Skip to main content
PLOS ONE logoLink to PLOS ONE
. 2014 Aug 15;9(8):e104400. doi: 10.1371/journal.pone.0104400

The Complete Genome Sequence of Escherichia coli EC958: A High Quality Reference Sequence for the Globally Disseminated Multidrug Resistant E. coli O25b:H4-ST131 Clone

Brian M Forde 1, Nouri L Ben Zakour 1, Mitchell Stanton-Cook 1, Minh-Duy Phan 1, Makrina Totsika 1, Kate M Peters 1, Kok Gan Chan 2, Mark A Schembri 1, Mathew Upton 3, Scott A Beatson 1,*
Editor: Ulrich Dobrindt4
PMCID: PMC4134206  PMID: 25126841

Abstract

Escherichia coli ST131 is now recognised as a leading contributor to urinary tract and bloodstream infections in both community and clinical settings. Here we present the complete, annotated genome of E. coli EC958, which was isolated from the urine of a patient presenting with a urinary tract infection in the Northwest region of England and represents the most well characterised ST131 strain. Sequencing was carried out using the Pacific Biosciences platform, which provided sufficient depth and read-length to produce a complete genome without the need for other technologies. The discovery of spurious contigs within the assembly that correspond to site-specific inversions in the tail fibre regions of prophages demonstrates the potential for this technology to reveal dynamic evolutionary mechanisms. E. coli EC958 belongs to the major subgroup of ST131 strains that produce the CTX-M-15 extended spectrum β-lactamase, are fluoroquinolone resistant and encode the fimH30 type 1 fimbrial adhesin. This subgroup includes the Indian strain NA114 and the North American strain JJ1886. A comparison of the genomes of EC958, JJ1886 and NA114 revealed that differences in the arrangement of genomic islands, prophages and other repetitive elements in the NA114 genome are not biologically relevant and are due to misassembly. The availability of a high quality uropathogenic E. coli ST131 genome provides a reference for understanding this multidrug resistant pathogen and will facilitate novel functional, comparative and clinical studies of the E. coli ST131 clonal lineage.

Introduction

Many multidrug resistant (MDR) Escherichia coli strains belong to specific clones that are frequently isolated from urinary tract and bloodstream infections. These clones may originate in a specific locale, country or may be distributed globally without a clear place of origin. A major contributor to this phenomenon is E. coli ST131, a group of E. coli strains of multi-locus sequence type 131 (ST131) that have emerged rapidly and disseminated globally in hospitals and the community, causing MDR infections typically associated with frequent recurrences and limited treatment options [1][4]. E. coli ST131 strains are commonly identified among E. coli producing the CTX-M-15 type extended-spectrum β-lactamase (ESBL), currently the most widespread CTX-M ESBL enzyme worldwide [1], [4], [5]. The largest sub-clonal lineage of E. coli ST131 is resistant to fluoroquinolones and belongs to the fimH-based H30 group [6].

E. coli EC958 represents one of the most well characterised E. coli ST131 strains in the literature. E. coli EC958 is a phylogenetic group B2, CTX-M-15 positive, fluoroquinolone resistant, H30 E. coli ST131 strain isolated from the urine of an 8-year old girl presenting in the community in March 2005 in the United Kingdom (UK) [7]. The strain belongs to the pulse field gel electrophoresis defined UK epidemic strain A and has a O25b:H4 serotype [8]. E. coli EC958 contains multiple genes associated with the virulence of extra-intestinal E. coli, including those encoding adhesins, autotransporter proteins and siderophore receptors. E. coli EC958 expresses type 1 fimbriae and this is required for adherence to and invasion of human bladder cells, as well as colonization of the mouse bladder [7]. In mice, E. coli EC958 causes acute and chronic urinary tract infection (UTI) [9], as well as impairment of ureter contractility [10]. E. coli EC958 bladder infection follows a well-defined pathogenic pathway that involves the formation of intracellular bacterial communities (IBCs) in superficial epithelial cells and the subsequent release of rod-shaped and filamentous bacteria into the bladder lumen [9]. E. coli EC958 also causes impairment of uterine contractility [10], and is resistant to the bactericidal action of human serum [11]. The complement of genes that define the serum resistome of E. coli EC958 have been comprehensively defined [11].

Second generation sequencing (SGS) technologies have revolutionised genome research through the provision of a rapid, cost-effective method for generating sequence data. However, obtaining complete bacterial genomes using these technologies has been challenging. Short read lengths are a characteristic feature of SGS technologies and highly repetitive stretches of DNA, often present in multiple copies, are difficult to correctly resolve using these platforms. Typically, these assemblies are highly fragmented, prone to misassembly and require costly and time consuming finishing procedures [12][14]. Consequently, most genomes are not completely resolved; they are submitted as draft genomes, often containing hundreds of contigs that are generally unannotated or poorly annotated [15]. As a result, many of these genomes are of limited use for comparative, functional, clinical and epidemiological studies [16]. In contrast to other methods, the Pacific Biosciences (PacBio) single molecule real time (SMRT) sequencing platform [17] can produce read lengths of up to 30,000 bp that are capable of spanning large repeat regions (such as rRNA operons), thereby facilitating the generation of complete genome assemblies without the need for additional sequencing.

In order to enhance our knowledge of E. coli ST131 and its capacity to cause disease, a greater understanding of this clone is required at the genomic level. Four complete or draft E. coli ST131 genome sequences are currently available, namely EC958 (draft) [7], SE15 [18], NA114 [19] and most recently JJ1886 [20]. EC958, NA114 and JJ1886 are all phylogroup B2, CTX-M-15 positive, fluoroquinolone resistant, H30 strains which have recently been shown in two independent phylogenomic studies to belong to single clade (ST131 clade C) distinct from SE15 (ST131 clade A) [6], [21]. A pair-wise comparison between SE15 and NA114 demonstrated that SE15 contains a number of differences in genome content despite being closely related at the core genome level [22]. Furthermore, we have shown that many of the genomic islands and prophage regions previously identified in the draft EC958 genome [7] are well conserved in most other fluoroquinolone resistant, clade C/fimH30 strains [21]. Here we used PacBio SMRT sequencing to determine the complete genome sequence of E. coli EC958. The E. coli EC958 genome represents as an accurate reference for future functional, comparative, phylogenetic and clinical studies of E. coli ST131.

Methods

Genome sequencing and assembly

Genomic DNA for E. coli EC958 was prepared using the Qiagen DNeasy Blood and Tissue kit, as per manufacturer's instructions. The genome of E. coli EC958 was sequenced by generating a total of 601,224 pre-filtered reads with an average length of 1,600 bp, from six SMRT cells on a PacBio RS I sequencing instrument, using an 8–12 kilobase (kb) insert library, generating approximately 200-fold coverage (GATC Biotech AG, Germany).

