Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Sep 1.
Published in final edited form as: J Immunol. 2014 Jul 25;193(5):2512–2518. doi: 10.4049/jimmunol.1400588

Acute and Chronic Effects of IL-22 on Acetaminophen-Induced Liver Injury

Dechun Feng *, Yan Wang *, Hua Wang *, Honglei Weng †, Xiaoni Kong ‡, Brittany V Martin-Murphy §, Yongmei Li *, Ogyi Park *, Steve Dooley †, Cynthia Ju §, Bin Gao *
PMCID: PMC4135042  NIHMSID: NIHMS610210  PMID: 25063867

Abstract

Acetaminophen (APAP)-induced liver injury (AILI) accounts for half of the acute liver failure cases in the United States. A better understanding of the underlying mechanisms of AILI is necessary for the development of novel antidotes. We found that pretreatment with interleukin-22 (IL-22) protected mice from APAP-mediated hepatotoxicity. The protection was dependent on STAT3, as IL-22 failed to reduce APAP hepatotoxicity in liver-specific STAT3 knockout mice. In contrast to the acute exposure to IL-22, the endogenous chronic overexpression of IL-22 in IL-22 transgenic (TG) mice or IL-22 adenovirus treatment for 6 weeks resulted in a markedly increased susceptibility to AILI. Furthermore, the hepatic expression levels of Cyp2E1 and Cyp1A2 were much higher in IL-22TG mice. Ablation of Cyp2E1 but not hepatic STAT3 abolished AILI and protein-adduct formation in IL-22TG mice. Finally, hepatic expression of HNF1α, a transcriptional factor that is known to control Cyp2E1 expression, was elevated in IL-22TG mice compared with wild-type mice. Upregulation of hepatic Cyp2E1 was only observed in mice with constitutive overexpression of IL-22 but not with short-term treatment with one dose of IL-22 or multiple doses of IL-22 for two weeks. In conclusion, short-term acute IL-22 exposure protects mice against AILI through STAT3 activation; however, chronic constitutive overexpression of IL-22 exacerbates AILI by increasing Cyp2E1 and toxic reactive APAP metabolite production. These findings may not only enhance our understanding of the effects of chronic inflammation on AILI in patients with liver disease but also helpful to identify novel therapeutic targets for the treatment of AILI.

Keywords: IL-22, APAP, STAT3, Cyp2E1, HNF1α

Introduction

Acetaminophen (APAP) is one of the most widely used drugs to relieve mild to moderate pain and reduce fever (1). APAP is generally safe at therapeutic doses; however, an overdose of APAP may lead to severe liver damage (2, 3). In the past four decades, the mechanism of APAP hepatotoxicity has been extensively studied in a murine model. APAP is bioactivated to a toxic reactive metabolite, N-acetyl-p-benzoquinone imine (NAPQI), by cytochrome 2E1 (cyp2E1) and, to a much lesser extent, cyp1A2 in the liver. NAPQI depletes glutathione (GSH) and subsequently binds to liver proteins, leading to oxidative stress, mitochondrial dysfunction, and necrotic cell death (3–7).

Cyp2E1 is critically involved in the bioactivation of APAP to form NAPQI and, thus, APAP hepatotoxicity (8). The expression and activity of Cyp2E1 are regulated by many factors. For example, alcohol and isoniazid can up-regulate cyp2E1 and enhance AILI (9–12). In contrast, Cyp2E1 expression and APAP hepatotoxicity are usually reduced by the inflammatory mediators induced by LPS (13–16) or Poly I: C (17–19). For example, interleukin (IL)-6, tumor necrosis factor (TNF)-α and interferons have been shown to suppress cyp2E1 (13, 20–22). These studies clearly demonstrate an interaction between immune cell functions and drug metabolism. However, the majority of the studies have focused on the short-term or acute effects of inflammatory cytokines on cyp2E1 expression. It is not known how the long-term elevation of cytokines in chronic inflammatory conditions, which occurs in chronic liver disease, influences cyp2E1 expression and cyp2E1-mediated drug metabolism.

IL-22 is a member of the IL-10 family of cytokines. IL-22 is mainly produced by Th17 cells, natural killer (NK) and NKT cells and plays critical roles in controlling bacterial infection and tissue repair (23–25). The hepatoprotective effects of IL-22 have been well documented in various mouse models (26–31). Clinical trials evaluating the therapeutic potential of recombinant IL-22 on alcoholic hepatitis and acute liver failure are under consideration. Our previous studies revealed that the hepatic expression of IL-22 is elevated in patients with a chronic HBV or HCV infection (32). To better understand the effects of chronic IL-22 elevation in the pathogenesis of liver diseases, we have generated liver-specific IL-22 transgenic (IL-22TG) mice, in which both hepatic and serum IL-22 levels are elevated (33). This model of IL-22TG mice serves as an excellent tool to further elucidate the impact of the chronic elevation of IL-22 on liver diseases as well as the liver’s response to drug therapies.

In the present study, we evaluated i) whether a single dose of IL-22 exerts a hepatoprotective function in AILI and ii) how the long-term elevation of IL-22 affects AILI. Our data demonstrate that the injection of a single dose of IL-22 has a prophylactic protective effect against AILI, which is in agreement with a previous report (34). The protective effect of acute IL-22 treatment on AILI is mediated through STAT3 activation because the disruption of hepatic STAT3 abolished the protective function of acute IL-22 treatment. To our surprise, the chronic elevation of IL-22 markedly exacerbates AILI. Further investigation suggested that the detrimental effect of chronic IL-22 exposure on AILI is mediated by up-regulating the hepatic expression of cyp2E1 and to a lesser extent cyp1A2. Upregulation of hepatic cyp2E1 was not observed in mice with short-term treatment with one dose of IL-22 or multiple doses of IL-22 for two weeks.

Materials and methods

Materials

Recombinant mouse IL-22 protein was provided by Dr. Xiaoqiang Yan (Generon Corporation).

