Birth of a healthy boy after PGD for X-linked heterotaxy syndrome

Introduction

Heterotaxy syndrome is a clinically and genetically heterogeneous rare disorder included in the group of congenital heart diseases (CHD). The word heterotaxy comes from the Greek “heteros”, meaning “different”; and “taxis”, meaning “arrangement”. The thoracic and visceral organs (including the heart, liver, lungs, spleen, and stomach) have an abnormal placement, as they are situated randomly with respect to the left-right axis and with respect to one another [20].

The inheritance pattern of the disease is heterogeneous, as it could be autosomal recessive, autosomal dominant or X-linked. At least six different disease-causing genes have been identified [3, 13, 20] and one novel candidate has been determined [15]. Mutations in the zinc finger transcription factor gene (ZIC3, MIM *300265) cause the X-linked heterotaxy syndrome (OMIM #306955) [7], which accounts for less than 5 % of sporadic heterotaxy cases. Female carriers in the reported familial cases are usually asymptomatic, although in one case they presented phenotype [20]. The estimated prevalence is unclear, ranging from 2.5/10000 to 1/15000 (from Orphanet reports series, November 2012) [14].

Affected patients present high morbidity and mortality resulting from a wide variety of congenital defects, as they typically present complex cardiovascular malformations. Clinical diagnosis and surgical treatment for patients have improved recently. However, survival rates of patients undergoing surgery are not satisfactory. In this context, preimplantation genetic diagnosis (PGD) has been proved over the years to be a valid reproductive option for couples carrying a genetic disorder who wish to have offspring free of the disease, avoiding the traumatic termination of pregnancy (TOP). Since its first application in 1990 [8], PGD has been made available for a large number of rare genetic disorders [16] and the number of cycles continuously increases year by year [9].

The aim of this paper is to show, for the first time, the successful application of PGD for X-linked heterotaxy, resulting in the birth of a healthy boy.

Case report

Family history

The couple composed of a 35 year-old woman and a 35 year-old man attended genetic counseling after three pregnancies affected of heterotaxy syndrome, that were terminated (Fig. 1). Consanguinity was not referred. The first pregnancy was a male foetus with asplenia, persistent bilateral superior vena cava, right pulmonary isomerism, congenital cardiopathy with dextrocardia and transposition of great arteries. The second pregnancy was a healthy girl, but she had not been studied at the time of consultation. The third pregnancy was a male foetus with congenital cardiopathy and lateralization defects. After clinical diagnosis of both foetuses, as they were affected males and the second pregnancy an asymptomatic girl, a recessive X-linked heterotaxy syndrome was suspected. The study of the ZIC3 gene on foetal remains revealed the mutation c.842_843delAT (p.His281ArgfsX62) in exon 1 in hemizygosis. This mutation creates a premature stop-codon either leading to nonsense-mediated decay of aberrant RNA or a truncated ZIC3 protein, eliminating all important Zinc-Finger (ZF) protein domains. ZF2 and ZF3 domains are responsible for transportation of the ZIC3 protein to the nucleus, where it acts as a transactivation regulator. Therefore, elimination of these domains will eliminate this transport. This mutation had not been previously described in any database as pathogenic. Nevertheless, due to its deleterious effect and highly severe clinical phenotype, it was determined as the disease-causing mutation.

Fig. 1.

Genealogical tree of the family requesting preimplantation genetic diagnosis for X-linked heterotaxy syndrome. The arrow indicates the consultant patient. The asterisk indicates the family members involved in the informativity study. The grandmother was studied and did not carry the mutation. The woman’s sisters, father and daughter had not been studied at the time of consultation

The woman was studied and the same mutation was identified in heterozygosis, proving to be an asymptomatic carrier of X-linked heterotaxy syndrome. Her mother, who did not refer any abortions due to lateralization defects, was also studied, but she did not carry the mutation. According to literature, hemyzigous males carrying a mutation in the ZIC3 gene always show clinical symptoms [20]. For this reason, it was supposed that it could be a de novo mutation, as the father did not show any clinical symptoms. However, as he was not studied at the time of consultation, genetic testing was recommended, in order to ascertain if there was a genetic risk for the sisters. Incomplete penetrance in hemizygous males has been reported previously [12].

A fourth spontaneous male pregnancy underwent prenatal diagnosis of chorionic villus sampling, confirming the presence of the mutation c.842_843delAT (p.His281Arg fsX62) in exon 1 in hemizygosis. This pregnancy was also terminated.

The complete PGD process was explained to the patients and their queries were answered. The couple signed an informed consent form for PGD testing.

