Skip to main content
PMC home page
UKPMC Funders Author Manuscripts logoLink to UKPMC Funders Author Manuscripts
. Author manuscript; available in PMC: 2014 Aug 8.
Published in final edited form as: Herpetol J. 2013 Jul;23(3):175–178.

Characterization of seven new polymorphic microsatellite loci in the brilliant-thighed poison frog Allobates femoralis (Dendrobatidae), and their cross-species utility in three other dendrobatid species

Eva Ringler 1,2, Andrius Pašukonis 2, Walter Hödl 1, Max Ringler 1,3
PMCID: PMC4126724  EMSID: EMS59832  PMID: 25110383

Abstract

Here we document the development of seven novel polymorphic microsatellite markers for the brilliant-thighed poison frog Allobates femoralis (Dendrobatidae). We found between six and 27 alleles per locus in 100 individuals (50 males, 50 females) from the field site ‘Saut Pararé’, French Guiana, with an average observed heterozygosity of 0.79. One locus (Afem23) deviated significantly from Hardy–Weinberg equilibrium. We did not find any evidence for linkage disequilibrium among the new loci, or to seven of the already described markers for A. femoralis. We also report cross-species amplification of some of the markers in three other dendrobatid species (A. talamancae, Dendrobates tinctorius and Oophaga pumilio).

Keywords: Allobates femoralis, cross-species amplification, Dendrobatidae, microsatellite marker, polymorphic

The Neotropical poison frog Allobates femoralis (Dendrobatidae) has a pan-Amazonian distribution (Amézquita et al., 2009). Individuals of this species are rather small (approx. 27 mm snout-urostyle length, females slightly bigger than males, Ursprung et al., 2011a), do not possess highly toxic skin alkaloids (Lötters et al., 2007) and their appearance is rather cryptic. Males call from elevated structures on the forest floor to announce territory possession to male competitors and to attract females (Hödl et al., 2004). Pair formation, courtship and mating take place in the male’s territory (Roithmair, 1992; Ringler et al., 2009; Montanarin et al., 2011). Both sexes are highly iteroparous and polygamous within prolonged but rather discrete reproductive periods that coincide with the local rainy seasons (Ursprung et al., 2011a).

Previously developed microsatellite markers for A. femoralis served to investigate the genetic mating system of this species (Ursprung et al., 2011a), parental relatedness and individual reproductive success (Ringler et al., 2012a). Although ten microsatellite loci had been originally designed for A. femoralis (Jehle et al. 2008), only seven of those actually work for the population in French Guiana, and for two loci (Afem15 and Afem16) new primers had to be designed to enhance PCR amplification rates (see Ursprung et al., 2011a). This was likely due to the fact that markers were originally derived from individuals of a Brazilian population more than 800 km away (Amézquita et al., 2009), leading to sequence differences at primer binding sites. Microsatellite markers are a powerful tool to assess genetic differences on the individual and population level (Jehle & Arntzen, 2002; Selkoe & Toonen, 2006). However, their combined resolution capacity is strongly dependent on the number of markers used and their respective level of polymorphism (Kalinowski, 2002).

Here we describe the characteristics of seven new microsatellite loci for A. femoralis and assess their cross-species amplification in three other dendrobatid species: A. talamancae, another member of the subfamily Aromobatinae and Dendrobates tinctorius and Oophaga pumilio, two less closely related species from the sub-family Dendrobatinae (cf. Brown et al., 2011; Pyron & Wiens, 2011).

Tissue samples were collected via toe clipping of adult individuals (cf. Ursprung et al., 2011b) from the field station Saut Pararé situated in the nature reserve Les Nouragues, French Guiana (3°59′N, 52°35′W), which harbours a large population of A. femoralis (cf. Ursprung et al., 2011a). Toe clips were stored in absolute ethanol and individuals were immediately released where they were collected. Genomic DNA of 15 individuals was extracted using a phenol-chloroform protocol (Sambrook et al., 1989) and sent to Ecogenics GmbH (Zurich, Switzerland) to test twelve validated sets of compound primers for amplification from a previously established microsatellite library based on individuals from Brazil (Jehle et al., 2008). Five primer sets were discarded because they failed to amplify or led to multiple fragments. Seven of the tested microsatellite loci were polymorphic and produced consistent products across all 15 individuals.