Animal experiments

Male C57BL/6N mice were purchased from the National Cancer Institute (Frederick, MD). The cyp2E1 knockout (KO) mice were provided by Dr. Frank Gonzalez (NCI, NIH) and backcrossed to a C57BL6/N background for at least 8 generations in our facility. Two strains of IL-22TG mice (designated as IL-22TG6 and IL-22TG8) were generated as previously described (32). The level of serum IL-22 is much higher in the IL-22TG8 mice (~6,000 pg/ml) compared with the IL-22TG6 mice (~600 pg/ml). IL-22TG8cyp2E1KO double-mutant mice were generated through several steps of crossing the IL-22TG8 mice with cyp2E1KO mice. The liver-specific STAT3 KO mice (AlbCreSTAT3flox/flox) mice were described previously (35). IL-22TG8STAT3LKO double-mutant mice (IL-22TG8AlbCreSTAT3flox/flox) were generated via several steps of crossing the IL-22TG8STAT3flox/flox mice with AlbCreSTAT3flox/flox mice. Fresh solutions of APAP (Sigma, St. Louis, MO) were prepared immediately before use by dissolving the compound in warmed PBS. All the mice were fasted overnight before the APAP i.p. injection. Liver and blood samples were collected 3, 6 or 24 hours after the APAP injection. All the animal experiments were approved by the NIAAA animal care and use committee.

Histological analysis and immunohistochemistry

Formalin-fixed liver samples were processed, and 4-µm-thick paraffin sections were stained with hematoxylin and eosin (H&E) for histological analysis. After heat-induced epitope retrieval, paraffin-embedded sections were stained with an anti-cyp2E1 antibody (Millipore, Billerica, MA) or an anti-cyp1A2 antibody (Sigma) and visualized with DAB.

Hepatic glutathione (GSH) measurement

GSH levels were measured in whole-liver homogenates (15–25 mg each of frozen liver tissue) with a glutathione assay kit, purchased from Cayman Chemical Company (Ann Arbor, MI), according to the manufacturer’s instructions. Liver proteins were removed by adding meta-phosphoric acid prior to the measurement.

TUNEL staining

TUNEL-positive cells in sections of mouse livers were detected using an in situ apoptosis detection kit (Millipore) as instructed by the manufacturer.

Administration of the IL-22 adenovirus to mice

An IL-22 adenovirus and a GFP adenovirus were kindly provided by Drs. M. Zhang and J. Kolls (Louisiana State University, New Orleans, LA) and were prepared as described previously (29, 33). Mice were injected intravenously with adenovirus-IL-22 (5×108 pfu) or adenovirus-empty vector (5×108 pfu).

Western blot

The western blot analysis was performed as described previously (29). Protein bands were visualized with an enhanced chemiluminescence reaction (GE Healthcare, Piscataway, NJ) or enhanced fluorescence and analyzed with the Typhoon analyzer (GE Healthcare). The antibodies against JNK, p-JNK, Bcl-2, and Bcl-XL were purchased from Cell Signaling Technology. The antibodies against cyp2E1 and cyp1A2 were purchased from Millipore and Sigma, respectively. The antibody against HNF-1α was purchased from BD Bioscience. The antibody for the APAP adducts was kindly provided by Dr. Lance R. Pohl from NHLBI, NIH.

Real-time PCR

The expression levels of genes were measured by real-time quantitative PCR with an ABI7500 real-time PCR detection system (Applied Biosystems, Foster City, CA). The primers used in the real-time PCR were as follows:

  • cyp2E1: F: CTTAGGGAAAACCTCCGCAC R: GGGACATTCCTGTGTTCCAG

  • cyp1A2: F:AAAGGGGTCTTTCCACTGCT R: AGGGACACCTCACTGAATGG.

Statistical analysis

The data are expressed as the means ± SD. To compare values obtained from three or more groups, a one-factor analysis of variance (ANOVA) was used, followed by Tukey’s post hoc test. To compare values obtained from two groups, Student’s t-test was performed. Statistical significance was set at the P < 0.05 level.

Results

Short-term treatment with a single dose of IL-22 protects mice from AILI

The protective role of IL-22 in various models of acute liver injury including AILI has been well documented (26–31, 34); in this study, we also confirmed that treatment with a single dose of IL-22 prevents AILI. As shown in Fig. 1A, IL-22 pretreatment significantly blocked the elevation of ALT induced by the injection of APAP. Similar to the ALT results, H&E staining of the liver and TUNEL staining revealed a significant improvement regarding the development of necrotic areas in the liver tissue (Figs. 1B and C). However, treatment of the mice with IL-22 1.5 hours post-APAP injection failed to alleviate the liver damage (data not shown). To test whether the protective effect of IL-22 on AILI was due to the alteration of APAP metabolism, we analyzed APAP adducts in the liver by using western blotting. As illustrated in Fig. 1D, treatment with a single dose of IL-22 did not affect APAP metabolism in the liver.

Fig. 1. Short-term pretreatment with a single dose of IL-22 protects mice from AILI.

Fig. 1

Open in a new tab

Overnight-fasted WT mice were injected with IL-22 (1 mg/kg) or PBS 2 hours prior to an injection with 300 mg/kg of APAP dissolved in warm PBS. Livers and sera were obtained from these mice 6 or 24 hours post-APAP injection. (A) Serum ALT levels were measured. (B) H&E staining. (C) TUNEL staining. (D) Western blot analyses of APAP adducts in the liver protein 6 hours post-APAP injection. *** P < 0.001.

It has been reported that IL-22 rapidly activates STAT3 in the liver, thereby protecting against concanavalin A (ConA)-induced liver injury (27). To investigate the involvement of STAT3 in the IL-22-induced protection against AILI, we measured pSTAT3 levels in the liver via Western blot analysis. As illustrated in Fig. 2A, a single injection of IL-22 markedly induced STAT3 phosphorylation in the liver and upregulated the expression of the STAT3 downstream genes Bcl-2 and Bcl-xL. Upregulation of both Bcl-2 and Bcl-xL, which have been shown to stabilize mitochondrial membrane potential (36, 37) likely contribute to the protective effect of IL-22 in APAP-mediated hepatotoxicity. To define the role of hepatic STAT3 in the protective function of IL-22, we compared AILI in both WT and liver-specific STAT3 knockout (STAT3LKO) mice. As shown in Figs. 2B, C, and D, serum ALT levels were only slightly higher in STAT3LKO mice than those in WT mice after APAP injection. This difference did not reach statistical difference. In addition, there were no differences in necrotic and TUNEL positive areas between APAP-treated STAT3LKO and WT mice. The injection of a single dose of IL-22 prevented the APAP-induced elevation of serum ALT, liver necrosis and apoptosis in WT mice but failed to attenuate AILI in the STAT3LKO mice. These data suggest that the protective effect of IL-22 is mediated through the activation of STAT3.

Fig. 2. The protective effect of IL-22 pretreatment against AILI is mediated by STAT3.