De novo genome assemblies were produced using PacBio's SMRT Portal (v2.0.0) and the hierarchical genome assembly process (HGAP) [23], with default settings and a seed read cut-off length of 5,000 bp to ensure accurate assembly across E. coli rRNA operons. Assemblies were performed multiple times using different combinations of between one and six SMRT cells of read data. The best assembly results were obtained with six SMRT cells which yielded approximately 547 Mb of sequence from 190,145 post-filtered reads (Table 1). The average read length was found to be 2,875 bp with an average single pass accuracy of 86.5%. During the preassembly stage 190,145 long reads were converted into 23,772 high quality, preassembled reads with an average length of 4,573 bp. Assembly of these reads returned seven contigs, three were greater than 500 kb. Furthermore, the largest contig (∼3.8 Mb) was estimated to contain 74.5% of the chromosome of EC958. For all other assemblies total contig numbers exceeded 10 (Table 1). However, for assemblies using two or three SMRT cells, assembly metrics could be improved >2-fold by reducing the seed read length (Table 1).

Table 1. PacBio assembly statistics.

Raw read data Pre-assembly Final assembly
SMRT cells Seed length1 Total bases2 Total reads Average length3 Total bases2 Total reads Assembly size3 Total contigs N50
1 5 89 33736 2649 7 2381 1372346 162 8748
2 5 177 63802 2913 29 6244 5163106 154 56927
2 1.5 177 63802 2777 91 37720 5262395 44 225550
3 5 286 97231 2945 47 10407 5298899 40 216859
3 2.7 268 96187 2793 105 31531 5317490 20 594137
4 5 383 130044 2946 65 13934 5311243 18 1061190
4 3.5 357 125866 2844 108 27592 5314416 17 769937
5 5 472 159723 2958 81 17175 5320054 14 1100290
5 4.1 449 157332 2859 108 25345 5339571 16 710956
6 5 546 190145 2875 108 23772 5298989 7 3866706
1

Kilobase-pairs;

2

Megabase-pairs;

3

Base-pairs.

To determine their correct order and orientation, contigs from our six SMRT cell assembly were aligned to the complete genome of E. coli SE15 using Mauve v. 2.3.1 [24]. Contig ordering was confirmed by PCR. Overlapping but un-joined contigs, a characterised artefact of the HGAP assembly process [23], were manually trimmed based on sequence similarity and joined. All joins were manually inspected using ACT [25] and Contiguity (http://mjsull.github.io/Contiguity/).

A single contig representing the EC958 large plasmid pEC958 was identified and isolated by BLASTn comparison against the previous draft assembly of EC958 (NZ_CAFL00000000.1) [7]. Overlapping sequences on the 5′ and 3′ ends of the plasmid contig were then manually trimmed based on sequence similarity. Although the EC958 small plasmid (pEC958B) was too small to be assembled as part of the main assembly, 25 unassembled PacBio reads, with an average length of 2,031 bp, were found to align to the small 4,080 bp plasmid contig that had previously been assembled from 454 GS-FLX reads (emb|CAFL01000138).

To determine if reads containing unremoved adapter sequence have had an impact on the assembly of EC958 we first screened the filtered subreads for adapter sequence using BBMap version 31.40 (http://sourceforge.net/projects/bbmap/). A high level of adapter contamination would likely pose some risk of misassembly. Additionally, to eliminate the possibility that aberrant reads have resulted in the inclusion of assembly artefacts in the EC958 genome assembly, contig-ends were screened for hairpin artefacts using MUMmer version 3.23 [26].

Genome annotation and comparison

Initial annotation of the genome of EC958 was done by annotation transfer from the draft genome of EC958 (NZ_CAFL00000000.1) using the rapid annotation transfer tool (RATT) [27]. In addition, the genome of EC958 was subject to additional automatic annotation using Prokka (Prokka: Prokaryotic Genome Annotation System - http://vicbioinformatics.com/). All predicted protein coding sequences were searched (BLASTp) against the reannotated genome of E. coli UTI89 [28], [29] with the aim of correcting CDS start sites and assigning correct gene names and an appropriate functional annotation. Whole genome nucleotide alignments for E. coli EC958, SE15 and NA114 were generated using BLASTn and visualised using Easyfig version 2.1 [30], Artemis Comparison Tool [25] and BRIG [31]. To compare the original 454 draft genome and the complete PacBio genome, 454 sequencing reads used for the draft assembly of E. coli EC958 [7] were mapped to the complete E. coli EC958 genome using SHRiMP v 2.0 [32]. SNP calling and insertion/deletion (indel) prediction were performed using the Nesoni package with default parameters (http://www.vicbioinformatics.com/software.nesoni.shtml). Additional platform-specific SNPs and indels were identified by comparison of the 454 draft genome contigs and the PacBio complete genome using MUMmer 3.23 [26]. The complete annotated chromosome of EC958, large plasmid (pEC958A) and small plasmid (pEC958B) are available at the European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena) under the accession numbers HG941718, HG941719 and HG941720 respectively.

Phylogenetic analysis

To determine the phylogenetic relatedness of the four complete ST131 genomes, a single-nucleotide polymorphism (SNP) based phylogenetic tree was constructed. The pan-genome SNPs in EC958, 3 complete ST131 genomes (E. coli SE15, NA114 and JJ886), an additional 16 representative complete E. coli genomes: E. coli ED1A, CFT073, UTI89, 536, S88, APEC-01, IAI39, UMN026, HS, W3110, MG1655, BW2952, IAI1, SE11, Sakai, EDL933 [20], [28], [33][42] and the out-group species E. fergusonii ATCC35469 were identified using kSNP2 2.1.1 [43] (using default setting and a k-mer size of 21). In total, 261,214 SNPs were found to be common to all 21 E. coli genomes, including EC958. SNPs in each genome were concatenated into single contiguous sequences and aligned. The resulting SNP-based alignment was used for phylogenetic analysis. A maximum likelihood (ML) phylogenetic tree was constructed with PhyML 3.0 [44], using the GTR nucleotide substitution model and 1000 bootstrap replicates. The phylogenetic tree was plotted using FigTree 1.4.0 (http://tree.bio.ed.ac.uk/software/figtree/).