For the characterization of these seven microsatellite loci we genotyped 100 individuals of A. femoralis (50 males, 50 females). We also checked for cross-species utility of the markers in the three other dendrobatid species A. talamancae (n=3), D. tinctorius (n=8) and O. pumilio (n=8). PCR amplifications were performed using reaction volumes of 10 μl containing about 10 ng of genomic DNA, 0.2 mm of each dNTP, 1 μm of each forward and reverse primer, 0.5 U of Taq DNA polymerase (Axon) and 1 μl of 10× NH4 reaction buffer (Axon), at a final concentration of 1.5 mmMgCl2. We used the following PCR programme: 5 min at 95 °C, 39 cycles at 95 °C for 45 s, the primer specific annealing temperature (Table 1) for 45 s, 72 °C for 45 s, followed by a final extension step for 5 min at 72 °C. Differences in the sizes of the amplified alleles and in the fluorescent dye labels of the primers allowed for pooling of multiple loci for the subsequent sequencing process. The pooled products were diluted with water 1:20, mixed with HiDiformamid and the internal size standard ROX500 (Applied Biosystems), and run on an ABI 3130xl Genetic Analyzer. Alleles were manually inspected with Peakscanner software (Applied Biosystems), and final allele sizes were determined using TANDEM v.1.08 (Matschiner & Salzburger, 2009). Number of alleles, observed and expected heterozygosities, and PIC values (mean polymorphic information content) were calculated using CERVUS v.3.0.3 (Kalinowski et al., 2007) and FSTAT v.2.9.3.2 (Goudet, 2001) was used for calculations of Hardy–Weinberg equilibrium and linkage disequilibria between all sets of loci. MICROCHECKER v.2.2.3 (van Oosterhout et al., 2004) was used to test for the possibility of scoring errors, allelic dropout and null alleles. The locus-specific primers, their optimized PCR conditions, and the characteristics of 100 A. femoralis genotypes are presented in Table 1. The program IDENTITY v.4.0 (Wagner & Sefc, 1999) was used to calculate the probability of identity (Paetkau et al., 1995) for different sets of loci.

Table 1.

Details of seven polymorphic microsatellite loci characterized in 100 A. femoralis individuals from French Guiana; k (number of alleles observed), AT (annealing temperature), Ho (observed heterozygosity), He (expected heterozygosity), PIC (mean polymorphic information content), PHWE (probability for deviation from Hardy–Weinberg equilibrium), P Null(van Oosterhout estimate for the frequency of null alleles at each locus).

Locus Repeat motif Dye and primer sequence (5′–3′) k Size range of amplified product (bp) AT (°C) H O HE PIC P HWE P Null GenBank
accession no
Afem04 (TAGA)7 F: HEX-GAGACGCCTGTTATAGATGGTG
R: TTAAAATGCACCGACACTGG		 21 248–336 56 0.95 0.919 0.908 NS −0.0213 KF021569
Afem20 (CA)15 F: TET-TCCTAAGCCAGAGGAAGCTG
R: ACAATCACATGCACCGAGTC		 6 139–151 56 0.73 0.72 0.669 NS −0.0083 KF021570
Afem22 (AGAC)9(AGAT)14 F: NED-ACCGTGGAGTGGTTGATGAG
R: CCTGCCAAGGATTGATAAGC		 23 162–258 56 0.949 0.938 0.929 NS −0.0094 KF021571
Afem23 (TAGA)8 F: FAM-AGGCAGAGATTGCAGAGAATG
R: GTGGCCATCTCCTGTTCATC		 9 219–279 56 0.273 0.66 0.596 ** 0.2689 KF021572
Afem24 (ATAG)13 F: NED-AAAGTAGGGTCGCAGCACTC
R: AGGTCAAGTCGGATGGTTTG		 25 177–293 56 0.878 0.943 0.935 NS 0.0323 KF021573
Afem25 (AC)15 F: HEX-GTAATCCCCCAATCCTGGTC
R: GATCCCGGCATCGTTAAG		 27 168–286 61 0.878 0.92 0.909 NS 0.0218 KF021574
Afem27 (AC)12 F: FAM-AACGCAAACACACCCTTAGC
R: ATCACTTGACATGGAATGACC		 24 163–245 56 0,9 0,947 0.938 NS 0.0214 KF021575
Open in a new tab

We detected six to 27 alleles per locus, with observed and expected heterozygosities ranging from 0.27 to 0.95 (mean=0.79) and 0.66 to 0.947 (mean=0.864), respectively. Only one (Afem23) out of the seven tested loci showed significant deviations from Hardy–Weinberg equilibrium (p-value for Fis within samples=0.0071, adjusted 5% nominal level=0.00714), which was likely due to the presence of null alleles. We did not find any evidence for linkage disequilibrium among the new loci, or to any of the seven previously published markers for A. femoralis. With the exception of locus Afem23, MICROCHECKER did not detect evidence for scoring errors due to stuttering, for large allele dropout, or for a high frequency of null alleles in any of the tested loci (van Oosterhout values are given in Table 1). We did not find any sex-specific differences in allele frequency or observed heterozygosity between males and females (Wilcoxon signed rank test, all p-values>0.05), thus assuming all loci to be autosomal.