Fig. 2

Open in a new tab

(A) Overnight-fasted WT mice were injected with IL-22 (1 mg/kg) or PBS for two hours, liver tissues were collected and subjected to Western blot analysis (three mice per group). (B–D) Overnight-fasted WT and STAT3LKO mice were treated with IL-22 (1 mg/kg) or PBS. Two hours later, all the mice were injected with 300 mg/kg APAP, and the livers and sera were collected from these mice 6 hours post-APAP injection. Serum ALT levels were measured (B); the liver tissues were subject to H&E staining (C) or TUNEL staining (D). *** P< 0.001.

Chronic overexpression of IL-22 exacerbates AILI

To further study the impact of IL-22 on AILI, we generated IL-22 transgenic mice to mimic the long-term high-level IL-22 expression that is found in chronic viral hepatitis patients (32). Two different transgenic strains, IL-22TG6 (serum IL-22 levels reach ~600 pg/ml) and IL-22TG8 (serum IL-22 levels reach ~6,000 pg/ml), with different serum levels of IL-22 were used. To our surprise, when mice were treated with 300 mg/kg of APAP, all the IL-22TG8 mice (n=6) died within 12 hours, whereas all the WT (n=6) and IL-22TG6 (n=5) mice survived until 24 hours after the APAP injection. When the dose of APAP was reduced to 160 mg/kg, the WT mice developed only mild liver injury; however, the IL-22TG6 and IL-22TG8 mice exhibited much more severe tissue damage, as evidenced by a marked elevation of ALT levels and increased cell death (Figs. 3A–C). Notably, the extent of the AILI correlated with the level of IL-22 in the serum because the liver injury was much more severe in the IL-22TG8 mice than in the IL-22TG6 mice. JNK activation is reported to play a crucial role in the hepatotoxicity induced by APAP-associated oxidative stress (38, 39). In agreement with the elevation of ALT activity, hepatic JNK phosphorylation was strongly induced in the IL-22TG6 and IL-22TG8 mice, but not in WT mice after administration of a low dose of APAP (Fig. 3D).

Fig. 3. Chronic overexpression of IL-22 exacerbates AILI.

Fig. 3

Open in a new tab

Overnight-fasted WT, IL-22TG6 and IL-22TG8 mice were injected (i.p) with 160 mg/kg APAP. Livers and sera were obtained from these mice 6 or 24 hours post-APAP injection. (A) Serum ALT levels were measured. (B) H&E staining. (C) TUNEL staining. (D) Western blot analyses of pJNK and JNK in the liver tissues from the mice 6 hours post-APAP injection. (E, F) WT mice were administered with adeno-GFP virus or adeno-IL-22 virus every 2 weeks for 6 weeks. All the mice were fasted overnight and treated with 160 mg/kg APAP. Livers and sera were obtained from these mice 6 or 24 hours post-APAP injection. Serum ALT levels were measured (E). H&E staining and TUNEL staining were performed (F). ** P < 0.01; *** P < 0.001.

In addition to using IL-22 TG mice, we achieved long-term high levels of IL-22 expression by treating WT mice with adenovirus-IL-22 (Ad-IL-22) once every 2 weeks for a total of 6 weeks. Control mice were treated with Ad-GFP. Two weeks after the last adenovirus injection, all the mice were fasted overnight and treated with 160 mg/kg APAP. Similar to the IL-22 TG mice, the Ad-IL-22-treated mice also developed much more severe liver damage compared with the Ad-GFP-treated control mice (Figs. 3E and F). Taken together these data suggest that, in contrast to the protective effect of a single dose of IL-22, chronically high levels of IL-22 actually exacerbate AILI.

Effects of chronic overexpression of IL-22 on APAP bioactivation and protein adduct formation

Because the degree of AILI is closely associated with the amount of NAPQI, we compared the levels of NAPQI-protein adducts in WT and IL-22 TG mice. The data reveal a marked increase of protein adduct formation in both the IL-22TG6 and the IL-22TG8 strains of mice (Fig. 4A). The data suggest that the increased susceptibility to AILI in the IL-22 TG mice is due to a greater amount of NAPQI generation. The major pathway for NAPQI detoxification is conjugation with GSH. Therefore, we measured liver GSH levels in the WT and IL-22TG8 mice before and after APAP treatment (160 mg/kg). Prior to the APAP treatment, the GSH levels were similar between the WT and IL-22TG8 mice. After the APAP challenge, the WT mice exhibited a faster recovery of GSH levels than the IL-22TG8 mice (Fig. 4B), reflecting a smaller burden of toxic NAPQI in the WT mice than in the IL-22TG8 mice.

Fig. 4. Chronic overexpression of IL-22 enhances hepatic APAP adduct formation.

Fig. 4

Open in a new tab

Overnight-fasted WT and IL-22TG8 mice were injected with 160 mg/kg APAP. Livers were obtained at various time points post-APAP injection. (A) Western blot analysis of hepatic APAP adducts from the mice treated with APAP for 6 hours. (A) Liver GSH levels were measured. ** P < 0.01.

The data indicate that the increased NAPQI generation in the IL-22 TG mice was not due to impaired detoxification in these mice. Hence, we measured the hepatic expression levels of cyp2E1 and cyp1A2, two major enzymes that mediate the bioactivation of APAP to NAPQI. As illustrated in Figs. 5A and 5B, the levels of hepatic cyp2E1 and cyp1A2 mRNA and protein were significantly higher in the IL-22TG6 and IL-22TG8 mice compared with those in the WT mice. Immunohistochemical staining further confirmed that the areas of hepatic cyp2E1 and cyp1A2 protein staining were larger in the IL-22TG6 and IL-22TG8 mice than in the WT mice (Figs. 5C and D).

Fig. 5. Chronic overexpression of IL-22 increases hepatic cyp2E1 and cyp1A2 expression.

Fig. 5

Open in a new tab

Livers were obtained from overnight-fasted WT, IL-22TG6 and IL-22TG8 mice. (A) Real-time PCR analyses of hepatic Cyp2E1 and Cyp1A2 mRNA levels. (B) Western blot analysis of hepatic Cyp2E1 and Cyp1A2 proteins. (C) Immunohistochemical analysis of liver Cyp2E1 and Cyp1A2. (D) The quantification of protein expression levels from panel C. * P < 0.05; ** P < 0.01; *** P < 0.001.