Materials and methods

Preclinical studies and lymphocyte validation were performed prior to the in vitro fertilization (IVF) cycle, following recommended international guidelines on PGD [10], and the norm UNE-EN ISO 9001:2000 [11, 18]. Blood samples in EDTA were requested from both members of the couple. Also, DNA sample from one of the foetus and buccal swabs from the healthy daughter were provided. DNA extraction from blood and buccal swabs was carried out using the QIAcube System (QIAgen, Germany) following the manufacturer’s instructions. PCR was first performed on genomic DNA to confirm the mutation and to determine the informative short tandem repeat (STR) markers, then on 1 ng of diluted genomic DNA in a heminested multiplex PCR with the informative STR markers and finally on single lymphocytes collected from both parents with the same PCR conditions that worked for 1 ng of genomic DNA. Oligonucleotides were tested in order to discard possible human DNA contamination.

Fifteen STR markers closely linked to the ZIC3 gene were tested and the AMELX gene was used in order to know the number of expected alleles. The molecular analysis protocol was the same for lymphocytes (preclinical set-up) and blastomeres (clinical PGD cycle). Single cells were isolated and lysed as previously described [5]. PCR amplification was performed using the outer and inner oligonucleotide primers listed in Table 1. First round multiplex PCR containing the external primers was carried out in a total volume of 25 μL containing 200 μM dNTP, 1.5 mM MgCl2, 1X PCR buffer, 1 unit Go-Taq Hot Start polymerase (Promega, U.S.A.) and 0.4 μM each of the outer forward and reverse primers. One microlitre from the first round PCR was used as template for separate second round PCR reactions with fluorescently labelled inner forward and reverse primers in a total volume of 10 μL. PCR reactions were undertaken using a TProffesional standard Thermocycler (Biometra, Germany).

Table 1.

Primer sequences used for preimplantation genetic diagnosis of X-linked heterotaxy

Name	Heterozygosity (%)	Gene distance (Mb)	Primer sequences
ZIC3-E1	N/A	N/A	Fout: 5′ CAGCCTATCAAGCAGGAGC 3′
			R: 5′CTTCGCCTTGAAAGACTTGC 3′
			Fin: 5′ 6FAM-CCAAGAAGAGCTGCGACCG 3′
DXS691a	uk	1.25	Fout: 5′GCTATTGGCTGTGTAATGGA 3′
			R: 5′GTTACACTCTTTCAGCCAGC 3′
			Fin: 5′6FAM-TATGGGTAGGTTTGGGTTG 3′
DXS8094a	0.77	0.41	Fout: 5′GAGAAAACATCCAGCACAATG 3′
			R: 5′GAGTCACTGTCTCTTAGGGTC 3′
			Fin: 5′ 6FAM-GCAATGTCACCATTAACAGTTTG 3′
DXS1211a	0.64	1.65	Fout. 5′CATCTCCAGAGCGGTAGGAT 3′
			R: 5′GCAAGTCTGTCCAAGACCT 3′
			Fin. 5′ 6FAM-CATTCCCCTCCAATCTGGCAG 3′
DXS1062a	0.75	0.64	Fout: 5′GAGATGTGTGACCTTGAGCAC 3′
			R: 5′GTTGCCTGTTAAGCACTTTG 3′
			Fin: 5′ 6FAM-AGTAGCACCCACCTAATAG 3′
AMELX	N/A	N/A	Fout: 5′ACCTCATCCTGGGCACCCTGG 3′
			R: 5′ATCAGAGCTTAAACTGGGAAGCTG 3′
			Fin: 5′NED-CCCTGGGCTCTGTAAAGAATAGTG 3′

Fout forward outer primer; Fin forward inner primer; R reverse primer; N/A not applicable; uk unknown

^aRosen, N., V. Chalifa-Caspi, O. Shmueli, A. Adato, M. Lapidot, J. Stampnitzky, M. Safran, and D. Lancet (2003). GeneLoc: Exon-based integration of human genome maps. Bioinformatics 19(S1)

URL: http://genecards.weizmann.ac.il/geneloc

Seventeen thermal cycles were performed for the outer primers and 30 for the inner primers at 95 °C for 1 min, 55 °C for 45 s, and 72 °C for 1 min. The cycling was preceded by a 5 min initial denaturation step at 95 °C and ended with an additional elongation step of 7 min at 72 °C. Amplified inner products were electrophoresed in an automated genetic analyser ABI 3730xl (Applied Biosystems, USA). Results were analysed with the Genemapper v3.7 software (Applied Biosystems, USA).

