to 0–1.0E–5. Gene Ontology (GO) was also used to predict functions of the unigenes (http://geneontology.org/). Eighteen sequences were found to have potential functions by BLASTX or GO analysis. These sequences showed significant homology to protein sequences from Picea sitchensis (Bong.) Carrière, Picea glauca Voss, Selaginella moellendorffii Hieron., Vitis vinifera L., Cucumis sativus L., and Zea mays L. The potential functions were mainly related to ionic bonding, oxidation–reduction processes, and feedback regulation (Table 3).
Table 3.
Potential functions of the SSR-associated sequences in Pinus sylvestris var. mongolica.
| Locus | BLAST top hit accession no. | BLAST top hit description [organism] | E-value | GO_ID | Putative gene function |
| lw_isotig00542 | None | None | None | None | None |
| lw_isotig04204 | ABK21059.1 | Unknown [Picea sitchensis] | 2E-64 | None | None |
| lw_isotig04600 | XP_002273895 | PREDICTED: uncharacterized protein LOC100267221 [Vitis vinifera] | 2E-47 | None | None |
| lw_isotig06440 | None | None | None | None | None |
| lw_isotig07383 | XP_004154913 | PREDICTED: protein RCC2-like [Cucumis sativus] | 1E-25 | None | None |
| lw_isotig10603 | None | None | None | None | None |
| lw_isotig17679 | None | None | None | None | None |
| lw_isotig21953 | ADE76095.1 | Unknown [Picea sitchensis] | 7E-12 | None | None |
| lw_isotig26230 | None | None | None | None | None |
| lw_isotig27940 | None | None | None | None | None |
| lw_isotig00080 | ABA54143.1 | Putative glycine-rich protein [Picea glauca] | 1E-11 | GO:0046872 | Metal ion binding |
| GO:0008270 | Zinc ion binding | ||||
| GO:0006355 | Regulation of transcription, DNA-dependent | ||||
| GO:0003676 | Nucleic acid binding | ||||
| lw_isotig00081 | ABA54143.1 | Putative glycine-rich protein [Picea glauca] | 1E-11 | None | None |
| lw_isotig01420 | ACN39897.1 | Unknown [Picea sitchensis] | 2E-157 | GO:0055114 | Oxidation-reduction process |
| GO:0046872 | Metal ion binding | ||||
| GO:0020037 | Heme binding | ||||
| GO:0016705 | Oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen | ||||
| GO:0016491 | Oxidoreductase activity | ||||
| GO:0009055 | Electron carrier activity | ||||
| GO:0005506 | Iron ion binding | ||||
| lw_isotig02138 | XP_002971210.1 | Hypothetical protein SELMODRAFT_171829 [Selaginella moellendorffii] | 3E-107 | GO:0046872 | Metal ion binding |
| lw_isotig02347 | XP_002990606.1 | Hypothetical protein SELMODRAFT_448108 [Selaginella moellendorffii] | 2E-57 | None | None |
| lw_isotig03088 | XP_002266814.1 | PREDICTED: CCA-adding enzyme [Vitis vinifera] | 1E-118 | GO:0016779 | Nucleotidyltransferase activity |
| GO:0006396 | RNA processing | ||||
| GO:0003723 | RNA binding | ||||
| lw_isotig04931 | ABR16534.1 | Unknown [Picea sitchensis] | 2E-143 | None | None |
| lw_isotig02842 | ADE76527.1 | Unknown [Picea sitchensis] | 0 | None | None |
| lw_isotig04195 | ABK21301.1 | Unknown [Picea sitchensis] | 7E-80 | None | None |
| lw_isotig04306 | ABR17562.1 | Unknown [Picea sitchensis] | 1E-79 | None | None |
| lw_isotig05123 | ABK22664.1 | Unknown [Picea sitchensis] | 6E-165 | None | None |
| lw_isotig06215 | ABQ51222.1 | R2R3-MYB transcription factor MYB6 [Picea glauca] | 1E-127 | GO:0006355 | Regulation of transcription, DNA-dependent |
| GO:0005634 | Nucleus | ||||
| lw_isotig11166 | ABK23767.1 | Unknown [Picea sitchensis] | 2E-23 | GO:0009055 | Electron carrier activity |
| lw_isotig12667 | None | None | None | None | None |
| lw_isotig20215 | DAA51826.1 | TPA: hypothetical protein ZEAMMB73_014853 [Zea mays] | 2E-14 | GO:0055114 | Oxidation-reduction process |
| GO:0051536 | Iron-sulfur cluster binding | ||||
| GO:0050660 | Flavin adenine dinucleotide binding | ||||
| GO:0046872 | Metal ion binding | ||||
| GO:0016614 | Oxidoreductase activity, acting on CH-OH group of donors | ||||
| GO:0016491 | Oxidoreductase activity | ||||
| GO:0009055 | Electron carrier activity | ||||
| GO:0005506 | Iron ion binding | ||||
| GO:0003824 | Catalytic activity |
CONCLUSIONS
Very few SSR markers for P. sylvestris var. mongolica have previously been reported. Here we have developed 25 novel EST-SSR polymorphic markers for this species. The 25 markers provide an efficient tool for investigating population genetic diversity in different environments, as well as illuminating infraspecific phylogeography, mating systems, and gene flow in different populations. These new EST-SSRs will facilitate studies on molecular breeding, genetic improvement, and conservation of P. sylvestris var. mongolica.
