Abstract
Oral verrucous carcinoma (OVC) is one malignant tumor which was carved out from the oral squamous cell carcinoma (OSCC). However, the clinical and pathological features as well as the treatment strategies of OVC are different from OSCC. Here, global transcript abundance of tumor tissues from five patients with primary OVC and six patients with primary OSCC including their matched adjacently normal oral mucosa were profiled using the Affymetrix HGU133 Plus 2.0. Ingenuity Systems IPA software was used to analyse the gene function and biological pathways. There were 109 differentially expressed genes (more than 2-fold) between OVC and the adjacently normal tissue, among them 66 were up-regulated and 43 were down-regulated; 1172 differentially expressed genes (more than 2-fold) between OSCC and the adjacently normal tissue, among them 608 were up-regulated and 564 were down-regulated. There were 39 common differentially expressed genes in OVC and OSCC compared with their matched normal oral mucosa, among them 22 up-regulated and 17 down-regulated, and 8 of them different between OVC and OSCC. In addition, the gene expression profile was further validated by quantitative real-time PCR (Q-RT-PCR) analysis for four of those 39 selected genes.
Keywords: Oral verrucous carcinoma, oral squamous cell carcinoma, biological pathways, expression profile, quantitative real-time PCR
Introduction
Verrucous carcinoma is a special form of squamous cell carcinoma with its own clinical and histological features. It was first described as a different entity of tumor from squamous cell carcinoma by Lauren V. Ackermann in 1948, so verrucous carcinoma is also known as “Verrucous carcinoma of Ackermann” or “Ackermann’s tumor” [1]. Verrucous carcinoma frequently affects multiple organs and tissues including the oral mucosa, esophagus, leg, temporal bone, eye, penis, buttocks, foot, toe, skin, hand etc. [2-9]. Oral cavity is the most common site for verrucous carcinoma, which is thus called Oral Verrucous Carcinoma (OVC). OVC is slow growing, locally invasive and is not supposed to metastasize, but it can grow very large and can destroy adjacent tissue such as bone and cartilage [10], and some cases have local lymphatic metastases and recurrence [11]. The diagnosis of OVC is established by close communication between surgeons and pathologists. Like oral squamous cell carcinoma (OSCC), surgery is considered as the treatment of choice, but it is not thought to be necessary to perform a neck dissection [12,13]. Nonetheless, the molecular mechanisms of OVC remain unclear. Recent research has shown that there were some genes differentially expressed between OVC and OSCC, such as αB-crystallin [14], matrix metalloproteinase-2 [15], matrix metalloproteinase-9 [16] and vascular endothelial growth factor [16], but there is no overall study on OVC and OSCC. The aim of the present study was to identify differential gene expression profiles between OVC and OSCC and find new possible molecular biomarkers genes in OVC, which was useful for the clinical diagnosis and therapies.
Materials and methods
Patients and samples
We collected the primary cancer and the matched normal oral mucosa tissues obtained from 5 patients with OVC and 6 patients with oral squamous cell carcinomas (OSCC). All the patients underwent surgery from January 2007 to December 2009 in Xiangya Hospital, Central South University. Consent was taken from all the patients after getting the institutional ethical approval. The selected patients did not receive any preoperative chemotherapy or radiotherapy or experience any other cancer. Each sample was confirmed by pathologic analysis and anonymized prior to the study. Two samples of 1 cm size were immediately cut (within 15 minutes) from the tumor resected by a standard surgical procedure, snap frozen in liquid nitrogen, and stored at -80°C until use. The clinicopathological features of patients are shown in Table 1. Written informed consent was acquired from all participants in this study, according to the declaration of Helsinki. The study was reviewed and approved by the Medical Ethics Committee of the Changsha Xiangya Hospital.
Table 1.