Genome assembly of EC958 using simulated Illumina paired-end reads

In an attempt to replicate the assembly protocol of E. coli NA114, simulated Illumina sequencing and assembly of E. coli EC958 was performed as described for E. coli NA114 in Avasthi et al [19]. The chromosome of EC958 was used as a reference to generate 500-fold coverage of simulated 54 bp, error free, Illumina paired-end reads with an average insert size of 300 bp. These simulated Illumina paired-end reads were then assembled using Velvet 1.2.7 [45]. Assembled contigs were ordered and orientated by aligning them to the genome of E. coli SE15 using Mauve and concatenated to produce a ∼5 Mb pseudo-molecule.

Results

The complete PacBio genome assembly of E. coli EC958 reveals dynamic phage rearrangements

To determine the complete genome sequence of E. coli EC958 we carried out sequencing of genomic DNA using the PacBio RS I platform. An initial assembly of seven contigs representing the E. coli EC958 genome was produced by HGAP [21] using 190,145 post-filtered reads from 6 SMRT cells (Table 1). A circular chromosome was unambiguously assembled by trimming and joining the overlapping 3′ and 5′ ends from three large contigs of 3,866,718 bp, 715,826 bp and 541,428 bp, respectively. Contig joins were confirmed by PCR. Previously, we showed that a 14 scaffold draft 454 genome assembly of E. coli EC958 contained two additional replicons: a large antibiotic resistance plasmid (pEC958) and a small high-copy cryptic plasmid (pEC958B) [7]. In the PacBio assembly we found that pEC958 was represented as single circular contig of 135,602 bp that was consistent with the pEC958 scaffold in the original draft assembly (scaffold HG328349). In contrast, pEC958B was too small to be assembled using the HGAP parameters employed for rest of the chromosome, but it could be assembled from PacBio reads using a read-mapping approach.

The contig order and orientation in the original draft 454 assembly was contiguous with the complete PacBio assembly determined in this study. We also found a high degree of consensus concordance between the two technologies with only fifteen single nucleotide indels and a single substitution between the two assemblies, most of which could be accounted for by homopolymeric tract errors in the 454 assembly according to comparisons with independent E. coli genomes and manual read inspection (Table 2). We also noted two discrepant regions that exhibited a cluster of substitutions and indels in the GI-leuX genomic island and in the tail fibre region of prophage Phi1 that initially appeared to be PacBio assembly errors. Further investigation revealed that the GI-leuX discrepancies were within a 3727 bp repeat region also found within GI-selC, thus the differences were due to a collapsed repeat in the 454 assembly (Table 2). In contrast, the Phi1 prophage discrepancy corresponded to a 2773 bp segment in the tail fibre region that was also present in an inverted orientation within a separate 12.2 kb contig (Fig. 1A). This spurious contig resulted from the assembly of PacBio reads (approximately 50% of all reads in this region) that contained the 2.8 kb segment in an alternative orientation, suggesting that high-frequency allele switching had occurred during propagation of E. coli EC958 prior to DNA extraction. Prophage tail fibre allele switching mediated by a site-specific DNA invertase has long been recognised as a phenomenon for altering host specificity of phage by alternating in-frame C-terminal phage tail fibre protein fragments (for review see Sandmeier, 1994 [46]). Interestingly, we also identified PacBio contigs corresponding to alternative alleles of prophage tail fibre regions from prophage Phi2 and Phi4 that were separately assembled into 8.7 kb and 12.7 kb contigs, respectively, due to 2–3 kb inversions (Fig. 1B). SMRTbell adapter sequences were found to be present in only 620 of 217,502 subreads (0.29%). This low level of adapter contamination combined with the absence of any hairpin artefacts at contig break points make it highly unlikely that aberrant reads are responsible for the three small phage-associated contigs, and suggest these contigs represent real biological variation of tail fibre genes in the chromosome of EC958. All three invertible segments exhibited the 5′ and 3′ 26 bp crossover sites characteristic of DNA invertase mediated phage tail switching mechanisms [46] (Table 3).

Table 2. Comparison of complete PacBio EC958 genome with draft 454 EC958 genome.

Variant 454 contig information2
Position1 PacBio 454 SE15 Name Position Length Genomic context Comment3
786693 . A . 00007 131223 131239 Intergenic (EC958_0852 and EC958_0854) Homopolymeric tract
955837–957967 N/A N/A N/A 00011 62258 64195 Phi1 phage tail region 2.8 Kb invertable region in Phi1 phage tail region (2 substitutions/20 indels)
985718 T . T 00014 19202 34445 Intergenic (EC958_1049 and EC958_1050) Homopolymeric tract
1493217 . T T 00033 1143 74077 Tryptophan biosynthesis protein TrpCF (EC958_4924) 454 variant consistent with SE15 genome
2027391 A . A 00040 28390 75386 Chemotaxis protein CheA (EC958_2110) Homopolymeric tract
2598139 A . A 00085 32434 57547 Intergenic (EC958_2623 and EC958_4988) Homopolymeric tract
3098765 A . A 00073 3745 4934 Hypothetical protein (EC958_5038) Homopolymeric tract
3377055 . C . 00057 28348 88502 Hypothetical protein (EC958_5205) Homopolymeric tract
4149057 A . A 00104 7234 41331 Type II restriction enzyme (EC958_4083) Homopolymeric tract
4308872 T . T 00148 3658 51318 Intergenic (EC958_4231 and EC958_4232) Homopolymeric tract
4380208 T . T 00146 7992 42111 Hypothetical protein (EC958_4927) Homopolymeric tract
4756303 A . A 00117 4118 15191 Intergenic (EC958_4610 and EC958_4611) Homopolymeric tract
4762264 T . T 00117 10078 15191 Hypothetical protein (EC958_5122) Homopolymeric tract
4762871 A . . 00117 10684 15191 Hypothetical protein (EC958_5123) Homopolymeric tract; 454 variant consistent with SE15 genome
4776778 A . A 00119 7363 155673 Transcriptional activator CadC (EC958_4623) Homopolymeric tract
4938457 G T G 00158 1028 1512 Transposase DDE domain protein (EC958_5125) 1.5 Kb repeat region duplicated in pEC958
4963207–4965562 N/A N/A N/A 00105 1144 3727 Repeat region in GI-LeuX 3.7 Kb repeat region duplicated in GI-SelC (11 substitutions/4 indels)
1

Nucleotide position (or range) in complete PacBio EC958 genome.

2

Name, position of variant and length of 454 contig from draft 454 assembly.

3

“Homopolymeric tract” indicates that variant falls within tract of 5 or more nucleotides of same type.

Figure 1. Prophage tail fibre allele switching in EC958.