Respecting the IVF cycle, the patient received a routine superovulation procedure based on the long protocol of down-regulation with gonadotrophin-releasing hormone agonist and ovarian stimulation with recombinant follicle stimulant hormone for 12 days [2]. Twenty nine mature oocytes were obtained, and 24 two-pronucleus zygotes were produced after intracytoplasmic sperm injection. In order to avoid ovarian hyperstimulation syndrome, all embryos were cryopreserved at pronuclear stage and PGD was cancelled. In the next menstrual cycle, endometrial preparation was done with oestrogen and progesterone administered in a sequential regime. Frozen-thawed embryo transfer was planned when the endometrium was 9 mm thick. After thawing, 23 zygotes survived and 15 cleaving embryos were available for biopsy on day +3. Biopsy procedures were performed according to previously described protocols [1].

Results

Eleven STR markers resulted informative. Therefore, the two closest markers upstream (DXS691 and DXS8094) and downstream (DXS1062 and DXS1211) of the gene were chosen. The order with respect to the ZIC3 gene is shown in Fig. 2. Once the diagnosis strategy to detect the c.842_843delAT mutation in the ZIC3 gene was established, validation of the technique was carried out with 25 single isolated lymphocytes from each parent. Amplification failure and allelic drop out (ADO- the random non-amplification of one of the alleles in a heterozygous sample) rates for each PCR amplicon were estimated. ADO rates were 0 % (0/25) for c.842_843delAT mutation and 0 % (0/25) for each the STR markers and the AMELX gene. PCR efficiency for each amplicon was 100 % (50/50) excepting DXS691, where it was 99.98 % (49/50).

Fig. 2.

Location of the short tandem repeat markers tested in the preclinical work-up with respect to the ZIC3 gene on chromosome Xq26.3. The two closest informative markers upstream and downstream to the gene (DXS691, DXS8094, DXS1062 and DXS1211) were selected to support the diagnosis in the PGD cycle. Distance to the gene is stated in megabases (Mb)

Fifteen embryos were biopsied obtaining 16 single blastomeres. Amplification failed in 11 single blastomeres. Five blastomeres from four embryos were successfully analysed. Total ADO and amplification efficiency rates were 26 % (6/23) and 77 % (23/30) respectively. Three embryos were diagnosed: two carriers and one healthy. One of the embryos presented either ADO of the AMELX gene or ADO of the paternal chromosome and could not be diagnosed. Two embryos (embryo no. 3 and 9) reached the blastocyst stage and embryo number 3 was transferred. A single pregnancy was achieved, resulting in a healthy birth. Prenatal diagnosis to confirm the PGD results was recommended. However, it was not performed, although the patient was exhaustively controlled by echography.

Discussion

In the last two decades, surgical approaches for the problems derived from heterotaxy syndrome have improved significantly. However, a large proportion of patients do not undergo any operation due to complex manifestations of the syndrome where surgical mortality is high and outcome uncertain [4]. Also, these approaches require aggressive neonatal interventions, careful management in every phase of the disease and frequent re-interventions. In the case presented, the couple had three TOP. As they wished to have more offspring, PGD was offered as the best reproductive alternative for them, as they did not want any more pregnancies to be terminated.

Nowadays, PGD for single-gene disorders is considered as a routine alternative to prenatal diagnosis, and several strategies have been reviewed thoroughly [17]. In all cases, preconception genetic counselling is necessary, especially in rare syndromes with genetic heterogeneity like heterotaxy. Inheritance and clinic information compiled from the couple allows orientating the genetic diagnosis, crucial aspects prior to preimplantation/prenatal decisions [6, 19].

In this case, a direct approach was decided. This is not obvious in cases of X-linked disorders. Molecular genotyping of single blastomeres supported with STR-haplotyping analyses represent an accurate option, unlike sex selection or indirect PGD based on haplotyping. In cases of X-linked disorders, when the disease-causing mutation is diagnosed, a direct genotyping approach offers clear advantages: healthy male embryos are identified, genetic status of female embryos (strictly healthy or asymptomatic carriers) is established, and recombination events could be detected reducing the risk of misdiagnosis.

Before couples undergo PGD cycle, it is compulsory to perform a preclinical work-up. In this particular case, PGD was limited at the time of consultation as the female carried a suspected de novo mutation and the genetic status of her daughter was unknown. In this scenario, the maternal family was non-informative and a haplotyping strategy was inadequate because the disease-bearing haplotype could not be established a priori [17]. In order to overcome this limitation, a genetic study of the ZIC3 gene was performed on foetal remains from affected pregnancies. This genetic information was confirmed on the mother, and on buccal swabs from the daughter. Thus, more than one meiosis was involved in the preclinical work-up as recommended in the ESHRE Guidelines for molecular PGD cases [10]. The daughter’s genetic status (healthy or carrier) was not revealed to the family due to controversial decisions regarding genetic studies on minors.

In conclusion, a successful protocol for X-linked heterotaxy syndrome was developed, resulting in the birth of a healthy boy. In extremely rare conditions, a case by case strategy is the gold standard option for couples at risk where the disease-causing mutation is known.