Clinical and pathological features of patients
| Case | Diagnosis | Primary Site | Age | Sex |
|---|---|---|---|---|
| 1 | OVC | lower lip | 48 | Male |
| 2 | OVC | gingiva | 45 | Male |
| 3 | OVC | gingiva | 53 | Male |
| 4 | OVC | gingiva | 63 | Male |
| 5 | OVC | tongue | 46 | Male |
| 6 | OSCC | tongue | 63 | Male |
| 7 | OSCC | lower lip | 53 | Male |
| 8 | OSCC | tongue | 68 | Male |
| 9 | OSCC | gingiva | 60 | Female |
| 10 | OSCC | buccal | 45 | Male |
| 11 | OSCC | gingiva | 46 | Male |
Total RNA isolation
Total RNA was isolated from the frozen tissues using the TRIzolReagant (Invitrogen Life Technologies, Carlsbad, CA; P/N 15596-018) according to the manufacturer’s protocol. The aqueous phase containing the RNA separated from the TRIzol reagent was further purified using the RNeasyMinElute Cleanup Kit (Qiagen, Valencia, CA; 74204). The quality of total RNA was then assessed by agarose gel electrophoresis of A260/280 ratio and by analysison the Bioanalyser 2100 (Agilent).
Target sample preparation
One microgram of total RNA was first reverse transcribed using a T7-Oligo (dT) Promoter Primer in the first-strand cDNA synthesis reaction. Following RNase H-mediated second-strand cDNA synthesis, the double-stranded cDNA is purified and serves as a template in the subsequent in vitro transcription (IVT) reaction. The IVT reaction is carried out in the presence of T7 RNA Polymerase and a biotinylated nucleotide analog/ribonucleotide mix for complementary RNA (cRNA) amplification and biotin labeling. The biotinylated cRNA targets are then cleaned up, fragmented, and hybridized to GeneChip expression arrays.
Microarray hybridization and processing
Gene expression profiling was performed using the HGU133 Plus 2.0 Affymetrix GeneChip platform, this microarrays contain approximately 38,500 genes profiled (47,000 distinct transcripts assayed). Hybridization with the biotin-labeled RNA, staining and scanning of the HGU133 Plus 2.0 chips followed the prescribed procedure outlined in the Affymetrix technical manual. Hybridization was performed at 45°C for 16 hour using the Hybridization Oven 640 (Affymetrix). Washing and staining was done using Fluidics Station 450 (Affymetrix). Images were acquired using the Affymetrix Gene Array scanner. Images were acquired using the GeneArray scanner 3000 5 (Affymetrix).
Microarray data analysis
Scanned output files were visually inspected for hybridization artifacts, the statistical analysis of microarrays method was used to do the data preprocessing, include masking and background subtraction. Then used the preprocesseddata did the signal value (expression values) calculated, and get the p-value and fold change. Genes exhibiting marked differences (fold change >2 or <0.05) of expression between two analyzed groups were selected by SAM application supplied by Multi Experiment Viewer. The IPA software was used for network analyses.
Confirmatory Q-RT-PCR analysis
We quantified the expression of 4 genes by Q-RT-PCR analysis: MMP1, SERINE1, MAL and DNASE1L3. Total RNA was performed as described above. Reverse transcription (RT) was carried out using Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) after pretreatment with RNase-free DNase I (Roche, Indianapolis, IN, USA). The primer sequences for each gene are shown in Table 2, all primers were designed using the IDT SciTools software (http://www.idtdna.com/SciTools/SciTools.aspx) and are synthesized by Invitrogen. Actin acted as endogenous control and all the samples were assayed in duplicate. The SPSS/PC software package version 17.0 was used for collection, processing, and statistical data analysis. Statistical analysis was performed using the non-parametrical Wilcoxon test for comparison of paired samples. p<0.05 values were considered statistically significant.
Table 2.
Primers used for RT-qPCR to verify array-identified genes
| Gene | Primer | Sequence (5’→3’) | Amplification Size |
|---|---|---|---|
| MMP1 | F | GTGCTACACGGATACCCCAAG | 205 |
| R | GGCCAATTCCAGGAAAGTCAT | ||
| SERINE1 | F | GCGCTGTCAAGAAGACCCA | 242 |
| R | AACACCCTCACCCCGAAGT | ||
| MAL | F | GTCACCTTGGACGCAGCCTA | 249 |
| R | AACACCATCTGGGTTTTCAGC | ||
| DNASE1L3 | F | GAGCCCTTTGTGGTCTGGTT | 159 |
| R | AATGAAATTCTCCGCCTTCC | ||
| GAPDH | F | TGTTGCCATCAATGACCCCTT | 202 |
| R | CTCCACGACGTACTCAGCG |
Results
Differentially expressed genes in OVC vs matched normal oral mucosa
Gene expression analysis revealed a total of 109 altered genes (genes that were over or under-expressed more than 2-fold) with 66 up-regulated and 43 down-regulated genes in OVC compared with it’s matched normal oral mucosa (OVCN). Functionally analyzed build on the existing pathway using the IPA knowledge base, the network with the highest score (network 1, score = 53) was generated with 24 focus genes. The first 5 Associated Network Functions altered genes are shown in Table 3.