The herein described microsatellite loci have similar properties than the previously published markers (old/new: mean alleles per locus=17.4/19.3; mean HE=0.85/0.86; c.f. Ursprung et al., 2011a). By increasing the number of markers from 7 to 14, the probability of identity decreased from PID[7]=4.93*10−11 to PID[14]=6.46*10−23 in the present dataset, or PID[13]=5.53*10−22 (omitting Afem23), respectively. Cross-species tests revealed that some loci are potentially useful in three other dendrobatid species, albeit showing much lower variability and amplification success (Table 2; cf. Ringler et al., 2012b).

Table 2.

Cross-species utility of 14 microsatellite loci in A. femoralis in A. talamancae, D. tinctorius and O. pumilio (n, number of tested individuals). When polymorphic, the numbers of alleles are given; m, multiple bands within one PCR product; x, no amplification.

Species n Afem05 Afem12 Afem09 Afem03 Afem15 Afem13 Afem16
A. talamancae 3 1 2 x 2 2 x x
D. tinctorius 8 1 3 x 2 2 x x
O. pumilio 8 1 3 x 2 4 x x
Species n Afem20 Afem22 Afem27 Afem25 Afem24 Afem23 Afem04
A. talamancae 3 2 m m 2 3 x x
D. tinctorius 8 4 m m 2 m 1 x
O. pumilio 8 4 m m 2 4 2 x
Open in a new tab

The integration of the described new microsatellite loci will significantly enhance the explanatory power of future genotype analyses in studies on fine-scale population genetic structure in A. femoralis. Furthermore, these markers are designed to be used as a reliable tool for individual identification in mark-recapture studies across the life-history stages of A. femoralis; i.e. genetic tracking of individuals from the larval to the adult stage.

Acknowledgements

Work in the lab was supported by the Austrian Science Fund (FWF): P24788-B22 (PI Eva Ringler, http://www.fwf.ac.at). Eva Ringler was further supported by a DOC-fFORTE scholarship and a L’ORÉAL Austria fellowship ‘For Women in Science’ from the Austrian Academy of Sciences. Permissions for collection and exportation of all A. femoralis samples were provided by the CNRS and the DEAL (sampling permission n°14 du 27 Fev 2012). Dendrobates tinctorius samples were already available from a previous project (permission n°2011-274). Thanks to Dennis Kollarits, who provided samples of A. talamancae (deceased pet frogs from captivity), and to Heike Pröhl for providing DNA samples of O. pumilio (sampling permissions from the Costa Rican and Panamanian authorities: 088-2004-OFAU and SE/A-87-04). We are very grateful to Philippe Gaucher for logistic support in French Guiana.