We previously demonstrated that serum IL-22 levels in 2-week-old mice were approximately 30% of the peak level observed in mice at 4 weeks of age or older (32). As illustrated in Fig. S1, the hepatic expression of the cyp2E1 and cyp1A2 proteins was comparable in 2-week-old WT and IL-22TG8 mice. These data suggest that the upregulation of hepatic cyp2E1 and cyp1A2 by IL-22 requires long-term exposure (a 2-week exposure is inadequate).

The deletion of Cyp2E1 abrogates the increased susceptibility to APAP hepatotoxicity in IL-22 TG mice

To further confirm that the up-regulation of cyp2E1 by the chronic expression of IL-22 causes increased AILI in the IL-22TG mice, we generated IL-22TG8cyp2E1KO double mutant mice via several steps of crossing the IL-22TG8 mice with cyp2E1KO mice. Compared with the IL-22TG8 mice, the double-mutant mice had similar levels of IL-22 in the serum, but the AILI was almost completely abolished (Fig. 6A–D). Moreover, similar to the cyp2E1KO mice, no APAP adducts were detected in the double mutant mice (Fig. 6E). Of note, although cyp1A2 is not deleted in the IL-22TG8cyp2E1KO mice, an APAP dose of 160 mg/kg did not cause liver injury. This result suggests that cyp1A2 plays a minor role in relatively low-dose AILI, which is consistent with a previous report (40).

Fig. 6. Increased cyp2E1 contributes to the increased susceptibility of IL-22 TG mice to AILI.

Fig. 6

Open in a new tab

(A) Serum levels of IL-22 were measured in the IL-22TG8 mice and the IL-22TG8cyp2E1KO double-mutant mice. (B-E) Overnight-fasted WT, IL-22TG8, IL-22TG8cyp2E1KO and cyp2E1KO mice were injected with 160 mg/kg APAP. Sera and livers were obtained 6 and 24 hours post-APAP injection. (B) Serum ALT levels were measured. (C) H&E staining. (D) TUNEL staining. (E) Western blot analyses of APAP adducts in the liver protein 6 hours post-APAP injection. ***P < 0.001.

HNF1α, but not STAT3, is involved in the upregulation of cyp2E1 by the chronic overexpression of IL-22

Because STAT3 is the main downstream signaling molecule for IL-22, we first examined whether STAT3 mediates the IL-22-induced upregulation of cyp2E1 expression in the liver. We generated IL-22TG8STAT3LKO double mutant mice (IL-22TG8AlbCreSTAT3flox/flox) via several steps of crossing IL-22TG8STAT3flox/flox mice with AlbCreSTAT3flox/flox mice. The level of cyp2E1 expression and the susceptibility to AILI were compared between the IL-22TG8 and IL-22TG8STAT3LKO mice. The data revealed similar levels of hepatic cyp2E1 expression (Fig. 7A) and serum ALT activity (Fig. 7B), as well as similar changes in liver histopathology (Fig. 7C) and TUNEL staining (Fig. 7D) between the two strains of mice. Necrotic areas in the liver (as observed after APAP administration) are usually susceptible to nonspecific staining. To rule out this possiblility, we performed negative control staining (without terminal transferase) for liver slides with necrotic areas. As illustrated in Fig. 7E, no nonspecific staining was observed in negative control staining slides, which indicated the TUNEL staining was specific. These findings indicate that the effect of IL-22 on cyp2E1 upregulation is independent of STAT3.

Fig. 7. The increased expression of cyp2E1 is not dependent on STAT3 activation.

Fig. 7

Open in a new tab

(A) Immunohistochemical analysis of hepatic cyp2E1 protein from overnight-fasted IL-22TG8 and IL-22TG8 STAT3LKO mice. (B–D) Overnight-fasted IL-22TG8, STAT3LKO and IL-22TG8 STAT3LKO mice received a 160 mg/kg APAP injection. Serum ALT levels were measured 6 hours post-APAP injection (B). Representative H&E staining (C) and TUNEL staining (D) are shown. Negative control staining for TUNEL assay is shown in panel E. ns P>0.05.

Several transcription factors, such as STAT6, NF-κB and HNF1α, have been reported to up-regulate cyp2E1 expression (41–44). We did not observe any differences in the hepatic protein levels of pSTAT6 or NF-κB p65 between WT mice and the IL-22TG6 or IL-22TG8 mice (Fig. 8A). In contrast, the expression of the well-documented liver-specific transcription factor HNF1α was markedly increased in the livers of the IL-22TG6 and IL-22TG8 mice compared with the WT mice (Fig. 8A). Moreover, we tested the DNA binding activity of HNF1α to the cyp2E1 promoter via a chromatin-IP (ChIP) assay. Consistent with the Western blot results, the binding of HNF1α to the cyp2E1 promoter was significantly increased in the IL-22TG6 and IL-22TG8 mice in a dose dependent manner (binding was higher in the IL-22TG8 than in the IL-22TG6 mice) (Fig. 8B). These results suggest that HNF1α may be a downstream factor that mediates the regulation of cyp2E1 by IL-22. We then investigated whether a single dose of IL-22 also regulates HNF1α expression. Liver protein was extracted from mice that received IL-22 for 24 and 48 hours or PBS as a control. No differences were found in HNF1α levels among these groups. Moreover, Cyp2E1 levels remained unchanged (Fig. S2). In addition, the hepatic expression of the HNF1α protein was comparable in 2-week-old WT and IL-22TG8 mice (supporting Fig. 1), and was not altered after injection of one-dose of IL-22 or two-week injection of multiple doses of IL-22 (supporting Fig. 2 and supporting Fig. 3). Collectively, these findings indicate that the upregulation of HNF1α by IL-22 requires long-term exposure.

Fig. 8. Increased Cyp2E1 levels are associated with HNF1α upregulation.

Fig. 8

Open in a new tab

Livers were obtained from overnight-fasted WT, IL-22TG6 and IL-22TG8 mice. (A) Western blot analyses of hepatic HNF1α, p65 and pSTAT6 proteins. (B) DNA binding activity of HNF1α in the liver was determined via a ChIP assay. *P<0.05; ***P<0.01.

Discussion

In the present study, we found that pretreatment with a single dose of IL-22, through the activation of STAT3, protected against AILI. However, chronic constitutive exposure to IL-22, through the up-regulation of cyp2E1, exacerbated AILI.