Table 3.
The first 5 Associated Network Functions altered genes in OVC vs matched normal oral mucosa
| Network | Genes in Ingenuity networks1 | Function | Score2 | Focus molecules |
|---|---|---|---|---|
| 1 | CCR7, CD1C, CDSN, collagen, Collagen type IV, CTSC, CYP2E1, CYTIP, Cytokeratin, DEFB1, FABP4, Gm-csf, IFI6, IFN Beta, IgG, IL24, IL12 (complex), INPP5D, Interferon alpha, KLK7, KRT4, KRT13, KRT17, LDL, LGALS1, LIPG, MMP1, MMP11, NFkB (complex), PI3, PLAC8, Tgf beta, TGFBI, TNFAIP6, TXNIP | Dermatological Diseases and Conditions, Genetic Disorder, Inflammatory Response | 53 | 24 |
| 2 | Akt, Ap1, BLNK, CAV1, CCL20, COL4A1, COL4A2, Collagen Alpha1, CST6, CTSL2, CXCR4, ERK1/2, Focal adhesion kinase, FSH, Hcg, IL1, INHBA, Laminin, Lh, P38 MAPK, Pdgf (complex), PDGF BB, PFN2, PP2A, PPP2R2C, PROCR, SEC14L2, SELL,SERPINE1, SLC1A1, Sos, STC1, TCL1A, TEAD4, Vegf | Cellular Movement, Hematological System Development and Function, Immune Cell Trafficking | 39 | 19 |
| 3 | AKR1C3, ALDH3A1, AVPI1, BTLA, CCL23, CTSL2, CXCR7, DLG4, DNASE1L3, EHF, EIF4E, GPX2, GPX4, Hmgb1, HNF1A, HTT, IL13, KLF11, MMP10, MTMR2, NEFH, NEFL, NEFM, PI3, POU3F1, ROBO2, SEMA3C, SPRR2A (includes others), STRA6, TCR, TIMP4 TNF, WISP1, WNT1, WNT10B | Neurological Disease, Cell-To-Cell Signaling and Interaction, Cellular Assembly and Organization | 26 | 14 |
| 4 | ADRA1D, AKR1B10, ATRIP, BATF3, CCNG2, CDK2, CITED2, COL1A2, COL7A1, CTBP1, EPB49, ESRRG, GNB2L1, HLF, HLTF, JUN, KIF1B, KRT17, LARP6, LGALS1, mevalonic acid, MMD, NODAL, NOV, NR2F1, NRIP1, PKN1, SAA1, SLC27A6, SP1, SPAG4, TGFB1, Thyroid hormone receptor, TMED4, WFDC5 | Cell Cycle, Cellular Development, Embryonic Development | 22 | 12 |
| 5 | 26s Proteasome, AKT3, AQP2, ARRDC4, BSG, Caspase, DDIT4, DUSP1, DUSP4, ERK, FOXE1, HERPUD1, HLA-DQA1, HPGD, Hsp90, IL17R, Insulin, Jnk, JUN/JUNB/JUND, Mapk, MATK, mevalonic acid, Mmp, PI3K (complex), Pka, Pkc(s), PODXL, Ras, RGS13, RNA polymerase II, SNCG, sphingomyelinase, Ubiquitin, UTS2, WISP1 | Cell Cycle, Cellular Movement, Immunological Disease | 11 | 7 |
Genes in bold were identified by microarray analysis; other genes were either not on the expression array or did not change significantly.
A score >3 was considered significant.
Differentially expressed genes in OSCC vs matched normal oral mucosa
Gene expression analysis revealed a total of 1172 altered genes (Genes that were over or under-expressed more than 2-fold) with 608 up-regulated and 564 down-regulated genes in OVC compared with it’s matched normal oral mucosa (OSCCN). The network with the highest score (network 1, score = 40) was generated with 32 focus genes. The first 5 Associated Network Functions altered genes are shown in Table 4.
Table 4.