Figure 1

A. Alignment of the Phi1 alternative contig that contains the inversion of the tail fibre region to the genome of EC958. Phage tail fibre genes are coloured from dark green to light green. Phage DNA invertase genes are coloured orange. 26 bp crossover sites are indicated by black arrows. Red shading indicates nucleotide identity in the same orientation. Blue shading indicates nucleotide identity in the opposite orientation, highlighting the inversion in the phage tail fibre region. B. Genetic loci map of the tail fibre gene region of EC958 phages (Phi1, Phi2 and Phi4) and the location of recombination sites for DNA invertase. The major tail fibre gene is formed by a fusion of the stable 5′ region (dark green), encoding a series of Phage_fibre_2 tandem repeats (Pfam03406), with the invertible 3′ region (green) that encodes a Phage Tail Collar domain (Pfam07484). Downstream and presumably co-transcribed with the major tail fibre gene is a minor tail fibre gene (green). The alternate alleles form a mirror image of this arrangement, immediately downstream of the functional phage tail genes (lime green), enabling a new major tail fibre gene (and cognate minor tail fibre gene) to be formed by inversion of a 2–3 kb DNA segment. DNA invertase genes are coloured orange. The Phi4 prophage encodes a truncated DNA invertase (EC958_1582) that lacks the characteristic helix-turn-helix resolvase domain (PF02796). Invertible regions are highlighted in yellow. Figure prepared using Easyfig [27].

Table 3. Sites of DNA inversion within EC958 prophage genomes as determined by PacBio assembly of alternate alleles.

Crossover site Sequence1 Location2 Comments3
Phi1_5prime [gccgTTATCGAATACCTCGGTTTACGAGAA - 478 bp] c961070..961095 Part of 508 bp imperfect inverted repeat (77% nt identity); 2773 bp invertible segment
Phi1_3prime [gccaTTATTTAAAACCTCGGTTTACGAGAA - 478 bp] 958322..958347 -
Phi2_5prime [ TCCTCAATTACCTTGGTTTAGGAGAA - 197 bp] c1007582..1007607 Part of 227 bp imperfect inverted repeat (96% nt identity); 2067 bp invertible segment
Phi2_3prime [GAGAGATAAACGTTGGTTTGGGGGAA - 197 bp] 1005540..1005565 -
Phi4_5prime [ccgccgTTATCGAATACCTCGGTTTACAGGAA ] 1484784..1484809 Part of 36 bp imperfect inverted repeat (3 mismatches); 3106 bp invertible segment
Phi4_3prime [ccgccaTTATCTAAAACCTCGGTTTACGAGAA ] c1487865..1487890 -
Consensus TTCCC.TAAACGTT∧CGTTTA.AAGAA n/a Based on consensus of crossover sites from.
TT.A C C G T.GG Mu, P1, e14, p15B and S. boydii DNA inversion systems, as previously determined by Sandmeier et al. 1994 [42]
1

Predicted binding site for DNA invertase shown in capital letters; site of strand exchange is indicated by underlined central dinucleotide with ∧ indicating downstream staggered cut; nucleotides in bold are consistent with the previously determined consensus DNA invertase crossover site [42]; square brackets indicate boundaries of larger imperfect inverted repeats that encode the crossover sites.

2

Coordinates refer to start and end of 26 bp crossover site in EC958 complete genome; 5prime/3prime orientation is relative to the complete prophage tail fibre gene and prophage genome; c = complement.

3

Phi1 and Phi4 5prime and 3prime 26 bp crossover sites differ by only 2 and 1 mismatches, respectively.

E. coli EC958 general genome features

The genome of E. coli EC958 consists of a single circular chromosome of 5,109,767 bp with an average GC content of 50.7%. The chromosome encodes 4982 putative protein-coding genes, including 358 that were not previously annotated on the draft chromosome due their presence in repetitive regions that were not assembled as scaffolds. Seven rRNA loci, consisting of 16S, 23S and 5S rRNA genes, and 89 tRNA genes, representing all 20 amino acids, were identified on the chromosome. As described elsewhere [7], the virulence-associated gene complement of EC958 includes adhesins (e.g. fimA-H, afa and curli), autotransporters (e.g. agn43, upaG, upaH, sat and picU), iron receptors (e.g. fepA, iutA, iha, chuA, hma and fyuA) and a number of other virulence associated genes (e.g. kpsM, usp, ompT, malX). Four genes that were not annotated in the draft genome may be virulence related: sitB (EC958_5193), which encodes a component of an iron transport system that is up-regulated during Shigella intracellular growth [47]; and three hypothetical genes (EC958_4894, EC958_4977, EC958_4981) orthologous to genes previously identified as uropathogenic E. coli specific [48]. The EC958 large plasmid, pEC958, is predicted to contain 151 protein-coding genes, including a 22 kb locus encoding conjugal transfer (tra) genes and antibiotic resistance genes including bla CTX-M-15 [7].

Whole genome comparison of E. coli EC958, NA114 and SE15

Phylogenetic analyses indicated that E. coli strains EC958, NA114 and JJ1886 cluster together in a clade discrete from E. coli SE15 within an ST131 specific lineage within the B2 phylogroup (Fig. 2). Whole-genome BLASTn comparisons showed that the major structural differences between the genomes of SE15 and the three fimH30 ST131strains relate to the seven prophage loci (Phi1-Phi7) and four genomic islands (GI-thrW, GI-pheV, GI-selC, and GI-leuX) that were previously defined in the draft genome of E. coli EC958 [7] (Fig. 3A). The complete PacBio genome confirmed the position and size of these elements and was able to fill numerous gaps caused by insertion elements or other repetitive elements. These prophage and GI regions are absent in whole or in part from E. coli SE15, and from most of the 16 other E. coli representative strains surveyed (Fig. 3B). Additionally, GI-selC is largely absent from all ST131 strains except EC958, whereas GI-thrW and Phi7 are well conserved in all four ST131 strains (Fig. 3B). Genomic surveys with a greater number of ST131 strains from diverse origins will be necessary to determine the prevalence of prophage, genomic islands and other mobile genetic elements.

Figure 2. Maximum likelihood phylogenetic comparison of 4 ST131 and 17 representative E. coli isolates.

Figure 2

The tree is rooted using the out-group species E. fergusonii ATCC35469. The phylogenetic relationships were inferred with the use of 261,214 SNPs identified between the genomes of the 22 Escherichia strains and 1000 bootstrap replicates. The major E. coli phylogroups are coloured as follows; phylogroup B2-ST131: SE15, NA114, JJ1886, EC958 (red); other phylogroup B2: APEC-01, S88, 536, UTI89, CFT073, ED1A (orange); phylogroup D: UMN026 (yellow); phylogroup F: IAI39 (yellow); phylogroup A: BW2952, MG1655, W3110, HS (green); phylogroup B1: SE11, IAI1 (aquamarine); phylogroup E: O157 EDL933, O157 Sakai (blue). Red nodes have 100% bootstrap support from 1000 replicates.