The hepatoprotective effects of STAT3 activation have been well documented (27, 45–48). STAT3 activation in the liver has also been observed after APAP challenge (49, 50), and STAT3 is believed to stimulate hepatocyte compensatory proliferation, thereby protecting against APAP hepatotoxicity (49). In addition to STAT3, several other signaling pathways, which are known to regulate cell survival, are also activated by IL-22. These include STAT1, STAT5, ERK1/2, and AKT (51). During the preparation of our manuscript, Scheiermann et al. reported that the pretreatment of mice with IL-22 prevented AILI; however, the underlying mechanisms were not elucidated (34). In the current study, we demonstrated that the protective effect of IL-22 is abrogated in liver-specific STAT3 KO mice. This suggests that STAT3, not other signaling pathways, play an important role in mediating the hepatoprotection by IL-22 (Figs. 1 and 2). Notably, the treatment of mice with IL-22 1.5 hours post-APAP injection had no protective effect against AILI (data not shown). Our previous study revealed that an IL-22 injection rapidly induced STAT3 activation in vivo with a peak time 1 hour after IL-22 administration (27). Nevertheless, the induction of STAT3 downstream survival genes, such as Bcl2 and Bcl-xL, is likely delayed. In contrast, the onset of AILI in mice is very rapid because massive APAP adducts form as early as 2 hours after APAP injection (52). This may explain why IL-22 pretreatment is protective, while treatment at 1.5 hours post-APAP challenge fails to protect against AILI.

In contrast to the hepatoprotective effect of a single dose of IL-22, the chronic expression of high levels of IL-22, which is observed in viral hepatitis patients, significantly exacerbates AILI through the up-regulation of cyp2E1. Furthermore, the effect of IL-22 on cyp2E1 is not dependent on STAT3 because the deletion of hepatic STAT3 did not abolish the upregulation of cyp2E1 in the IL-22 TG mice (Fig. 7). Several transcription factors, such as STAT6, NF-κB and HNF1α, have been shown to up-regulate cyp2E1 expression (41–44). Among these transcription factors, only HNF1α protein expression and the DNA binding activity of this factor were upregulated in the IL-22 TG mice. This suggests that chronic elevation of IL-22 upregulates hepatic expression of HNF1α, followed by the stimulation of cyp2E1 expression. Although STAT3 activation is a major downstream component of IL-22 signaling, the disruption of hepatic STAT3 did not affect hepatic HNF1α expression in the IL-22 TG mice, suggesting that chronic IL-22 exposure upregulates hepatic cyp2E1 expression in vivo via the activation of a signaling pathway(s) other than STAT3. Further studies are required to identify this signaling pathway(s).

One clinical implication of this study may be related to the increased susceptibility to hepatotoxicity induced by APAP overdose in HCV patients. A previous nationwide analysis in the USA demonstrated that HCV infection potentiates the hepatotoxic effects of APAP overdose (53). The effects of HCV on APAP overdose sensitivity was further confirmed in an HCV TG mouse model (54). We previously demonstrated that high levels of IL-22 expression were detected in chronic HCV patients (32). Several studies also reported that serum levels of IL-22 were elevated in patients with HBV and HCV infection, ranging from 10 pg/ml to 400 ng/ml (55–57). In the current study, we used two lines of IL-22TG mice, including IL-22TG8 mice with 6000ng/ml and IL-22TG6 mice with 600ng/ml. Both lines of transgenic mice had increased sensitivity to APAP-induced liver injury. The ~600 ng/ml serum IL-22 levels in IL-22TG6 mice were similar to those from HBV patients as reported by Zhang et al. (57). Therefore, we believe that the data from IL-22TG6 mice are clinically relevant. It will be interesting to investigate whether hepatic expression of cyp2E1 in HCV patients is elevated and whether such elevation correlates with IL-22 levels and the increased susceptibility of these patients to hepatotoxicity induced by APAP overdose. However, the situation in patients may be more complex because both viral factors and immune responses may regulate the expression of CYPs in HCV patients. In contrast to IL-22, many cytokines involved in liver inflammation have been shown to be negative regulators of cyp2E1 expression (13, 20–22). Thus, hepatic CYP levels in HCV patients are likely up-regulated by IL-22 but downregulated by many other pro-inflammatory cytokines. Individual CYP levels are a result of the net effect of the two opposing factors and may vary significantly. When these patients are treated with drugs that are metabolized by CYPs, variations in pharmacodynamics and pharmacokinetics as well as drug toxicity will likely occur.

Because of the beneficial effects of IL-22 on liver damage, recombinant IL-22 is currently being developed to treat inflammatory liver disease and to promote liver regeneration after injury. Although our current study revealed that chronic overexpression of IL-22 via transgenic expression or injection of IL-22 adenovirus up-regulates cyp2E1 and cyp1A2 expression levels, short-term treatment with one dose of IL-22 or multiple doses of IL-22 for two weeks did not alter cyp2E1 (supporting Fig. 2 and supporting Fig. 3). Therefore, it is plausible to speculate that treatment of patients with multiple doses of IL-22 unlikely affects hepatic cyp2E1 expression.

Supplementary Material

1

Acknowledgements

We thank Drs. M. Zhang and J. Kolls from Louisiana State University, New Orleans, LA for providing the Ad-GFP and Ad-IL-22 and Dr. Lance R. Pohl from NHLBI, NIH for providing the APAP adduct antibody.

This work was supported by the intramural program of NIAAA, NIH.

Abbreviations

adeno-IL-22

IL-22 adenovirus

adeno-GFP

green fluorescent protein adenovirus

IL-22 TG

IL-22 transgenic mice

STAT3

signal transducer and activator of transcription 3

LPS

lipopolysaccharide

HBV

hepatitis B virus

HCV

hepatitis C virus

TUNEL

Terminal deoxynucleotidyl transferase dUTP nick end labeling

Footnotes

No conflicts of interest exist for any of the authors.

References

  • 1.Kaufman DW, Kelly JP, Rosenberg L, Anderson TE, Mitchell AA. Recent patterns of medication use in the ambulatory adult population of the United States: the Slone survey. JAMA. 2002;287:337–344. doi: 10.1001/jama.287.3.337. [DOI] [PubMed] [Google Scholar]
  • 2.Larson AM, Polson J, Fontana RJ, Davern TJ, Lalani E, Hynan LS, Reisch JS, Schiodt FV, Ostapowicz G, Shakil AO, Lee WM. Acetaminophen-induced acute liver failure: results of a United States multicenter, prospective study. Hepatology. 2005;42:1364–1372. doi: 10.1002/hep.20948. [DOI] [PubMed] [Google Scholar]
  • 3.McGill MR, Sharpe MR, Williams CD, Taha M, Curry SC, Jaeschke H. The mechanism underlying acetaminophen-induced hepatotoxicity in humans and mice involves mitochondrial damage and nuclear DNA fragmentation. J Clin Invest. 2012;122:1574–1583. doi: 10.1172/JCI59755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Mitchell JR, Jollow DJ, Potter WZ, Davis DC, Gillette JR, Brodie BB. Acetaminophen-induced hepatic necrosis. I. Role of drug metabolism. J Pharmacol Exp Ther. 1973;187:185–194. [PubMed] [Google Scholar]
  • 5.Kon K, Kim JS, Jaeschke H, Lemasters JJ. Mitochondrial permeability transition in acetaminophen-induced necrosis and apoptosis of cultured mouse hepatocytes. Hepatology. 2004;40:1170–1179. doi: 10.1002/hep.20437. [DOI] [PubMed] [Google Scholar]
  • 6.Masubuchi Y, Suda C, Horie T. Involvement of mitochondrial permeability transition in acetaminophen-induced liver injury in mice. J Hepatol. 2005;42:110–116. doi: 10.1016/j.jhep.2004.09.015. [DOI] [PubMed] [Google Scholar]
  • 7.Gujral JS, Knight TR, Farhood A, Bajt ML, Jaeschke H. Mode of cell death after acetaminophen overdose in mice: apoptosis or oncotic necrosis? Toxicol Sci. 2002;67:322–328. doi: 10.1093/toxsci/67.2.322. [DOI] [PubMed] [Google Scholar]
  • 8.Lee SS, Buters JT, Pineau T, Fernandez-Salguero P, Gonzalez FJ. Role of CYP2E1 in the hepatotoxicity of acetaminophen. J Biol Chem. 1996;271:12063–12067. doi: 10.1074/jbc.271.20.12063. [DOI] [PubMed] [Google Scholar]
  • 9.Walker RM, McElligott TF, Power EM, Massey TE, Racz WJ. Increased acetaminophen-induced hepatotoxicity after chronic ethanol consumption in mice. Toxicology. 1983;28:193–206. doi: 10.1016/0300-483x(83)90117-8. [DOI] [PubMed] [Google Scholar]
  • 10.Burk RF, Hill KE, Hunt RW, Jr, Martin AE. Isoniazid potentiation of acetaminophen hepatotoxicity in the rat and 4-methylpyrazole inhibition of it. Res Commun Chem Pathol Pharmacol. 1990;69:115–118. [PubMed] [Google Scholar]
  • 11.Prasad JS, Chen NQ, Liu YX, Goon DJ, Holtzman JL. Effects of ethanol and inhibitors on the binding and metabolism of acetaminophen and N-acetyl-p-benzoquinone imine by hepatic microsomes from control and ethanol-treated rats. Biochem Pharmacol. 1990;40:1989–1995. doi: 10.1016/0006-2952(90)90228-d. [DOI] [PubMed] [Google Scholar]
  • 12.Sato C, Matsuda Y, Lieber CS. Increased hepatotoxicity of acetaminophen after chronic ethanol consumption in the rat. Gastroenterology. 1981;80:140–148. [PubMed] [Google Scholar]
  • 13.Siewert E, Bort R, Kluge R, Heinrich PC, Castell J, Jover R. Hepatic cytochrome P450 down-regulation during aseptic inflammation in the mouse is interleukin 6 dependent. Hepatology. 2000;32:49–55. doi: 10.1053/jhep.2000.8532. [DOI] [PubMed] [Google Scholar]
  • 14.Abdulla D, Goralski KB, Renton KW. The regulation of cytochrome P450 2E1 during LPS-induced inflammation in the rat. Toxicol Appl Pharmacol. 2006;216:1–10. doi: 10.1016/j.taap.2006.03.012. [DOI] [PubMed] [Google Scholar]
  • 15.Cheng PY, Wang M, Morgan ET. Rapid transcriptional suppression of rat cytochrome P450 genes by endotoxin treatment and its inhibition by curcumin. J Pharmacol Exp Ther. 2003;307:1205–1212. doi: 10.1124/jpet.103.057174. [DOI] [PubMed] [Google Scholar]
  • 16.Sewer MB, Morgan ET. Down-regulation of the expression of three major rat liver cytochrome P450S by endotoxin in vivo occurs independently of nitric oxide production. J Pharmacol Exp Ther. 1998;287:352–358. [PubMed] [Google Scholar]
  • 17.Renton KW, Dickson G. The prevention of acetaminophen-induced hepatotoxicity by the interferon inducer poly(rI. rC) Toxicol Appl Pharmacol. 1984;72:40–45. doi: 10.1016/0041-008x(84)90247-3. [DOI] [PubMed] [Google Scholar]
  • 18.Kalabis GM, Wells PG. Biphasic modulation of acetaminophen bioactivation and hepatotoxicity by pretreatment with the interferon inducer polyinosinic-polycytidylic acid. J Pharmacol Exp Ther. 1990;255:1408–1419. [PubMed] [Google Scholar]
  • 19.Ghaffari AA, Chow EK, Iyer SS, Deng JC, Cheng G. Polyinosinic-polycytidylic acid suppresses acetaminophen-induced hepatotoxicity independent of type I interferons and toll-like receptor 3. Hepatology. 2011;53:2042–2052. doi: 10.1002/hep.24316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Warren GW, Poloyac SM, Gary DS, Mattson MP, Blouin RA. Hepatic cytochrome P-450 expression in tumor necrosis factor-alpha receptor (p55/p75) knockout mice after endotoxin administration. J Pharmacol Exp Ther. 1999;288:945–950. [PubMed] [Google Scholar]
  • 21.Abdel-Razzak Z, Loyer P, Fautrel A, Gautier JC, Corcos L, Turlin B, Beaune P, Guillouzo A. Cytokines down-regulate expression of major cytochrome P-450 enzymes in adult human hepatocytes in primary culture. Mol Pharmacol. 1993;44:707–715. [PubMed] [Google Scholar]
  • 22.Aitken AE, Richardson TA, Morgan ET. Regulation of drug-metabolizing enzymes and transporters in inflammation. Annu Rev Pharmacol Toxicol. 2006;46:123–149. doi: 10.1146/annurev.pharmtox.46.120604.141059. [DOI] [PubMed] [Google Scholar]
  • 23.Wolk K, Witte E, Witte K, Warszawska K, Sabat R. Biology of interleukin-22. Semin Immunopathol. 2010;32:17–31. doi: 10.1007/s00281-009-0188-x. [DOI] [PubMed] [Google Scholar]
  • 24.Witte E, Witte K, Warszawska K, Sabat R, Wolk K. Interleukin-22: a cytokine produced by T, NK and NKT cell subsets, with importance in the innate immune defense and tissue protection. Cytokine Growth Factor Rev. 2010;21:365–379. doi: 10.1016/j.cytogfr.2010.08.002. [DOI] [PubMed] [Google Scholar]
  • 25.Rutz S, Ouyang W. Regulation of interleukin-10 and interleukin-22 expression in T helper cells. Curr Opin Immunol. 2011;23:605–612. doi: 10.1016/j.coi.2011.07.018. [DOI] [PubMed] [Google Scholar]
  • 26.Xing WW, Zou MJ, Liu S, Xu T, Gao J, Wang JX, Xu DG. Hepatoprotective effects of IL-22 on fulminant hepatic failure induced by d-galactosamine and lipopolysaccharide in mice. Cytokine. 2011;56:174–179. doi: 10.1016/j.cyto.2011.07.022. [DOI] [PubMed] [Google Scholar]
  • 27.Radaeva S, Sun R, Pan HN, Hong F, Gao B. Interleukin 22 (IL-22) plays a protective role in T cell-mediated murine hepatitis: IL-22 is a survival factor for hepatocytes via STAT3 activation. Hepatology. 2004;39:1332–1342. doi: 10.1002/hep.20184. [DOI] [PubMed] [Google Scholar]
  • 28.Zenewicz LA, Yancopoulos GD, Valenzuela DM, Murphy AJ, Karow M, Flavell RA. Interleukin-22 but not interleukin-17 provides protection to hepatocytes during acute liver inflammation. Immunity. 2007;27:647–659. doi: 10.1016/j.immuni.2007.07.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ki SH, Park O, Zheng M, Morales-Ibanez O, Kolls JK, Bataller R, Gao B. Interleukin-22 treatment ameliorates alcoholic liver injury in a murine model of chronic-binge ethanol feeding: role of signal transducer and activator of transcription 3. Hepatology. 2010;52:1291–1300. doi: 10.1002/hep.23837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wahl C, Wegenka UM, Leithauser F, Schirmbeck R, Reimann J. IL-22-dependent attenuation of T cell-dependent (ConA) hepatitis in herpes virus entry mediator deficiency. J Immunol. 2009;182:4521–4528. doi: 10.4049/jimmunol.0802810. [DOI] [PubMed] [Google Scholar]
  • 31.Chestovich PJ, Uchida Y, Chang W, Ajalat M, Lassman C, Sabat R, Busuttil RW, Kupiec-Weglinski JW. Interleukin-22: implications for liver ischemia-reperfusion injury. Transplantation. 2012;93:485–492. doi: 10.1097/TP.0b013e3182449136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Park O, Wang H, Weng H, Feigenbaum L, Li H, Yin S, Ki SH, Yoo SH, Dooley S, Wang FS, Young HA, Gao B. In vivo consequences of liver-specific interleukin-22 expression in mice: Implications for human liver disease progression. Hepatology. 2011;54:252–261. doi: 10.1002/hep.24339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Feng D, Kong X, Weng H, Park O, Wang H, Dooley S, Gershwin ME, Gao B. Interleukin-22 promotes proliferation of liver stem/progenitor cells in mice and patients with chronic hepatitis B virus infection. Gastroenterology. 2012;143:188–198 e187. doi: 10.1053/j.gastro.2012.03.044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Scheiermann P, Bachmann M, Goren I, Zwissler B, Pfeilschifter J, Muhl H. Application of interleukin-22 mediates protection in experimental acetaminophen-induced acute liver injury. Am J Pathol. 2013;182:1107–1113. doi: 10.1016/j.ajpath.2012.12.010. [DOI] [PubMed] [Google Scholar]
  • 35.Horiguchi N, Wang L, Mukhopadhyay P, Park O, Jeong WI, Lafdil F, Osei-Hyiaman D, Moh A, Fu XY, Pacher P, Kunos G, Gao B. Cell type-dependent pro- and anti-inflammatory role of signal transducer and activator of transcription 3 in alcoholic liver injury. Gastroenterology. 2008;134:1148–1158. doi: 10.1053/j.gastro.2008.01.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Sung KF, Odinokova IV, Mareninova OA, Rakonczay Z, Jr, Hegyi P, Pandol SJ, Gukovsky I, Gukovskaya AS. Prosurvival Bcl-2 proteins stabilize pancreatic mitochondria and protect against necrosis in experimental pancreatitis. Experimental cell research. 2009;315:1975–1989. doi: 10.1016/j.yexcr.2009.01.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Chen YB, Aon MA, Hsu YT, Soane L, Teng X, McCaffery JM, Cheng WC, Qi B, Li H, Alavian KN, Dayhoff-Brannigan M, Zou S, Pineda FJ, O'Rourke B, Ko YH, Pedersen PL, Kaczmarek LK, Jonas EA, Hardwick JM. Bcl-xL regulates mitochondrial energetics by stabilizing the inner membrane potential. The Journal of cell biology. 2011;195:263–276. doi: 10.1083/jcb.201108059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Henderson NC, Pollock KJ, Frew J, Mackinnon AC, Flavell RA, Davis RJ, Sethi T, Simpson KJ. Critical role of c-jun (NH2) terminal kinase in paracetamol- induced acute liver failure. Gut. 2007;56:982–990. doi: 10.1136/gut.2006.104372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Latchoumycandane C, Goh CW, Ong MM, Boelsterli UA. Mitochondrial protection by the JNK inhibitor leflunomide rescues mice from acetaminophen-induced liver injury. Hepatology. 2007;45:412–421. doi: 10.1002/hep.21475. [DOI] [PubMed] [Google Scholar]