The first 5 Associated Network Functions altered genes in OSCC vs matched normal oral mucosa
| Network | Genes in Ingenuity networks1 | Function | Score2 | Focus molecules |
|---|---|---|---|---|
| 1 | AIM1, AMPK, ANGPT2, ANGPTL2, ANPEP, AURKA, CALU, CCDC64B, ECM1, EGR1, EMP1, EMP2, ENPEP, EPHX2, ERBB2, ERBB3, ETS1, GDPD3, HES1, HMMR, ID4, MELK, MXD1, NPNT, PRKCDBP, PTGES, RAB10, SF3A3, Sphk, SRGN, TMEM158, TNS3, VAV2, Vegf, VEGFC | Cardiovascular Disease, Cellular Growth and Proliferation, Cancer | 40 | 32 |
| 2 | AASS, BGN, C2, C1q, C1QA, C1QB, C1QC, CAND2, CD207, COL11A1, COL16A1, COL4A6, COL5A1, COL5A2, COL5A3, COL6A2, COL6A3, Complement component 1, DFNA5, EXT1, FNDC3B, FXYD5, GATM, Igm, KDELR3, LOXL2, MPHOSPH9, OVOL1, PCOLCE2 (includes EG:26577), PDLIM5, PLXNC1, PMM1, SLC16A3, ST3GAL5, TGFB1 | Connective Tissue Disorders, Genetic Disorder, Dermatological Diseases and Conditions | 39 | 32 |
| 3 | Akt, ANGPTL1, ARSI, Aryl Sulfatase, CADM1, CBP-ICSBP-IRF-1-PU.1, CDH13, CYBA, CYBB, EPB41L3, FABP7, FOXC1, GNS, HOXA1, HOXB7, HOXD10, LPXN, MAGI1, MYH11, N-acetylglucosamine-6-sulfatase, NCF2, NMB, PAX9, PBX1, Phox, Rac/Cdc42, SORBS2, SRPK2, ST8SIA4, SULF1, SULF2, THBS2, TLE2, WDR26 | Free Radical Scavenging, Genetic Disorder, Immunological Disease | 35 | 29 |
| 4 | CCNB2, Cdc25, CDK1, CKS2, COL10A1, COL18A1, COL1A1, COL1A2, COL3A1, Collagen type I, Collagen(s), CRABP1, CTSB, CTSL1, Cyclin B, DLGAP5, ESPL1, Gelatinase, HMGA2, ITGAV, MXI1, NID2, P4HA1, PRELP, PTHLH, Rbp, RBP1, RBP7, SAMSN1, SCNN1B, SPARC, TGFBI, TM4SF1, TNC, USP6NL | Connective Tissue Disorders, Genetic Disorder, Cellular Assembly and Organization | 33 | 29 |
| 5 | ACP5, ACPP, AQP3, BASP1, Calpain, CDKN2A, DPP3, ERMP1, FNDC1, FSH, G protein beta gamma, Integrin, ITGB4, KLF5, LDL, LEPRE1, MMP2, MMP9, MMP14, MYCN, NUCB1, OGN, P4HA2, PHGDH, PLAGL1, PLAU, PMEPA1, RAD51AP1, RILPRNA polymerase II, SC4MOL, SERPINE1, SLFN12, SORCS2, Tgf beta | Cardiovascular System Development and Function, Tumor Morphology, Organismal Development | 32 | 28 |
Genes in bold were identified by microarray analysis; other genes were either not on the expression array or did not change significantly.
A score >3 was considered significant.
The common genes in OSCC, OVC compared with its matched normal oral mucosa
Gene expression analysis revealed a total of 167 altered genes (Genes that were over or under-expressed more than 2-fold) with 108 up-regulated and 59 down-regulated genes in OSCC compared with OVC. We focused on a total of 39 common genes (Genes that were over or under-expressed more than 2-fold) with 22 up-regulated and 17 down-regulated genes in OSCC and OVC compared with it’s matched normal oral mucosa. There were 8 of the 39 genes were differently expressed between OVC and OSCC , which were ADAMTS12, COL4A1, COL4A2, INHBA, MMP1, SERPINE1, TGFB1, HLF, and all were up-regulated expect HLF. All the 39 common genes are shown in Table 5. Among of these 39 genes, 11 genes focus on the associated network functions: dermatological diseases and conditions, genetic disorder, inflammatory response and 8 genes focus on the associated network functions: cellular movement, hematological system development and function, immune cell trafficking. All these results suggest that OSCC and OVC not only have common genetic and molecular basis, but probably have independently regulatory mechanisms in vivo.