REFERENCES

  1. Amézquita A, Lima AP, Jehle R, Castellanos L, Ramos Ó , et al. Calls, colours, shape, and genes:a multi-trait approach to the study of geographic variation in the Amazonian frog Allobates femoralis. Biological Journal of the Linnean Society. 2009;98:826–838. [Google Scholar]
  2. Brown JL, Twomey E, Amézquita A, Barbosa de Souza M, Caldwell JP, Lötters S, von May R, Melo-Sampaio PR, Mejía-Vargas D, Perez-Peña P, Pepper M, Poelman EH, Sanchez-Rodriguez M, Summers K. A Taxonomic Revision of the Neotropical Poison Frog Genus Ranitomeya (Amphibia: Dendrobatidae) Zootaxa. 2011;3083:1–120. [Google Scholar]
  3. Goudet J. FSTAT, a program to estimate and test gene diversities and fixation indices (version 2.9.3) 2001 Available from http://www2.unil.ch/popgen/softwares/fstat.htm.
  4. Hödl W, Amézquita A, Narins PM. The role of call frequency and the auditory papillae in phonotacticbehavior in male dart-poison frogs Epipedobates femoralis (Dendrobatidae) Journal of Comparative Physiology A. 2004;190:823–829. doi: 10.1007/s00359-004-0536-1. [DOI] [PubMed] [Google Scholar]
  5. Jehle R, Arntzen JW. review: microsatellite markers in amphibian conservation genetics. Herpetological Journal. 2002;12:1–9. [Google Scholar]
  6. Jehle R, Gasser H, Pfunder M, Amézquita A, Lima AP, Hödl W. Ten polymorphic microsatellite loci for Allobates femoralis, an Amazonian dendrobatoid frog. Molecular Ecology Resources. 2008;8:1326–1328. doi: 10.1111/j.1755-0998.2008.02304.x. [DOI] [PubMed] [Google Scholar]
  7. Kalinowski ST. How many alleles per locus should be used to estimate genetic distances? Heredity. 2002;88:62–65. doi: 10.1038/sj.hdy.6800009. [DOI] [PubMed] [Google Scholar]
  8. Kalinowski ST, Taper ML, Marshall TC. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology. 2007;16:1099–1106. doi: 10.1111/j.1365-294X.2007.03089.x. [DOI] [PubMed] [Google Scholar]
  9. Lötters S, Jungfer K-H, Henkel FW, Schmidt W. Poison Frogs: Biology, Species & Captive Husbandry. Edition Chimaira; Frankfurt am Main: 2007. [Google Scholar]
  10. Matschiner M, Salzburger W. TANDEM: integrating automated allele binning into genetics and genomics workflows. Bioinformatics. 2009;25:1982–1983. doi: 10.1093/bioinformatics/btp303. [DOI] [PubMed] [Google Scholar]
  11. Montanarin A, Kaefer IL, Lima AP. Courtship and mating behaviour of the brilliant-thighed frog Allobates femoralis from Central Amazonia: implications for the study of a species complex. Ethology Ecology & Evolution. 2011;23:141–150. [Google Scholar]
  12. Paetkau D, Calvert W, Stirling I, Strobeck C. Microsatellite analysis of population structure in Canadian polar bears. Molecular Ecology. 1995;4:347–354. doi: 10.1111/j.1365-294x.1995.tb00227.x. [DOI] [PubMed] [Google Scholar]
  13. Pyron RA, Wiens JJ. A large-scale phylogeny of Amphibia including over 2800 species, and a revised classification of extant frogs, salamanders, and caecilians. Molecular Phylogenetics and Evolution. 2011;61:543–583. doi: 10.1016/j.ympev.2011.06.012. [DOI] [PubMed] [Google Scholar]
  14. Ringler M, Ursprung E, Hödl W. Site fidelity and patterns of short- and long-term movement in the brilliantthighed poison frog Allobates femoralis (Aromobatidae) Behavioral Ecology and Sociobiology. 2009;63:1281–1293. [Google Scholar]
  15. Ringler E, Ringler M, Jehle R, Hödl W. The Female Perspective of Mating in A. femoralis, a Territorial Frog with Paternal Care - A Spatial and Genetic Analysis. PLoS ONE. 2012a;7(6):e40237. doi: 10.1371/journal.pone.0040237. doi:10.1371/journal.pone.0040237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ringler E, Rojas B, Ringler M, Hödl W. Characterization of nine polymorphic microsatellite loci in the dyeing poison frog Dendrobates tinctorius (Dendrobatidae), and their cross-species utility in two other dendrobatoid species. Herpetological Journal. 2012b;22:263–265. [PMC free article] [PubMed] [Google Scholar]
  17. Roithmair ME. Territoriality and male mating success in the dart-poison frog, Epipedobates femoralis (Dendrobatidae, Anura) Ethology. 1992;92:331–343. [Google Scholar]
  18. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd edn Cold Spring Harbor Laboratory Press; New York: 1989. [Google Scholar]
  19. Selkoe KA, Toonen RJ. Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecology Letters. 2006;9:615–629. doi: 10.1111/j.1461-0248.2006.00889.x. [DOI] [PubMed] [Google Scholar]
  20. Ursprung E, Ringler M, Jehle R, Hödl W. Strong male/male competition allows for non choosy females: high levels of polygynandry in a territorial frog with paternal care. Molecular Ecology. 2011a;20:1759–1771. doi: 10.1111/j.1365-294X.2011.05056.x. [DOI] [PubMed] [Google Scholar]
  21. Ursprung E, Ringler M, Jehle R, Hödl W. Toe regeneration in the Neotropical frog Allobates femoralis (Aromobatidae) Herpetological Journal. 2011b;21:83–86. [Google Scholar]
  22. van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P. Micro-checker: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes. 2004;4:535–538. [Google Scholar]
  23. Wagner HW, Sefc KM. IDENTITY 1.0. Centre for Applied Genetics, University of Agricultural Sciences Vienna (version 4.0) 1999 Available from http://www.uni-graz.at/~sefck.

RESOURCES