Figure 3. Distribution of EC958 mobile genetic elements in E. coli.

Figure 3

A. Visualisation of the EC958 genome compared with three E. coli ST131 genomes and 16 other E. coli genomes using BLASTn. EC958 prophage (Phi1 – Phi7) and genomic islands (GI-thrW, GI-pheV, GI-selC, GI-leuX) are represented by black boxes in the outermost circle. The innermost circles represent the GC content (black) and GC skew (green/purple) of EC958. The remaining circles display BLASTn searches against the genome of EC958. B. A BRIG visualisation of the EC958 mobile elements compared with the 19 E. coli genomes. BLASTn searches of the 19 genomes against the EC958 prophage and genomic islands show that the EC958 GIs and prophage are well conserved in the ST131 clade C genomes but largely absent from the genomes of SE15 and the other 16 E. coli genomes, which are arranged inner to outer as follows: Group E strains O157 EDL933, O157 Sakai (blue); group B1 strains SE11, IAI1 (aquamarine); group A strains BW2952, MG1655, W3110, HS (green); group D strains UMN026, IAI39 (yellow); group B2 strains APEC-01, S88, 536, UTI89, CFT073, ED1A (orange); group B2 ST131 strains SE15, NA114, JJ1886, EC958 (red). Figure prepared using BRIG [28].

Large discrepancies between ST131 genomes are likely due to misassembly of E. coli NA114

At the core genome level EC958, NA114, JJ1886 and SE15 all display a high level of genome synteny, with major differences due to the number, content and location of integrated mobile elements giving rise to variation in chromosome length (Fig. 4). Whereas E. coli EC958 and E. coli JJ1886 chromosomes are 5.10 Mb and 5.12 Mb, respectively, E. coli NA114 is almost 200 kb smaller at 4.9 Mb, and E. coli SE15 has a 4.7 Mb chromosome. In addition to all seven defined EC958 prophages, the JJ1886 chromosome possess an additional prophage (Phi8) not present in the genomes of the other ST131 strains, but otherwise exhibits a high degree of synteny with the EC958 chromosome (Fig. 4). In contrast, the chromosome of E. coli NA114 shows multiple gaps relative to EC958, exhibits significant variation in both the number and content of prophages, and appears to lack the three largest defined EC958 genomic islands (GI-pheV, GI-selC and GI-leuX) (Fig. 4). Instead, E. coli NA114 has a ∼160 kb region immediately upstream of dnaJ that consists of an assortment of GI and prophage sequence fragments that are found in several different locations in the EC958 and JJ1886 genomes. The dnaJ locus is not a known genomic island integration site and is well conserved in E. coli genomes from all phylogroups (Fig. 5). Together, these observations suggested to us that the E. coli NA114 genome has been misassembled.

Figure 4. Nucleotide pairwise comparison of four E. coli ST131 chromosomes showing extensive variation in the structure and location of EC958 prophage elements (blue) and genomic islands (green).

Figure 4

An additional prophage element present in JJ1886 has also been annotated here as Phi8 for clarity. ST131 genomes are arranged from top to bottom as follows: JJ1886, EC958, NA114, SE15. Grey shading indicates nucleotide identity between sequences according to BLASTn (62%–100%). Figure prepared using Easyfig [27].

Figure 5. Nucleotide pairwise comparison of a 200 kb region (thrA to degP) from the genomes of the four ST131 and 16 other representative E. coli strains.

Figure 5

Grey shading indicates nucleotide identity between sequences according to BLASTn (62%–100%). Coding regions immediately upstream of dnaJ are highlighted in purple. This region is well conserved in 19 of 20 E. coli genomes examined. However, a large insertion in the genome of NA114 located immediately upstream of dnaJ is clearly evident (white). E. coli genomes are arranged from top to bottom as follows: group B2 ST131 strains JJ1886, EC958, NA114, SE15 (red); group B2 strains ED1A, CFT073, UTI89, 536, S88, APEC-01 (orange); group F strain: IAI39 (yellow); group D strain UMN026 (yellow); group A strains HS, W3110, MG1655, BW2952 (green); group B1 strains IAI1, SE11 (aquamarine); group E strains O157 Sakai, O157 EDL933 (blue). Figure prepared using Easyfig [27].

To determine how a misassembly might have occurred, we replicated the NA114 assembly strategy and reassembled the genome of E. coli EC958 using simulated, error free, Illumina reads ordered against the E. coli SE15 chromosome (EC958-sim). We found that GI-pheV, GI-selC, GI-leuX and several of the prophage loci were placed incorrectly in EC958-sim relative to the complete E. coli EC958 genome (Fig. 6A). As expected, contigs associated with the EC958 genomic islands and prophages, which represent novel regions in the genome of EC958 compared to SE15, could not be correctly placed/ordered by alignment to SE15. Instead, these contigs have been randomly placed at the “end” of the chromosome in what might be mistaken for a large genomic island. Interestingly, the pattern of variation observed in the structure and location of EC958-sim mobile elements is similar to that observed in linear alignments of EC958 and NA114 (Fig. 6B and Fig. 6C). Of the 77 gaps observed when EC958-sim contigs (>200 bp) were aligned with the complete E. coli EC958 chromosome, the majority corresponded with deletions or rearrangements at corresponding positions in the E. coli NA114 chromosome (Fig. 6C and Dataset S1).

Figure 6. Nucleotide pairwise comparison between EC958, a simulated EC958 Illumina assembly and NA114.

Figure 6

A. Nucleotide pairwise comparison of the EC958 chromosome (top) and a simulated EC958 chromosome assembly (EC958-sim, bottom). Linear alignments revealed extensive variations in the location and structure of mobile elements in EC958-sim when compared to EC958. Grey shading indicates nucleotide identity between sequences according to BLASTn (62%–100%). Prophage regions are annotated as blue boxes and genomic islands as green boxes. B. Nucleotide pairwise comparison of EC958 chromosome (top) and NA114 chromosome (bottom). C. Nucleotide pairwise comparison of EC958 (top), EC958-sim (centre) and NA114 (bottom) chromosomes. EC958 prophage and genomic islands misassembled in EC958-sim are similarly misassembled in the genome of NA114 (red boxes). Red boxes indicate positions in EC958-sim and NA114 where mobile genetic elements are present in EC958. The dnaJ gene is shown as a black triangle on each chromosome. Figure prepared using Easyfig [27].