LITERATURE CITED
- Li H. Y., Jiang J., Liu G. F., Ma X. J., Dong J. X., Lin S. J. 2005. Genetic variation and division of Pinus sylvestris provenances by ISSR markers. Journal of Forest Research 16: 216–218 [Google Scholar]
- Niu S. H., Li Z. X., Yuan H. W., Chen X. Y., Li Y., Li W. 2013. Transcriptome characterisation of Pinus tabuliformis and evolution of genes in the Pinus phylogeny. BMC Genomics 14: 263. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Porebski S., Bailey L., Baum B. 1997. Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Molecular Biology Reporter 15: 8–15 [Google Scholar]
- Temnykh S., DeClerck G., Lukashova A., Lipovich L., Cartinhour S., McCouch S. 2001. Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): Frequency, length variation, transposon associations, and genetic marker potential. Genome Research 11: 1441–1452 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang H. B., Pan P., Gao B. S. 2009. Key technologies of drought-resistant afforestation with Pinus sylvestris var. mongolica in Maowusu Sand Land. Journal of Northwest Forestry University 24: 70–73 [Google Scholar]
- Wang L. H., Zhang Y. X., Qi X. Q., Gao Y., Zhang X. R. 2012. Development and characterization of 59 polymorphic cDNA-SSR markers for the edible oil crop Sesamum indicum (Pedaliaceae). American Journal of Botany 99: e394–e398 [DOI] [PubMed] [Google Scholar]
- Wei Z. Z., Luo L. B., Zhang H. L., Xiong M., Wang X., Zhou D. 2012. Identification and characterization of 43 novel polymorphic EST-SSR markers for Arum lily, Zantedeschia aethiopica (Araceae). American Journal of Botany 99: e493–e497 [DOI] [PubMed] [Google Scholar]
- Yang A. H., Zhang J. J., Tian H., Yao X. H. 2012. Characterization of 39 novel EST-SSR markers for Liriodendron tulipifera and cross-species amplification in L. chinense (Magnoliaceae). American Journal of Botany 99: e460–e464 [DOI] [PubMed] [Google Scholar]
- Yeh F. C., Yang R. C., Boyle T. 1999. POPGENE version 1.32: Microsoft Windows–based freeware for population genetic analysis, quick user guide. Center for International Forestry Research, University of Alberta, Edmonton, Alberta, Canada [Google Scholar]
- Zeng D. H., Chen G. S., Chen F. S., Zhao Q., Ji X. Y. 2005. Foliar nutrients and their resorption efficiencies in four Pinus sylvestris var. mongolica plantations of different ages on sandy soil. Scientia Silvae Sinicae 41: 21–27 [Google Scholar]
- Zhao X. B., Liu G. Z. 2007. A review of studies of introduction cultivates and afforestation technology on Pinus sylvestris var. mongolica in sandy area. Journal of Northwest Forestry University 22: 86–89 [Google Scholar]
- Zhao X. B., Su S. P., Fu Y. R. 2010. Updating and transformation technology of inefficient wind-breaking and sand-fixing forests in Yulin Sandy Land. Journal of Northwest Forestry University 25: 104–106 [Google Scholar]
- Zhu J. J., Fan Z. P., Zeng D. H., Jiang F. Q., Matsuzaki T. 2003. Comparison of stand structure and growth between artificial and natural forests of Pinus sylvestiris var. mongolica on sandy land. Journal of Forest Research 14: 103–111 [Google Scholar]
- Zhu J. J., Tan H., Kang H. Z., Xu M. L. 2006. Natural regeneration characteristics of Pinus sylvestris var. mongolica forests on sandy land in Honghuaerji, China. Journal of Forest Research 17: 177–184 [Google Scholar]