Table 5.
Twenty-four focus genes in network 1
| Gene ID | Gene symbol | Gene name | Fold change |
|---|---|---|---|
| 206193_s_at | CDSN | corneodesmosin | 14.67 |
| 211964_at | Collagen type IV (COL4A2) | collagen, type IV, alpha 2 | 2.38 |
| 225647_s_at | CTSC | cathepsin C | 2.23 |
| 210397_at | DEFB1 | defensin, beta 1 | 2.21 |
| 203980_at | FABP4 | fatty acid binding protein 4, adipocyte | 4.15 |
| 204415_at | IFI6 | interferon, alpha-inducible protein | 2.75 |
| 206569_at | IL24 | interleukin 24 | 2.10 |
| 205778_at | KLK7 | kallikrein-related peptidase 7 | 3.50 |
| 205157_s_at | KRT17 | keratin 17 | 2.82 |
| 201105_at | LGALS1 | lectin, galactoside-binding, soluble, 1 | 2.01 |
| 219181_at | LIPG | lipase, endothelial | 2.87 |
| 204475_at | MMP1 | matrix metallopeptidase 1 (interstitial collagenase) | 7.47 |
| 203878_s_at | MMP11 | matrix metallopeptidase 11 (stromelysin 3) | 2.17 |
| 203691_at | PI3 | peptidase inhibitor 3, skin-derived | 2.29 |
| 201506_at | TGFBI | transforming growth factor, beta-induced, 68kDa | 2.10 |
| 206026_s_at | TNFAIP6 | tumor necrosis factor, alpha-induced protein 6 | 2.50 |
| 206337_at | CCR7 | chemokine (C-C motif) receptor 7 | 0.30 |
| 205987_at | CD1C | CD1c molecule | 0.47 |
| 209975_at | CYP2E1 | cytochrome P450, family 2, subfamily E, polypeptide 1 | 0.42 |
| 209606_at | CYTIP | cytohesin 1 interacting protein | 0.39 |
| 203332_s_at | INPP5D | inositol polyphosphate-5-phosphatase, 145kDa | 0.40 |
| 207935_s_at | KRT13 | keratin 13 | 0.42 |
| 213240_s_at | KRT4 | keratin 4 | 0.37 |
| 219014_at | PLAC8 | placenta-specific 8 | 0.32 |
| 201008_s_at | TXNIP | thioredoxin interacting protein | 0.43 |
Common genes in OSCC and OVC displayed different gene expression level
To validate the microarray results, we performed Q-RT-PCR analysis for 4 genes (MMP1, SERINE1, MAL and DNASE1L3) from 5 samples of OVC, OSCC and their matched paracancerous and normal oral mucosa tissue, independently. The Q-RT-PCR expression of the selected genes was in accordance with corresponding microarray data. SERPNE1 mRNA level is reduced gradually in OVC, paracancerous tissue of Oral verrucous carcinoma (OVC-P) and normal mucosa tissue of Oral verrucous carcinoma (OVC-N), just similar to expression level of OSCC and their matched paracancerous and normal oral mucosa tissue. Specifically, expression of MMP1 was increased over 400-fold in OSCC related to paracancerous tissue of Oral squamous cell carcinoma (OSCC-P) and normal mucosa tissue of Oral squamous cell carcinoma (OSCC-N). MMP1 mRNA level is also high in OVC related to those in OVC-P and OVC-N. The results indicated that MMP1 maybe play a significant role in developing oral cancer [17]. The expression level of MAL was increased gradually in OVC, OVC-P and OVC-N, and the similar expression pattern occurred among OSCC, OSCC-P and OSCC-N. Most specially, transcription level of DNASE1L3 is reduced gradually in OVC, OVC-P and OVC-N, but is increased gradually in OSCC, OSCC-P and OSCC-N. In all, these differently expressed genes provide clues about the carcinogenesis of OVC and OSCC.