Discussion

Here we report the complete genome sequence of the E. coli ST131 strain EC958. Sequencing the genome of E. coli EC958 with six SMRT cells of data followed by de novo assembly using the HGAP method and minimal post-processing produced a high quality finished genome comparable in terms of contiguity and error rate with a 454 GS-FLX mate-pair derived assembly. Since the sequence data for this genome was generated, the PacBio SMRT platform has transitioned from the RS I to the RS II instrument and improved chemistry, with average read lengths increasing to ∼8 kb. Consequently, we expect that sequencing strategies utilising fewer than six SMRT cells on the PacBio RS II platform should be capable of producing fully assembled bacterial genomes with minimal intervention.

The sensitivity of PacBio for detecting dynamic prophage rearrangements is due to the length of PacBio reads, which allows them to span inverted regions and thus force the assembler to generate two alternative versions of regions that have undergone inversion in a subset of the bacterial population. In contrast, such mixed inversions are more difficult to detect in shorter read assemblies, which would normally require separate mapping and detection of discordant read-pairs to identify. Although there have been no other reports of phage tail inversion in PacBio assemblies to date, others have noted that a ∼7.5 kb “spurious contig” was produced in the assembly of the E. coli K-12 MG1655 genome [23]. PacBio thus offers a novel solution for studying the mechanism of phage tail fibre switching, and more generally, for the function of DNA invertase and other site-specific recombinases. For example, the DNA invertase gene has been severely truncated in the Phi4 prophage, suggesting that the inversion observed in this study must have been mediated by another enzyme in trans, as has been previously reported [49][51]. Notably, the Phi1 and Phi4 prophages encode near-identical 26 bp crossover sites at either end of their respective invertible segments (Table 3), suggesting that the Phi1 DNA invertase may be capable of mediating inversion at heterologous sites within the Phi4 prophage.

On a practical level, users should ensure that alternative allele contigs in PacBio assemblies are not integrated into the assembly of the main chromosome, which would lead to artefactual duplications in phage regions. Instead, we have annotated the EC958 chromosome to highlight the DNA invertase binding sites and invertible regions with misc_feature keys according to INSDC guidelines. We have also simplified the annotation of these regions to help avoid propagating genome-rot in E. coli genomes; for example, alternate phage tail gene 3′ fragments that contain the Phage Tail Collar domain but lack the Phage Tail Repeat domains are often auto-annotated as “Phage tail repeat domain proteins” due to their similarity to their full-length homologs. For E. coli assemblies, it is relatively straight-forward to determine which contigs are alternate versions of inverted loci as opposed to truly independent contigs, by first aligning all contigs to each other during post-assembly using tools such as ACT [25] or Contiguity (http://mjsull.github.io/Contiguity/). However, care must be taken to ensure that “recombination” is not due to adapter sequences. Due to the high error rates associated with raw PacBio reads, occasionally adapters on the ends of the SMRTbell construct are not correctly identified and removed [52]. Failure to remove adapter sequences can result in chimeric subreads which consist of the insert sequence in the forward orientation followed by the adapter sequence and the insert sequence in the reverse orientation. Adapter sequences occur randomly within the reads and are removed during read correction but aberrant reads can be produced. Retaining these reads can result in false hairpins in assemblies and the generation of small spurious contigs. Users should also be aware that small plasmids are not necessarily assembled from PacBio reads using seed read length cut-offs in excess of the total plasmid size, as illustrated in this study with the 4.1 kb pEC958B plasmid. In this case we assembled pEC958B by utilising prior knowledge of the plasmid from the original 454 assembly, however, de novo assembly of the entire genome would be possible by iteratively reducing the seed read length cut-off within HGAP (data not shown).

We previously generated a high-quality draft sequence of E. coli EC958 [7], however, using only PacBio reads we were able to assemble a high-quality complete genome sequence. A comparison of the complete PacBio and draft 454 assemblies revealed a small number of discrepancies, the majority of which were due to homopolymeric tracts in the 454 assembly or collapsed repeats that were resolved in favour of the PacBio consensus after closer inspection. Although contig order and orientation in the original draft assembly was contiguous with the PacBio assembly, only the latter was able to resolve repetitive regions of the genome such as rRNA operons, extended tracts of tRNAs, prophage loci and insertion sequences (IS) within the GI-pheV, GI-selC and GI-leuX genomic islands. The long, multi-kilobase reads produced in SMRT sequencing can be unambiguously anchored with unique sequences flanking these repeats, allowing for their accurate and uninterrupted assembly. Given the rapid improvements in PacBio technology, and the HGAP assembly software [23], this technology may become the platform of choice for generating high-quality reference sequences for bacterial genomes.

Comparisons of the complete E. coli EC958 genome against other published ST131 genomes revealed the extensive nucleotide identity that exists between the core genomes of E. coli ST131 clade C strains EC958, NA114 and JJ1886. Although E. coli NA114 possesses many of the genes associated with genomic islands and prophages of EC958 and JJ1886, it lacks insertions at recognised E. coli integration hotspots, including the pheV tRNA gene [28]. Furthermore, it contains a highly atypical insertion of ∼160 kb within a location that is consistent with the artefactual concatenation of contigs, “junked” at the end of the assembly, that could not be ordered against the SE15 reference genome. Our recent comparative genomic analysis has shown that, with the exception of GI-selC and Phi6, the genomic islands and prophages previously defined in EC958 are prevalent in nearly all other ST131 clade C strains [21]. Based on our whole genome comparisons of EC958, NA114, JJ1886 and SE15, and our simulated draft Illumina assembly (EC958-sim), we suggest that much of the variation in mobile elements observed between NA114, EC958 and JJ1886 is not biologically relevant but rather the result of systematic errors introduced during the assembly of the E. coli NA114 genome.

Genome misassemblies are not only confined to draft genomes and have previously been identified in finished genomes [15]. Furthermore, in recent years a number of draft genomes have been erroneously deposited into the complete genome division of GenBank/EMBL/DDBJ, with reversal of sequence deposition very difficult due to the structure of these databases. Due to the clinical importance of uropathogenic E. coli we believe it is important to bring the misassembly of the E. coli NA114 genome to the attention of the community, particularly as it has been used recently in genome comparisons as if it was complete [22], and was used as the reference genome in a larger study of 100 E. coli ST131 isolates [6]. It should be more broadly recognised that it is not possible to generate an accurate representation of a complete E. coli genome by de novo assembly of Illumina, 454 or Ion Torrent reads alone. Ideally, a combination of paired-end and mate-pair libraries of varying insert length, often combined with PCR/Sanger sequencing, is necessary to correctly place contigs generated by SGS technologies and accurately close the gaps between them. In contrast, we show here that PacBio is able to act as a stand-alone platform for the generation of high-quality complete bacterial genome sequences. The availability of a complete, annotated genome of E. coli EC958 will provide an important resource for future comparative studies and reference guided assemblies of E. coli ST131 clade C/fimH30 genomes.