  • 40.Zaher H, Buters JT, Ward JM, Bruno MK, Lucas AM, Stern ST, Cohen SD, Gonzalez FJ. Protection against acetaminophen toxicity in CYP1A2 and CYP2E1 double-null mice. Toxicol Appl Pharmacol. 1998;152:193–199. doi: 10.1006/taap.1998.8501. [DOI] [PubMed] [Google Scholar]
  • 41.Wang J, Hu Y, Nekvindova J, Ingelman-Sundberg M, Neve EP. IL-4-mediated transcriptional regulation of human CYP2E1 by two independent signaling pathways. Biochem Pharmacol. 2010;80:1592–1600. doi: 10.1016/j.bcp.2010.08.005. [DOI] [PubMed] [Google Scholar]
  • 42.Zordoky BN, El-Kadi AO. Role of NF-kappaB in the regulation of cytochrome P450 enzymes. Curr Drug Metab. 2009;10:164–178. doi: 10.2174/138920009787522151. [DOI] [PubMed] [Google Scholar]
  • 43.Matsunaga N, Ikeda M, Takiguchi T, Koyanagi S, Ohdo S. The molecular mechanism regulating 24-hour rhythm of CYP2E1 expression in the mouse liver. Hepatology. 2008;48:240–251. doi: 10.1002/hep.22304. [DOI] [PubMed] [Google Scholar]
  • 44.Liu SY, Gonzalez FJ. Role of the liver-enriched transcription factor HNF-1 alpha in expression of the CYP2E1 gene. DNA Cell Biol. 1995;14:285–293. doi: 10.1089/dna.1995.14.285. [DOI] [PubMed] [Google Scholar]
  • 45.Kovalovich K, DeAngelis RA, Li W, Furth EE, Ciliberto G, Taub R. Increased toxin-induced liver injury and fibrosis in interleukin-6-deficient mice. Hepatology. 2000;31:149–159. doi: 10.1002/hep.510310123. [DOI] [PubMed] [Google Scholar]
  • 46.Hong F, Jaruga B, Kim WH, Radaeva S, El-Assal ON, Tian Z, Nguyen VA, Gao B. Opposing roles of STAT1 and STAT3 in T cell-mediated hepatitis: regulation by SOCS. The Journal of clinical investigation. 2002;110:1503–1513. doi: 10.1172/JCI15841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Streetz KL, Wustefeld T, Klein C, Kallen KJ, Tronche F, Betz UA, Schutz G, Manns MP, Muller W, Trautwein C. Lack of gp130 expression in hepatocytes promotes liver injury. Gastroenterology. 2003;125:532–543. doi: 10.1016/s0016-5085(03)00901-6. [DOI] [PubMed] [Google Scholar]
  • 48.Klein C, Wustefeld T, Assmus U, Roskams T, Rose-John S, Muller M, Manns MP, Ernst M, Trautwein C. The IL-6-gp130-STAT3 pathway in hepatocytes triggers liver protection in T cell-mediated liver injury. J Clin Invest. 2005;115:860–869. doi: 10.1172/JCI200523640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Nishina T, Komazawa-Sakon S, Yanaka S, Piao X, Zheng DM, Piao JH, Kojima Y, Yamashina S, Sano E, Putoczki T, Doi T, Ueno T, Ezaki J, Ushio H, Ernst M, Tsumoto K, Okumura K, Nakano H. Interleukin-11 links oxidative stress and compensatory proliferation. Sci Signal. 2012;5:ra5. doi: 10.1126/scisignal.2002056. [DOI] [PubMed] [Google Scholar]
  • 50.Numata K, Kubo M, Watanabe H, Takagi K, Mizuta H, Okada S, Kunkel SL, Ito T, Matsukawa A. Overexpression of suppressor of cytokine signaling-3 in T cells exacerbates acetaminophen-induced hepatotoxicity. J Immunol. 2007;178:3777–3785. doi: 10.4049/jimmunol.178.6.3777. [DOI] [PubMed] [Google Scholar]
  • 51.Brand S, Dambacher J, Beigel F, Zitzmann K, Heeg MH, Weiss TS, Prufer T, Olszak T, Steib CJ, Storr M, Goke B, Diepolder H, Bilzer M, Thasler WE, Auernhammer CJ. IL-22-mediated liver cell regeneration is abrogated by SOCS-1/3 overexpression in vitro. American journal of physiology. Gastrointestinal and liver physiology. 2007;292:G1019–G1028. doi: 10.1152/ajpgi.00239.2006. [DOI] [PubMed] [Google Scholar]
  • 52.Hur KY, So JS, Ruda V, Frank-Kamenetsky M, Fitzgerald K, Koteliansky V, Iwawaki T, Glimcher LH, Lee AH. IRE1alpha activation protects mice against acetaminophen-induced hepatotoxicity. J Exp Med. 2012;209:307–318. doi: 10.1084/jem.20111298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Nguyen GC, Sam J, Thuluvath PJ. Hepatitis C is a predictor of acute liver injury among hospitalizations for acetaminophen overdose in the United States: a nationwide analysis. Hepatology. 2008;48:1336–1341. doi: 10.1002/hep.22536. [DOI] [PubMed] [Google Scholar]
  • 54.Uehara T, Kosyk O, Jeannot E, Bradford BU, Tech K, Macdonald JM, Boorman GA, Chatterjee S, Mason RP, Melnyk SB, Tryndyak VP, Pogribny IP, Rusyn I. Acetaminophen-induced acute liver injury in HCV transgenic mice. Toxicol Appl Pharmacol. 2013;266:224–232. doi: 10.1016/j.taap.2012.11.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Dambacher J, Beigel F, Zitzmann K, Heeg MH, Goke B, Diepolder HM, Auernhammer CJ, Brand S. The role of interleukin-22 in hepatitis C virus infection. Cytokine. 2008;41:209–216. doi: 10.1016/j.cyto.2007.11.016. [DOI] [PubMed] [Google Scholar]
  • 56.Okuhara S, Umemura T, Joshita S, Shibata S, Kimura T, Morita S, Komatsu M, Matsumoto A, Yoshizawa K, Katsuyama Y, Ota M, Tanaka E. Serum levels of interleukin-22 and hepatitis B core-related antigen are associated with treatment response to entecavir therapy in chronic hepatitis B. Hepatology research : the official journal of the Japan Society of Hepatology. 2013 doi: 10.1111/hepr.12287. [DOI] [PubMed] [Google Scholar]
  • 57.Zhang Y, Cobleigh MA, Lian JQ, Huang CX, Booth CJ, Bai XF, Robek MD. A proinflammatory role for interleukin-22 in the immune response to hepatitis B virus. Gastroenterology. 2011;141:1897–1906. doi: 10.1053/j.gastro.2011.06.051. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS610210-supplement-1.pdf (195.9KB, pdf)

RESOURCES