Discussion
Oral verrucous carcinoma is a rare variant of Oral squamous cell carcinoma (OSCC), but little is known about the molecular mechanisms for its malignant development. The genetic and epigenetic alterations are related to most of cancer progression which may also be closely linked with oral verrucous carcinoma. It is, therefore, essential for understanding OVC to make comprehensive gene expression profiling. We compared with squamous cell carcinomain order to better differentiate it from squamous cell carcinoma. In undertaking this analysis, we have identified several genes that are differentially expressed in OVC and OSCC compared with its matched normal oral mucosa.In addition, we have identified 39 common genes are differentially in OSCC and OVC compared with it’s matched normal oral mucosa. 8 of these 39 common genes were different between OVC and OSCC. These findings can be a good description of that OVC is a rare variant of OSCC but it’s different of OSCC from the molecular point of view. All the 8 genes were ADAMTS12, COL4A1, COL4A2, INHBA, MMP1, SERPINE1, TGFBI, HLF, which we thought were one of the major research directions.
MMPs are a family of zinc-dependent proteases that can collectively degrade all components of the extracellular matrix [18]. MMP activity is tightly regulated at the level of transcription and activation by proteolytic cleavage. Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Matrix metalloproteinase (MMP1) is one of the most abundant proteases in the matrix metalloproteinase family. It is capable of degrading type I, II and III collagens, and plays a pivotal role in extracellular matrix (ECM) remodelling in both normal development and pathology [19]. It plays a clinically important role in inflammatory disease, and has been implicated in numerous pathological processes including wound healing, arthritis and tumour metastasis [20-22]. Some studies have shown that MMP-1 is a hallmark of human metastatic cancer, and its over expression represents a high risk factor that adversely correlates with overall survival of patients with invasive breast carcinoma [23-25]. Some research showed that the complex roles of MMP in tumor progression of sarcomas, not only does metastasis seem to be affected by MMP1 silencing, but also local tumor growth and angiogenesis are affected inversely [26]. In our research, MMP-1 was up-regulated in OVC and OSCC control with their normal oral mucosa, and highly up-regulated in OSCC. This finding implies OVC is a low-grade variant of OSCC, with slow growth, no metastatic potential and lowest invasive potential.
SERPINE1 (serpin peptidase inhibitor, clade E, member 1) plays an important role in tumorigenesis and invasion as a primary inhibitor of plasminogen activators [27]. High expression of SERPINE1 is predictive of a poor prognosis for survival of patients with cancer [28,29]. Previous studies have shown that that SERPINE1 is mainly expressed in cancer cells, such as ovarian cancer, colorectal cancer and OSCC, but not in normal oral mucosa. But the mechanisms responsible for the up-regulation of SERPINE1 in OVC remain unclear. In this paper, we found that the SERPINE1 is predominantly expressed in OVC and OSCC compared with their normal oral mucosa. This conclusion is in agreement with the microarray data.
INHBA (inhibin, beta A) is a subunit of both activin and inhibin, two closely related glycoproteins with opposing biological effects. The INHBA subunit joins the alpha subunit to form a pituitary FSH secretion inhibitor. Inhibin has been shown to regulate gonadal stromal cell proliferation negatively and to have tumor-suppressor activity. In addition, serum levels of inhibin have been shown to reflect the size of granulosa-cell tumors and can therefore be used as a marker for primary as well as recurrent disease [27]. INHBA is also a ligand in the transforming growth factor-beta (TGF-β) superfamily [28], INHBA also stimulates inflammatory corneal angiogenesis by increasing vascular endothelial growth factor (VEGF) levels [29]. VEGF expression may have prognostic significance for patients with HNSCC [30].
In summary, the study of gene expression in OVC and OSCC on a genome-wide scale was achieved successfully. There are obvious differences in gene expression between OVC and OSCC. 167 known genes were differentially expressed between OSCC and OVC, among of them 108 were up-regulated and 59 were down-regulated. The common differential expressed genes between OVC and OSCC compared with their matched normal mucosa were 39, among of them 22 were up-regulated, 17 were down-regulated, and 8 of them were differentially expressed between OVC and OSCC. These 8 genes may determine the identity differences of the two cancers. It remains to be determined whether their 8 genes can discriminate between OVC and OSCC in a much larger study.
Acknowledgements
This project was supported by The Natural Science Foundation for Distinguished Young Scholars of Hunan Province (S2013J504B), The National Natural Science Foundation of China (30872895), and The key Program of Department of Science and Technology of Hunan (2008FJ-2011).
Disclosure of conflict of interest
None.