Supporting Information

Dataset S1

Genome sequences of EC958, EC958-sim and NA114 and BLASTn comparison files required to create an ACT image as seen in figure 6C .

(ZIP)

Acknowledgments

We acknowledge Dr John Cheesbrough and staff at Preston Royal Infirmary bacteriology laboratories for original provision of the EC958 isolate and related clinical data.

Funding Statement

This work was supported by grants from the Australian National Health and Medical Research Council to MAS and SAB (APP1012076 and APP1067455) and a University of Malaya HIR Grant to KGC (UM-MOHE HIR Grant UM.C/625/1/HIR/MOHE/CHAN/14/1). MAS is supported by an Australian Research Council (ARC) Future Fellowship (FT100100662). MT is supported by an ARC Discovery Early Career Researcher Award (DE130101169). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Nicolas-Chanoine M-H, Blanco J, Leflon-Guibout V, Demarty R, Alonso MP, et al. (2008) Intercontinental emergence of Escherichia coli clone O25:H4-ST131 producing CTX-M-15. The Journal of antimicrobial chemotherapy 61: 273–281. [DOI] [PubMed] [Google Scholar]
  • 2. Lau SH, Reddy S, Cheesbrough J, Bolton FJ, Willshaw G, et al. (2008) Major uropathogenic Escherichia coli strain isolated in the northwest of England identified by multilocus sequence typing. J Clin Microbiol 46: 1076–1080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Johnson JR, Johnston B, Clabots C, Kuskowski MA, Castanheira M (2010) Escherichia coli sequence type ST131 as the major cause of serious multidrug-resistant E. coli infections in the United States. Clinical infectious diseases: an official publication of the Infectious Diseases Society of America 51: 286–294. [DOI] [PubMed] [Google Scholar]
  • 4. Coque TM, Novais A, Carattoli A, Poirel L, Pitout J, et al. (2008) Dissemination of clonally related Escherichia coli strains expressing extended-spectrum beta-lactamase CTX-M-15. Emerging infectious diseases 14: 195–200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Peirano G, Pitout JD (2010) Molecular epidemiology of Escherichia coli producing CTX-M beta-lactamases: the worldwide emergence of clone ST131 O25:H4. Int J Antimicrob Agents 35: 316–321. [DOI] [PubMed] [Google Scholar]
  • 6. Price LB, Johnson JR, Aziz M, Clabots C, Johnston B, et al. (2013) The epidemic of extended-spectrum-beta-lactamase-producing Escherichia coli ST131 is driven by a single highly pathogenic subclone, H30-Rx. MBio 4: e00377–00313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Totsika M, Beatson SA, Sarkar S, Phan M-D, Petty NK, et al. (2011) Insights into a multidrug resistant Escherichia coli pathogen of the globally disseminated ST131 lineage: genome analysis and virulence mechanisms. PloS one 6: e26578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Lau SH, Kaufmann ME, Livermore DM, Woodford N, Willshaw GA, et al. (2008) UK epidemic Escherichia coli strains A-E, with CTX-M-15 beta-lactamase, all belong to the international O25:H4-ST131 clone. J Antimicrob Chemother 62: 1241–1244. [DOI] [PubMed] [Google Scholar]
  • 9. Totsika M, Kostakioti M, Hannan TJ, Upton M, Beatson SA, et al. (2013) A FimH inhibitor prevents acute bladder infection and treats chronic cystitis caused by multidrug-resistant uropathogenic Escherichia coli ST131. The Journal of infectious diseases 208: 921–928. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Floyd RV, Upton M, Hultgren SJ, Wray S, Burdyga TV, et al. (2012) Escherichia coli-mediated impairment of ureteric contractility is uropathogenic E. coli specific. J Infect Dis 206: 1589–1596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Phan M-D, Peters KM, Sarkar S, Lukowski SW, Allsopp LP, et al. (2013) The Serum Resistome of a Globally Disseminated Multidrug Resistant Uropathogenic Escherichia coli Clone. PLoS genetics 9: e1003834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Salzberg SL, Phillippy AM, Zimin A, Puiu D, Magoc T, et al. (2012) GAGE: A critical evaluation of genome assemblies and assembly algorithms. Genome Res 22: 557–567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Nagarajan N, Cook C, Di Bonaventura M, Ge H, Richards A, et al. (2010) Finishing genomes with limited resources: lessons from an ensemble of microbial genomes. BMC genomics 11: 242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Kingsford C, Schatz MC, Pop M (2010) Assembly complexity of prokaryotic genomes using short reads. BMC bioinformatics 11: 21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Phillippy AM, Schatz MC, Pop M (2008) Genome assembly forensics: finding the elusive mis-assembly. Genome biology 9: R55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Ricker N, Qian H, Fulthorpe RR (2012) The limitations of draft assemblies for understanding prokaryotic adaptation and evolution. Genomics 100: 167–175. [DOI] [PubMed] [Google Scholar]
  • 17. Korlach J, Bjornson KP, Chaudhuri BP, Cicero RL, Flusberg BA, et al. (2010) Real-time DNA sequencing from single polymerase molecules. Methods in enzymology 472: 431–455. [DOI] [PubMed] [Google Scholar]
  • 18. Toh H, Oshima K, Toyoda A, Ogura Y, Ooka T, et al. (2010) Complete genome sequence of the wild-type commensal Escherichia coli strain SE15, belonging to phylogenetic group B2. Journal of bacteriology 192: 1165–1166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Avasthi TS, Kumar N, Baddam R, Hussain A, Nandanwar N, et al. (2011) Genome of multidrug-resistant uropathogenic Escherichia coli strain NA114 from India. Journal of bacteriology 193: 4272–4273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Andersen PS, Stegger M, Aziz M, Contente-Cuomo T, Gibbons HS, et al. (2013) Complete Genome Sequence of the Epidemic and Highly Virulent CTX-M-15-Producing H30-Rx Subclone of Escherichia coli ST131. Genome announcements 1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Petty NK, Ben Zakour NL, Stanton-Cook M, Skippington E, Totsika M, et al. (2014) Global dissemination of a multidrug resistant Escherichia coli clone. Proc Natl Acad Sci U S A 111: 5694–5699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Paul S, Linardopoulou EV, Billig M, Tchesnokova V, Price LB, et al. (2013) Role of homologous recombination in adaptive diversification of extraintestinal Escherichia coli. J Bacteriol 195: 231–242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Chin C-S, Alexander DH, Marks P, Klammer AA, Drake J, et al. (2013) Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing data. Nature methods 10: 563–569. [DOI] [PubMed] [Google Scholar]