References
- 1.Ackerman LV. Verrucous carcinoma of the oral cavity. Surgery. 1948;23:670–678. [PubMed] [Google Scholar]
- 2.Macias-Garcia F, Martinez-Lesquereux L, Fernandez B, Parada P, Larino-Noia J, Sobrino-Faya M, Iglesias-Canle J, Iglesias-Garcia J, Forteza J, Dominguez-Munoz JE. Verrucous carcinoma of the esophagus: a complex diagnosis. Endoscopy. 2010;42:E137–E138. doi: 10.1055/s-0029-1244051. [DOI] [PubMed] [Google Scholar]
- 3.Wolf H, Platzer P, Vecsei V. Verrucous carcinoma of the tibia arising after chronic osteomyelitis: a case report. Wien Klin Wochenschr. 2009;121:53–56. doi: 10.1007/s00508-008-1104-4. [DOI] [PubMed] [Google Scholar]
- 4.Miller ME, Martin N, Juillard GF, Bhuta S, Ishiyama A. Temporal bone verrucous carcinoma: outcomes and treatment controversy. Eur Arch Otorhinolaryngol. 2010;267:1927–1931. doi: 10.1007/s00405-010-1281-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Rekha KP, Angadi PV. Verrucous carcinoma of the oral cavity: a clinico-pathologic appraisal of 133 cases in Indians. Oral Maxillofac Surg. 2010;14:211–218. doi: 10.1007/s10006-010-0222-0. [DOI] [PubMed] [Google Scholar]
- 6.Mak ST, Io IY, Tse RK. Verrucous carcinoma: a rare tumor of the eyelid. Ophthal Plast Reconstr Surg. 2011;27:e32–e34. doi: 10.1097/IOP.0b013e3181c663b1. [DOI] [PubMed] [Google Scholar]
- 7.Yaman I, Bozdag AD, Derici H, Tansug T, Reyhan E. Verrucous carcinoma arising in a giant condyloma acuminata (Buschkelowenstein Tumour): ten-year follow-up. Ann Acad Med Singapore. 2011;40:104–105. [PubMed] [Google Scholar]
- 8.Miller SB, Brandes BA, Mahmarian RR, Durham JR. Verrucous carcinoma of the foot: a review and report of two cases. J Foot Ankle Surg. 2001;40:225–231. doi: 10.1016/s1067-2516(01)80022-3. [DOI] [PubMed] [Google Scholar]
- 9.Gertler R, Werber KD. Management of verrucous carcinoma of the hand: a case report. Int J Dermatol. 2009;48:1233–1235. doi: 10.1111/j.1365-4632.2009.04183.x. [DOI] [PubMed] [Google Scholar]
- 10.Koch BB, Trask DK, Hoffman HT, Karnell LH, Robinson RA, Zhen W, Menck HR Commission on Cancer, American College of Surgeons and American Cancer Society. National survey of head and neck verrucous carcinoma: patterns of presentation, care, and outcome. Cancer. 2001;92:110–120. doi: 10.1002/1097-0142(20010701)92:1<110::aid-cncr1298>3.0.co;2-k. [DOI] [PubMed] [Google Scholar]
- 11.Schrader M, Laberke HG, Jahnke K. Lymphatic metastases of verrucous carcinoma (Ackerman tumor) HNO. 1987;35:27–30. [PubMed] [Google Scholar]
- 12.Kang CJ, Chang JT, Chen TM, Chen IH, Liao CT. Surgical treatment of oral verrucous carcinoma. Chang Gung Med J. 2003;26:807–812. [PubMed] [Google Scholar]
- 13.McClure DL, Gullane PJ, Slinger RP, Wysocki GP. Verrucous carcinoma--changing concepts in management. J Otolaryngol. 1984;13:7–12. [PubMed] [Google Scholar]
- 14.Quan H, Tang Z, Zhao L, Wang Y, Liu O, Yao Z, Zuo J. Expression of alphaB-crystallin and its potential anti-apoptotic role in oral verrucous carcinoma. Oncol Lett. 2012;3:330–334. doi: 10.3892/ol.2011.470. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Tang ZG, Li JM, Hong ZZ, Yu ZW, Liu CH. Expression of matrix metalloproteinase 2 in oral verruvous carcinoma and squamous cell carcinoma. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2005;30:650–652. [PubMed] [Google Scholar]
- 16.Ray JG, Mukherjee S, Pattanayak Mohanty S, Chaudhuri K. Oral verrucous carcinoma--a misnomer? Immunohistochemistry based comparative study of two cases. BMJ Case Rep. 2011:2011. doi: 10.1136/bcr.11.2010.3479. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Yen CY, Chen CH, Chang CH, Tseng HF, Liu SY, Chuang LY, Wen CH, Chang HW. Matrix metalloproteinases (MMP) 1 and MMP10 but not MMP12 are potential oral cancer markers. Biomarkers. 2009;14:244–249. doi: 10.1080/13547500902829375. [DOI] [PubMed] [Google Scholar]
- 18.Cooper AM. Cell-mediated immune responses in tuberculosis. Annu Rev Immunol. 2009;27:393–422. doi: 10.1146/annurev.immunol.021908.132703. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Pardo A, Selman M. MMP-1: the elder of the family. Int J Biochem Cell Biolm. 2005;37:283–288. doi: 10.1016/j.biocel.2004.06.017. [DOI] [PubMed] [Google Scholar]
- 20.Han YP, Tuan TL, Wu H, Hughes M, Garner WL. TNF-alpha stimulates activation of pro-MMP2 in human skin through NF-(kappa)B mediated induction of MT1-MMP. J Cell Sci. 2001;114:131–139. doi: 10.1242/jcs.114.1.131. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Brinckerhoff CE, Rutter JL, Benbow U. Interstitial collagenases as markers of tumor progression. Clin Cancer Res. 2000;6:4823–4830. [PubMed] [Google Scholar]
- 22.Vincenti MP, Brinckerhoff CE. Transcriptional regulation of collagenase (MMP-1, MMP-13) genes in arthritis: integration of complex signaling pathways for the recruitment of gene-specific transcription factors. Arthritis Res. 2002;4:157–164. doi: 10.1186/ar401. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Kim MY, Oskarsson T, Acharyya S, Nguyen DX, Zhang XH, Norton L, Massagué J. Tumor self-seeding by circulating cancer cells. Cell. 2009;139:1315–1326. doi: 10.1016/j.cell.2009.11.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Poola I, DeWitty RL, Marshalleck JJ, Bhatnagar R, Abraham J, Leffall LD. Identification of MMP-1 as a putative breast cancer predictive marker by global gene expression analysis. Nat Med. 2005;11:481–483. doi: 10.1038/nm1243. [DOI] [PubMed] [Google Scholar]
- 25.Yang E, Boire A, Agarwal A, Nguyen N, O’Callaghan K, Tu P, Kuliopulos A, Covic L. Blockade of PAR1 signaling with cell-penetrating pepducins inhibits Akt survival pathways in breast cancer cells and suppresses tumor survival and metastasis. Cancer Res. 2009;69:6223–6231. doi: 10.1158/0008-5472.CAN-09-0187. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Jawad MU, Garamszegi N, Garamszegi SP, Correa-Medina M, Diez JA, Wen R, Scully SP. Matrix metalloproteinase 1: role in sarcoma biology. PLoS One. 2010;5:e14250. doi: 10.1371/journal.pone.0014250. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Ju H, Lim B, Kim M, Noh SM, Kim WH, Ihm C, Choi BY, Kim YS, Kang C. SERPINE1 intron polymorphisms affecting gene expression are associated with diffuse-type gastric cancer susceptibility. Cancer. 2010;116:4248–4255. doi: 10.1002/cncr.25213. [DOI] [PubMed] [Google Scholar]
- 28.Andreasen PA, Egelund R, Petersen HH. The plasminogen activation system in tumor growth, invasion, and metastasis. Cell Mol Life Sci. 2000;57:25–40. doi: 10.1007/s000180050497. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Gao S, Nielsen BS, Krogdahl A, Sørensen JA, Tagesen J, Dabelsteen S, Dabelsteen E, Andreasen PA. Epigenetic alterations of the SERPINE1 gene in oral squamous cell carcinomas and normal oral mucosa. Genes Chromosomes Cancer. 2010;49:526–538. doi: 10.1002/gcc.20762. [DOI] [PubMed] [Google Scholar]
- 30.Kyzas PA, Stefanou D, Batistatou A, Agnantis NJ. Prognostic significance of VEGF immunohistochemical expression and tumor angiogenesis in head and neck squamous cell carcinoma. J Cancer Res Clin Oncol. 2005;131:624–630. doi: 10.1007/s00432-005-0003-6. [DOI] [PubMed] [Google Scholar]