  • 24. Darling AE, Mau B, Perna NT (2010) progressiveMauve: multiple genome alignment with gene gain, loss and rearrangement. PloS one 5: e11147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Carver T, Berriman M, Tivey A, Patel C, Bohme U, et al. (2008) Artemis and ACT: viewing, annotating and comparing sequences stored in a relational database. Bioinformatics 24: 2672–2676. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Kurtz S, Phillippy A, Delcher AL, Smoot M, Shumway M, et al. (2004) Versatile and open software for comparing large genomes. Genome Biol 5: R12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Otto TD, Dillon GP, Degrave WS, Berriman M (2011) RATT: Rapid Annotation Transfer Tool. Nucleic acids research 39: e57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Touchon M, Hoede C, Tenaillon O, Barbe V, Baeriswyl S, et al. (2009) Organised genome dynamics in the Escherichia coli species results in highly diverse adaptive paths. PLoS genetics 5: e1000344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Chen SL, Hung C-S, Xu J, Reigstad CS, Magrini V, et al. (2006) Identification of genes subject to positive selection in uropathogenic strains of Escherichia coli: a comparative genomics approach. Proceedings of the National Academy of Sciences of the United States of America 103: 5977–5982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Sullivan MJ, Petty NK, Beatson SA (2011) Easyfig: a genome comparison visualizer. Bioinformatics 27: 1009–1010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Alikhan NF, Petty NK, Ben Zakour NL, Beatson SA (2011) BLAST Ring Image Generator (BRIG): simple prokaryote genome comparisons. BMC Genomics 12: 402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. David M, Dzamba M, Lister D, Ilie L, Brudno M (2011) SHRiMP2: sensitive yet practical SHort Read Mapping. Bioinformatics (Oxford, England) 27: 1011–1012. [DOI] [PubMed] [Google Scholar]
  • 33. Welch RA, Burland V, Plunkett G, Redford P, Roesch P, et al. (2002) Extensive mosaic structure revealed by the complete genome sequence of uropathogenic Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America 99: 17020–17024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Rasko DA, Rosovitz MJ, Myers GSA, Mongodin EF, Fricke WF, et al. (2008) The pangenome structure of Escherichia coli: comparative genomic analysis of E. coli commensal and pathogenic isolates. Journal of bacteriology 190: 6881–6893. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Perna NT, Plunkett G, Burland V, Mau B, Glasner JD, et al. (2001) Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 409: 529–533. [DOI] [PubMed] [Google Scholar]
  • 36. Oshima K, Toh H, Ogura Y, Sasamoto H, Morita H, et al. (2008) Complete genome sequence and comparative analysis of the wild-type commensal Escherichia coli strain SE11 isolated from a healthy adult. DNA research: an international journal for rapid publication of reports on genes and genomes 15: 375–386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Johnson TJ, Kariyawasam S, Wannemuehler Y, Mangiamele P, Johnson SJ, et al. (2007) The genome sequence of avian pathogenic Escherichia coli strain O1∶K1∶H7 shares strong similarities with human extraintestinal pathogenic E. coli genomes. Journal of bacteriology 189: 3228–3236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Hayashi T, Makino K, Ohnishi M, Kurokawa K, Ishii K, et al. (2001) Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12. DNA research: an international journal for rapid publication of reports on genes and genomes 8: 11–22. [DOI] [PubMed] [Google Scholar]
  • 39. Hayashi K, Morooka N, Yamamoto Y, Fujita K, Isono K, et al. (2006) Highly accurate genome sequences of Escherichia coli K-12 strains MG1655 and W3110. Molecular systems biology 2: 2006.0007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Ferenci T, Zhou Z, Betteridge T, Ren Y, Liu Y, et al. (2009) Genomic sequencing reveals regulatory mutations and recombinational events in the widely used MC4100 lineage of Escherichia coli K-12. Journal of bacteriology 191: 4025–4029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Dobrindt U, Blum-Oehler G, Nagy G, Schneider G, Johann A, et al. (2002) Genetic structure and distribution of four pathogenicity islands (PAI I(536) to PAI IV(536)) of uropathogenic Escherichia coli strain 536. Infection and immunity 70: 6365–6372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Blattner FR, Plunkett G, Bloch CA, Perna NT, Burland V, et al. (1997) The complete genome sequence of Escherichia coli K-12. Science (New York, NY) 277: 1453–1462. [DOI] [PubMed] [Google Scholar]
  • 43. Gardner SN, Hall BG (2013) When whole-genome alignments just won't work: kSNP v2 software for alignment-free SNP discovery and phylogenetics of hundreds of microbial genomes. PLoS One 8: e81760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, et al. (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol 59: 307–321. [DOI] [PubMed] [Google Scholar]
  • 45. Zerbino DR, Birney E (2008) Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Genome research 18: 821–829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Sandmeier H (1994) Acquisition and rearrangement of sequence motifs in the evolution of bacteriophage tail fibres. Molecular microbiology 12: 343–350. [DOI] [PubMed] [Google Scholar]
  • 47. Fisher CR, Davies NMLL, Wyckoff EE, Feng Z, Oaks EV, et al. (2009) Genetics and virulence association of the Shigella flexneri sit iron transport system. Infection and immunity 77: 1992–1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Lloyd AL, Rasko DA, Mobley HLT (2007) Defining genomic islands and uropathogen-specific genes in uropathogenic Escherichia coli. Journal of bacteriology 189: 3532–3546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Zhang L, Zhu B, Dai R, Zhao G, Ding X (2013) Control of directionality in Streptomyces phage phiBT1 integrase-mediated site-specific recombination. PLoS One 8: e80434. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Iida S, Hiestand-Nauer R (1987) Role of the central dinucleotide at the crossover sites for the selection of quasi sites in DNA inversion mediated by the site-specific Cin recombinase of phage P1. Mol Gen Genet 208: 464–468. [DOI] [PubMed] [Google Scholar]
  • 51. Iida S, Hiestand-Nauer R (1986) Localized conversion at the crossover sequences in the site-specific DNA inversion system of bacteriophage P1. Cell 45: 71–79. [DOI] [PubMed] [Google Scholar]
  • 52. English AC, Richards S, Han Y, Wang M, Vee V, et al. (2012) Mind the gap: upgrading genomes with Pacific Biosciences RS long-read sequencing technology. PLoS One 7: e47768. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Dataset S1

Genome sequences of EC958, EC958-sim and NA114 and BLASTn comparison files required to create an ACT image as seen in figure 6C .

(ZIP)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES