Identification and Characterization of a Novel Secreted Glycosidase with Multiple Glycosidase Activities in Streptococcus intermedius

Abstract

Streptococcus intermedius is a known human pathogen and belongs to the anginosus group (S. anginosus, S. intermedius, and S. constellatus) of streptococci (AGS). We found a large open reading frame (6,708 bp) in the lac operon, and bioinformatic analysis suggested that this gene encodes a novel glycosidase that can exhibit β-d-galactosidase and N-acetyl-β-d-hexosaminidase activities. We, therefore, named this protein “multisubstrate glycosidase A” (MsgA). To test whether MsgA has these glycosidase activities, the msgA gene was disrupted in S. intermedius. The msgA-deficient mutant no longer showed cell- and supernatant-associated β-d-galactosidase, β-d-fucosidase, N-acetyl-β-d-glucosaminidase, and N-acetyl-β-d-galactosaminidase activities, and all phenotypes were complemented in trans with a recombinant plasmid carrying msgA. Purified MsgA had all four of these glycosidase activities and exhibited the lowest K_m with 4-methylumbelliferyl-linked N-acetyl-β-d-glucosaminide and the highest k_cat with 4-methylumbelliferyl-linked β-d-galactopyranoside. In addition, the purified LacZ domain of MsgA had β-d-galactosidase and β-d-fucosidase activities, and the GH20 domain exhibited both N-acetyl-β-d-glucosaminidase and N-acetyl-β-d-galactosaminidase activities. The β-d-galactosidase and β-d-fucosidase activities of MsgA are thermolabile, and the optimal temperature of the reaction was 40°C, whereas almost all enzymatic activities disappeared at 49°C. The optimal temperatures for the N-acetyl-β-d-glucosaminidase and N-acetyl-β-d-galactosaminidase activities were 58 and 55°C, respectively. The requirement of sialidase treatment to remove sialic acid residues of the glycan branch end for glycan degradation by MsgA on human α₁-antitrypsin indicates that MsgA has exoglycosidase activities. MsgA and sialidase might have an important function in the production and utilization of monosaccharides from oligosaccharides, such as glycans for survival in a normal habitat and for pathogenicity of S. intermedius.

INTRODUCTION

Streptococcus intermedius is a facultatively anaerobic, opportunistic pathogen that belongs to the anginosus group of streptococci (AGS), which also includes Streptococcus anginosus and Streptococcus constellatus (1, 2). Taxonomic studies revealed that S. anginosus consists of 2 subspecies: subsp. anginosus and subsp. whileyi. S. constellatus consists of 3 subspecies: subsp. constellatus, subsp. pharyngis, and subsp. viborgensis (3). Members of AGS tend to form local suppurative infections, and these organisms are the most common pathogens associated with bacterial intracerebral abscesses (2, 4–7). Among AGS species, only S. intermedius has the ily gene, which encodes a cytolysin called intermedilysin (ILY), which is a member of the cholesterol-dependent cytolysin (CDC) family and is considered the major virulence factor for infectivity and cytotoxicity toward human cells (8–10). In contrast to other CDC family members, ILY can bind specifically to a glycosylphosphatidylinositol-linked membrane protein, human CD59—a regulator of the terminal pathway of complement in humans (11). Therefore, S. intermedius seems to be primarily adapted to be a human pathogen.

Cell- and supernatant-associated glycosidases, protease activities, and acid production of AGS strains have been characterized and can be used to distinguish them (1, 3, 12). It is known that S. intermedius is the only AGS strain that can secrete sialidase (neuraminidase; NanA), which is encoded by nanA. The function of NanA of this strain has been analyzed using a nanA-deficient mutant, and the results raise the possibility that this enzyme is involved in biofilm degradation and modification of sugar chains on the bacterial cell surface and in the surrounding environment; these changes may influence both bacterium-bacterium and bacterium-host interactions (13). Among the AGS strains, S. intermedius and S. constellatus subsp. pharyngis exhibit cell-associated β-d-galactosidase (β-Gal), β-d-fucosidase (β-Fuc), N-acetyl-β-d-glucosaminidase (β-GlcNAcase), and N-acetyl-β-d-galactosaminidase (β-GalNAcase) activities (14), although the enzymes responsible for these glycosidase activities have not been identified yet. S. intermedius and some viridans streptococci can secrete 3 glycosidases (NanA, β-Gal, and β-GlcNAcase), which seem to have an important function in the removal of glycans from glycoproteins; thus, these bacteria might be able to obtain utilizable sugars from serum glycoproteins (15, 16).

Previously, we characterized catabolite control protein A (CcpA), which can regulate ily expression and growth rate, depending on the extracellular glucose or utilizable carbohydrate concentration (17). We also showed that the lactose phosphotransferase system repressor (LacR) regulates transcription of ily by binding to its promoter region (18). Therefore, the levels of ILY secreted into the culture supernatant were increased by addition of lactose or galactose to the medium as a carbon source. Disruption of lacR in S. intermedius causes constitutive overproduction of ILY, and consequently, an increase in cytotoxicity against the human hepatoma cell line HepG2 was observed. In addition, ILY-overproducing strains isolated from deep-seated abscesses, such as brain and liver abscesses, have a loss-of-function mutation in LacR. These results strongly suggest that the amount and type of sugar structures in the environment of the bacterial cell are important factors in the pathogenicity of S. intermedius.

Accordingly, we searched for genes that potentially encode a glycosidase in the S. intermedius chromosome and discovered a gene coding for a novel secreted multisubstrate glycosidase A (MsgA), which has β-Gal, β-Fuc, β-GlcNAcase, and β-GalNAcase activities.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

The bacterial strains used in this study are listed in Table 1. S. intermedius PC574 isolated from dental plaque (9) and the derivative strains were cultured at 37°C under anaerobic conditions. Brain heart infusion (BHI) broth (Becton, Dickinson and Company, Palo Alto, CA) and 3-(N-morpholino)propanesulfonic acid-buffered BHI (MOPS-BHI) broth were used as the culture media (17). Antibiotics were added at the following concentrations: chloramphenicol (Cm), 2 μg/ml; erythromycin (Erm), 1 μg/ml; and spectinomycin (Spc), 50 μg/ml.

TABLE 1.

Plasmids and S. intermedius strains used in this study

Plasmid or strain	Relevant characteristic(s)	Reference or source
Plasmids
pSETN1	Streptococcus-E. coli shuttle vector	17
placR	pSETN1 carrying lacR with its own promoter region	18
pmsgA	pSETN1 carrying msgA with lacR promoter region	This study
pUHE212-1	N-terminal 6×His tag vector	22
pN-his lacZD	pUHE212-1 carrying coding region for LacZ domain of msgA	This study
pN-his hexD	pUHE212-1 carrying coding region for GH2 domain of msgA	This study
Strains
NCDO2227	Type strain	9
PC574	ILY low-production strain from human dental plaque	9
PC574 ΔmsgA	msgA knockout mutant derived from strain PC574	This study
PC574/pSETN1	PC574 transformed with pSETN1	18
PC574 ΔmsgA/pSETN1	PC574 ΔmsgA transformed with pSETN1	This study
PC574 ΔmsgA/pmsgA	PC574 ΔmsgA transformed with pmsgA	This study
PC574 ΔlacR	lacR knockout mutant derived from strain PC574	18
PC574 ΔlacR/pSETN1	PC574 ΔlacR transformed with pSETN1	18
PC574 ΔlacR/placR	PC574 ΔlacR transformed with pSETN1 lacR	18
PC574 Δ lacR Δily	lacR ily knockout mutant derived from strain PC574	This study
NCDO2227 ΔnanA	nanA knockout mutant derived from strain NCDO2227	13
PC574 ΔnanA	nanA knockout mutant derived from strain PC574	This study

Databases and sequence alignment.

The nucleotide sequence of msgA (SCIM_1144) was obtained from the genome sequence of S. intermedius type strain NCDO2227 (GenBank accession no. AP010969). An msgA homolog and its pseudogenes from the S. anginosus group strains were found using NCBI Microbial Nucleotide BLAST (National Institutes of Health). Nucleotide sequence alignments between msgA from NCDO2227 and its homologs from the AGS strains were performed using ClustalW (Kyoto University Bioinformatics Center, Japan; available at http://www.genome.jp/tools/clustalw/). Homologs of MsgA from S. constellatus subsp. pharyngis C232, C818, C1050, and SK1060 were found using NCBI Microbial Protein BLAST. MsgA sequences were analyzed using SignalP 4.1 to predict signal peptide sequences (http://www.cbs.dtu.dk/services/SignalP/), and Pfam 27.0 (http://pfam.sanger.ac.uk), the Clusters of Orthologous Groups of proteins (COGs) database (http://www.ncbi.nlm.nih.gov/COG/), and Blocks Search (http://blocks.fhcrc.org/blocks/blocks_search.html) were used to predict the conserved domain architecture in MsgA. pI values of the mature forms of both MsgA and ILY were predicted using the Compute ProtParam tool (Swiss Institute of Bioinformatics, Switzerland; available at http://web.expasy.org/protparam/).

Generation of msgA and nanA knockout mutants from strain PC574.

The msgA and nanA knockout mutants (ΔmsgA and ΔnanA mutants) were produced using homologous recombination. In the case of the ΔmsgA mutant, the 5′ region of the msgA DNA fragment (1,185 bp) was amplified using primer ΔmsgA F and internal primer ΔmsgA EcoRI R (Table 2) and then was digested with EcoRI. The 3′ region of the latter (1,105-bp) DNA fragment was amplified using the internal primers ΔmsgA SalI F and ΔmsgA R (Table 2) and then digested with SalI. A spectinomycin resistance (Spc) cassette was amplified from the thermosensitive suicide vector pSET4s (19) by using primers spc EcoRI F and spc SalI R (Table 2). The EcoRI- and SalI-digested Spc cassette was ligated to the EcoRI-digested 5′ and SalI-digested 3′ regions, and the ligated fragment was then amplified by PCR with primers ΔmsgA F and ΔmsgA R (Table 2). The amplified fragment was used to construct the ΔmsgA mutant. To knock out nanA, which encodes NanA in PC574, the ΔnanA region was amplified by PCR with primers ΔnanA F and ΔnanA R from the NCDO2227 ΔnanA mutant (Table 1). The resulting 3.7-kbp fragments were recovered and further amplified with primers ΔnanA nested F and ΔnanA nested R (Table 2). The amplified fragment was used to construct the ΔnanA mutant. The ΔmsgA and ΔnanA mutants were produced via transformation of competence-stimulating peptide (CSP)-treated PC574 cells with each PCR amplicon according to the method described previously (17). Colonies were selected on BHI agar containing 50 μg/ml Spc. Disruption of msgA or nanA was confirmed using PCR and by disappearance of the enzymatic activity of MsgA or NanA (Table 3).

TABLE 2.

Oligodeoxynucleotides used in this study

Purpose	Name	Sequence (5′ to 3′)
Disruption of msgA	ΔmsgA F	GTTGCTTATGTTTTGAACTGTGAGAAAGAC
	ΔmsgA EcoRI R	CTCCGTTTTTTAACCCAGTTGAATTCACAG
	ΔmsgA SalI F	GTGCAAGATGGGTCGACACCTCCATCTACG
	ΔmsgA R	CAAGAAATAGTTCAGATGAATCATGAAACG
	spc EcoRI F	AAACAATGAATTCGTTTACACTTACTTTAG
	spc SalI R	TCTGTCGACCAATTAGAATGAATATTTCCC
Complementation of ΔmsgA mutant	In-Fusion msgA F	GTGTTACAACTGGTTAACAATTCAATGAAAGG
	In-Fusion msgA R	TTATTTTTTCTTTCGATTTTTCTTGACAAAAAATC
	In-Fusion placR F	CGAAAGAAAAAATAATTAATATTTTAATCACCTGTTCGTGAAGCTGC
	In-Fusion placR R	AACCAGTTGTAACACTTTGTCTCCTTTCTAATCATATAATTAGATTCC
Cloning of coding region for LacZ domain or hexosaminidase domain into 6×His tag vector	LacZ domain F	CGTTGGATCCATGTTTTTATATAGTGTATTTTCAG
	LacZ domain R	GCTGTCCTAGGTTATTTCATAGCAGCTACATCTCC
	Hex. domain F	GAAATTGGATCCATGACAGCGATTGAAACTTTTG
	Hex. domain R	CGTAGCTGCAGGTGTGGATCAATCTTGCAC
Disruption of ily	Δily F	CGCCGCCTGACTAACCTTTAAGCGCCTTGC
	Δily EcoRI R	GCTGAATTCGGTGCTGCCGAAGAGAGAACG
	Δily SalI F	CTTCGTCGACAGTTTGAAGATAAAGTTGTG
	Δily R	GAACAGAAGAAGCTTCTGCCTTCTTGGCTG
Disruption of nanA	ΔnanA F	CAATCCCTATATAACTTTAAGTGTTTGTTG
	ΔnanA R	GATATCATGTAGAGAAACAGAAAAAACTAC
	ΔnanA nested F	TGAGAGAGGAGGGATTTTCTTACTGATCGG
	ΔnanA nested R	CTAGAAGATACACTTCTGGGATAAATAGGG
Probes for qRT-PCR	qRT-msgA F	CTACACCCAAAGTGGTGAAGCAGAGAGTGG
	qRT-msgA R	CGATAAATACCACTACCAGAATACCAGCGC

TABLE 3.

Relative glycosidase activities of PC574 and its mutants

Enzyme	Relative activity, mean (SD)a
	PC574 ΔmsgA	PC574 ΔmsgA/pmsgAb	PC574 ΔlacR	PC574 ΔnanA
β-d-Galactosidase	<0.01	1.8 (0.20)	4.6 (0.23)	1.1 (0.06)
β-d-Fucosidase	<0.01	2.0 (0.04)	5.5 (0.23)	1.3 (0.01)
N-Acetyl-β-d-glucosaminidase	<0.01	2.2 (0.15)	6.3 (0.45)	1.2 (0.01)
N-Acetyl-β-d-galactosaminidase	<0.01	2.2 (0.21)	5.0 (0.27)	1.1 (0.06)
Sialidase	1.1 (0.06)	NDc	0.5 (0.09)	<0.01
α-d-Glucosidase	0.9 (0.03)	ND	2.1 (0.07)	1.0 (0.02)

^aGlycosidase activity from a 10-μl cell suspension (OD₆₀₀, 1.0) of wild-type cells (PC574 or PC574/pSETN1) set as 1.

^bPC574/pSETN1.

^cND, not determined.

Complementation of the S. intermedius PC574 ΔmsgA strain.

To construct the MsgA-producing plasmid, a Streptococcus-E. coli shuttle vector pSETN1-derived plasmid (placR), in which was cloned a lacR fragment containing the putative native promoter, was used (18). The msgA fragments were amplified by PCR using the primers In-Fusion msgA F and In-Fusion msgA R from the chromosomal DNA of S. intermedius type strain NCDO2227. The placR plasmid was linearized by inverse PCR using primers In-Fusion placR F and In-Fusion placR R (Table 2). The linearized plasmid contained pSETN1, the putative native promoter of lacR, and 15-bp extensions (5′) complementary to the ends of msgA. The msgA fragments were cloned within the linearized plasmid using the In-Fusion HD cloning kit (TaKaRa Bio, Inc., Tokyo, Japan) as described in the user's manual. The In-Fusion reaction was carried out for 15 min at 50°C, and then the mixture was placed on ice. Escherichia coli DH5αZ1 (20) was transformed by the resultant plasmid (pmsgA). Subsequently, pmsgA was extracted and used for transformation of a CSP-treated PC574 ΔlacR mutant. Transformants were selected and isolated on a BHI agar plate containing 2 μg/ml Cm and 50 μg/ml Spc.

Preparation of an ily knockout in the PC574 ΔlacR mutant.

The 5′ region of the ily DNA fragment (839 bp) was amplified using primer Δily F and internal primer Δily EcoRI R (Table 2) and was then digested with EcoRI. The 3′ region of the latter (929-bp) DNA fragment was amplified using internal primers Δily SalI F and Δily R (Table 2) and then digested with SalI. The EcoRI- and SalI-digested Spc cassette was ligated to the EcoRI-digested 5′ region and SalI-digested 3′ region of ily, and the ligated fragment was then amplified with primers Δily F and Δily R (Table 2). The amplified fragment was used to generate the Δily mutant. The Δily mutant was created by transforming CSP-treated PC574 ΔlacR cells (Table 1) with the PCR amplicon, according to the method described previously (17). Colonies were selected on BHI agar containing 50 μg/ml Spc and 1 μg/ml Erm. Disruption of ily was confirmed using PCR and by checking for the absence of hemolytic activity of PC574 ΔlacR (18).

Preparation of glycosidase substrates.

The cell- and supernatant-associated glycosidase activities of S. intermedius, the culture supernatant, and the purified MsgA were measured using the fluorogenic (4-methylumbelliferyl [4-MU]-linked) substrates 4-MU-β-d-galactopyranoside, 4-MU-β-d-fucoside, 4-MU-N-acetyl-β-d-glucosaminide, 4-MU-N-acetyl-β-d-galactosaminide, 2′-(4-MU)-α-d-N-acetylneuraminic acid sodium salt hydrate, 4-MU-α-d-glucopyranoside, and 4-MU-β-d-mannopyranoside. All substrates were obtained from Sigma-Aldrich Corporation (St. Louis, MO) and solubilized in dimethyl sulfoxide.

Purification of MsgA.

The PC574 ΔlacR Δily double mutant was cultured in 1.0 liter of the BHI medium. The culture supernatant and the cells were separated by centrifugation (5,000 × g). Proteins in the culture supernatant were precipitated by addition of ammonium sulfate to 80% saturation and subsequent centrifugation (10,000 × g). The precipitated proteins were dissolved in 40 ml of 50 mM sodium acetate buffer (pH 5.5) containing 100 mM NaCl and 0.01% NP-40 and then dialyzed against the same buffer. The harvested cells were resuspended in 5 ml of 50 mM sodium acetate buffer (pH 5.5) containing 1.0 M NaCl and 0.01% NP-40 to extract cell-associated MsgA, and then the cells were removed by centrifugation (5,000 × g). An aliquot of the extracted MsgA was diluted 10-fold with 50 mM sodium acetate buffer (pH 5.5) containing 0.01% NP-40. The resultant dialyzed solution (from the culture supernatant) or MsgA extracted from the cells was loaded onto a HiTrap SP HP column (GE Healthcare, Buckinghamshire, United Kingdom). Proteins bound to the column were eluted with a linear gradient of 0 to 1.0 M NaCl in sodium acetate buffer (pH 5.5) containing 0.01% NP-40. Peak fractions of MsgA were identified and combined to measure β-Gal activity by using 4-MU-β-d-galactopyranoside as a substrate. The fraction was further purified using a Superdex 200 (GE Healthcare) gel filtration column preequilibrated with 50 mM sodium acetate buffer (pH 5.5) containing 1.0 M NaCl and 0.01% NP-40. Purified MsgA was stored at −80°C until use.

Protein quantification of MsgA.

The concentration of MsgA was determined using a protein molecular mass marker, XL-Ladder High (APRO Life Science Institute, Inc., Tokushima, Japan). MsgA and the diluted XL-Ladder High marker (2-fold serial dilutions) were analyzed using an 8% SDS-PAGE gel (21) and stained with Oriole fluorescent gel stain (Bio-Rad Co., CA). The stained proteins were detected and digitized using the ImageQuant LAS 4000 mini system (GE Healthcare). The amount of MsgA was calculated using a standard curve with the 250-kDa protein (150, 75, 32.5, and 16.3 ng/gel) in XL-Ladder High by using Multi Gauge version 3.0 software (GE Healthcare).

Preparation of His-tagged recombinant LacZ and GH20 domains of MsgA.

The coding regions of the LacZ domain (lacZD) and GH20 domain (hexD) in msgA were amplified from the chromosomal DNA of S. intermedius type strain NCDO2227. This was done using the primers LacZ domain F and LacZ domain R or Hex. domain F and Hex. domain R (Table 2). The amplified lacZD fragment was digested with BamHI and AvrII, and the amplified hexD fragment was digested with BamHI and PstI and cloned into pUHE212-1 (22). E. coli DH5αZ1 was transformed by each resultant plasmid (pN-his lacZD or pN-his hexD).

Hyperexpression of the His-tagged LacZ domain (LacZD) or His-tagged HexD domain (HexD) was induced by adding 1 mM isopropyl-β-d-thiogalactopyranoside to E. coli cells in the mid-exponential phase and then continuing incubation at 37°C for 2 h. The cells were then harvested by centrifugation (5,000 × g) and resuspended in 20 mM Tris-HCl buffer (pH 8.0) containing 1 mM EDTA, 20% sucrose, and 1 mg/ml lysozyme. The suspension was sonicated with an Astrason ultrasonic processor (model XL2020; Misonix, Inc., Farmingdale, NY) and diluted 5-fold with 20 mM Tris-HCl buffer (pH 8.0) containing 10 mM MgCl₂. The resultant cell extract was centrifuged at 10,000 × g for 20 min to remove the debris and unbroken cells. The supernatant was loaded onto a nickel affinity column (HisTrap FF, 5 ml; GE Healthcare) equilibrated with buffer A (20 mM Tris-HCl [pH 8.0], 300 mM NaCl, 20 mM imidazole). Each His-tagged protein was eluted with a linear gradient of 20 to 500 mM imidazole in buffer A. Peak fractions of LacZD were diluted 10-fold with buffer B (50 mM sodium acetate buffer [pH 6.0], 0.01% NP-40), and peak fractions of HexD were diluted 10-fold with buffer C (50 mM sodium acetate buffer [pH 5.5], 0.01% NP-40). Each diluted sample was loaded onto a HiTrap SP HP column (GE Healthcare). LacZD was eluted with a linear gradient of 0 to 1.0 M NaCl in buffer B, and HexD was eluted with a linear gradient of 0 to 1.0 M NaCl in buffer C. Purified proteins were stored at −80°C until use.

Detection of glycosidase activity in cell suspensions and culture supernatants.

S. intermedius PC574 and its derivative strains were cultured in MOPS-BHI medium at 37°C for 24 h. Cells were separated from the culture supernatants by centrifugation (5,000 × g). Each cell suspension (optical density at 600 nm [OD₆₀₀], 1.0) was prepared in ice-cold 20 mM Tris-HCl buffer (pH 7.5). Assays employing fluorogenic substrates were performed as described previously with minor modifications (23). An assay mixture (100 μl) containing 70 mM citrate buffer (pH 5.5), 250 μM 4-MU-linked substrate, and 10 μl of each cell suspension or culture supernatant was incubated at 37°C. Each aliquot (10 μl) of the reaction mixture was taken at suitable time points and mixed with 190 μl of 0.5 M sodium carbonate buffer (pH 10.2) to terminate the enzymatic reaction. All assays were set up in triplicate, and the release of 4-MU was quantified on an Infinite M200 microplate reader (Tecan Group, Ltd., Männedorf, Switzerland); the excitation and emission wavelengths used were 380 nm and 460 nm, respectively.

Specific glycosidase activity.

The glycosidase activities of the purified LacZ and GH20 domains of MsgA and intact MsgA were expressed as U/nM protein. Units are defined as the production of 100 nM 4-MU/min from 250 μM 4-MU-linked substrate in 70 mM citrate buffer (pH 5.5) at 37°C.

Identification of kinetic parameters and the optimum reaction temperature of MsgA.

The kinetic parameters Michaelis constant (K_m) and V_max for β-Gal, β-Fuc, β-GlcNAcase, and β-GalNAcase activities were determined as described previously with minor modifications (23). An assay mixture (100 μl) contained 70 mM citrate buffer (pH 5.5), 1 nM MsgA, and variable concentrations of a 4-MU-linked substrate. The concentration of substrates varied from 20 to 1,000 μM in the case of β-Gal, from 20 to 500 μM in the case of β-GalNAcase, from 10 to 250 μM in the case of β-GlcNAcase, and from 100 to 2,500 μM in the case of β-Fuc; all reaction mixtures were incubated at 37°C and set up in duplicate. A 10-μl aliquot of each reaction mixture was removed at suitable time points and mixed with 190 μl of 0.5 M sodium carbonate buffer (pH 10.2) to terminate the enzymatic reaction. Concentrations of released 4-MU were calculated by comparing fluorescence values with those obtained from standard concentrations of 4-MU. Optimum temperatures of MsgA enzymatic activities were determined using 250 μM 4-MU-linked substrates and 1 nM MsgA to assess the amount of released 4-MU at several temperatures.

Detection of glycans on α₁-antitrypsin by PAS staining.

PC574 and the ΔmsgA and ΔnanA mutants were cultured until the stationary phase in the BHI medium for 24 h. Culture supernatants were separated by centrifugation. A solution of 10 mg/ml α₁-antitrypsin (α₁AT) from human plasma (Sigma-Aldrich Corporation) was diluted 10-fold with culture supernatant in the presence or absence of 2 nM purified MsgA and incubated for 0, 24, and 48 h. After incubation, 1 μg of α₁AT was analyzed on a 12% SDS-PAGE gel. For periodic acid-Schiff (PAS) staining, the gel-resolved proteins were transferred onto a polyvinylidene difluoride (PVDF) membrane (Millipore, Bedford, MA). PAS staining was performed as described previously with minor modifications (24). Briefly, the blotted PVDF membrane was rinsed in deionized water and then incubated with 1.0% periodic acid in 3% acetic acid for 30 min. The periodic acid solution was removed, and the membrane was rinsed in deionized water twice. Schiff's reagent (Merck KGaA, Darmstadt, Germany) was added, and the mixture was incubated for 15 min. Reddish-pink bands of stained glycoproteins would then be visible. Schiff's reagent and background staining were removed by washing several times with a destaining solution (0.1% sodium bisulfite in 10 mM HCl). The destained membrane was rinsed in deionized water and then dried.

qRT-PCR analysis.

PC574, the PC574 ΔlacR mutant containing control vector pSETN1, and the PC574 ΔlacR mutant complemented with the LacR-producing plasmid placR (Table 1) were cultured in MOPS-BHI medium at 37°C for 24 h under anaerobic conditions, and the cells were subsequently separated by centrifugation (5,000 × g). Isolation of total RNA from the cells and quantitative RT-PCR (qRT-PCR) analysis were performed as described previously (17). The primer set qRT-msgA F and qRT-msgA R (Table 2) was used for quantification of msgA mRNA.

RESULTS

Bioinformatic analysis of msgA.

Among the AGS strains, S. intermedius and S. constellatus subsp. pharyngis can exhibit β-d-galactosidase (β-Gal), β-d-fucosidase (β-Fuc), N-acetyl-β-d-glucosaminidase (β-GlcNAcase), and N-acetyl-β-d-galactosaminidase (β-GalNAcase) activities. The genes encoding these glycosidases have not been identified yet. Therefore, we searched for the glycosidase gene(s) in the S. intermedius chromosome and found an open reading frame (ORF) in the lac operon that seemed to encode a large glycosidase (MsgA) with 2,235 amino acids (Fig. 1A and B). A homology search and prediction of conserved domains of MsgA demonstrated that this protein was homologous to the glycosidases that contain a glycoside hydrolase family 2 (GH2) and a glycoside hydrolase family 20 (GH20) catalytic domains, as shown in Fig. 1B (25). It is known that glycosidases such as β-Gal and β-d-mannosidase belong to GH2, which includes Escherichia coli β-Gal (LacZ). Glycosidases that have the GH20 catalytic domain and can remove β1,4-linked N-acetyl-d-hexosamine residues from nonreducing ends of N-acetyl-d-glucosamine or N-acetyl-d-galactosamine residues of oligosaccharides have been previously reported (26, 27). In addition, MsgA showed homology to the Big4 domain, which is a bacterial Ig-like domain found in bacterial surface proteins, including β-Gal (BgaA) from Streptococcus pneumoniae (28). The F5/8-type C domain, also known as carbohydrate-binding module family 32 (the CAZy database; http://www.cazy.org), has generally been considered a galactose-binding domain (29).

FIG 1.

Schematic of the lac operon of S. intermedius and the results of structural analysis of MsgA. (A) Schematic representation of the lac operon. The msgA gene is located just downstream from lacC. Phosphoenolpyruvate phosphotransferase system genes (PTSs) encoded homologs of fructose- or galactitol-specific phosphotransferase systems. The numbers refer to the length (kbp) of genes. (B) Location of the candidates of functional domain in MsgA. The first putative methionine starting position within msgA was taken from the published NCDO2227 chromosome sequence (GenBank accession no. AP010969). The numbering refers to the locations of amino acid residues in the MsgA. The locations of the signal peptide and conserved domains are indicated as follows: SIG, signal peptide predicted using the SignalP 4.1 server; LacZ (COG3250), β-d-galactosidase domain; Big4 (Pfam07532), bacterial Ig-like domain (group 4); F5/8 (Pfam00754), F5/8-type C domain; and GH20 (Pfam00728), N-acetyl-β-d-hexosaminidases of glycoside hydrolase family 20. Black lines indicate truncated MsgAs, which contain either the LacZ domain (LacZD) or the GH20 domain (HexD).

Characterization of the ΔmsgA mutant.

In order to confirm that the msgA mutation affects cell- and supernatant-associated glycosidase activities, an msgA knockout mutation was introduced into the PC574 genome. This was achieved through the insertion of an Spc cassette and the removal of the entire LacZ (GH2) and GH20 domains (amino acid positions 80 to 2173 of MsgA). PC574 and its msgA knockout (ΔmsgA) mutant had a similar colony shape and growth rate under our culture conditions in BHI and MOPS-BHI media (data not shown). In the ΔmsgA mutant, the four relevant cell- and supernatant-associated glycosidase activities were significantly reduced (Table 3 [the supernatant-associated activities are not shown]). However, cell-associated sialidase (NanA) and α-d-glucosidase activities were not affected (Table 3). To exclude the possibility that the mutant phenotypes resulted from other mutations in the chromosome, the ΔmsgA mutation was complemented in trans with a recombinant plasmid (pmsgA) carrying the msgA and lacR promoter region of S. intermedius. The levels of the four glycosidase activities that were lost in the ΔmsgA mutation were restored and increased by approximately 2-fold by pmsgA complementation compared to those in the wild-type strain (Table 3). In addition, transformation of the Streptococcus-E. coli shuttle vector pSETN1 did not affect the glycosidase activities of PC574 and the ΔmsgA mutant cells (data not shown). These results strongly indicate that MsgA is a multisubstrate glycosidase that has β-Gal, β-Fuc, β-GlcNAcase, and β-GalNAcase activities.

Because msgA localizes in the lac operon (Fig. 1A), its transcriptional activity is likely to be under the control of LacR, and expression of this gene might be enhanced by a ΔlacR mutation. Our results supported the supposition that four cell-associated glycosidase activities of the ΔlacR mutant were increased by approximately 5- to 6-fold (Table 3). A slightly weaker cell-associated NanA activity and a stronger α-d-glucosidase activity (compared to those of the parental strain) were observed in the ΔlacR mutant. Therefore, LacR appears to control the expression of these glycosidases, and consequently, the ΔlacR mutation may affect their expression and activity.

Thereafter, we examined the amount of mRNA from msgA in PC574, the ΔlacR mutant and the complemented strain of the ΔlacR mutant by measuring the relative amounts of msgA mRNA (msgA/gyrB) in these strains (Fig. 2). The expression level of msgA in the ΔlacR cells was 40.4-fold higher than that in PC574, and expression reverted to a normal level as in PC574 after placR complementation. In addition, the levels of the four glycosidase activities that were elevated by the ΔlacR mutation decreased to the level of the wild-type strain after placR complementation (data not shown). These results indicate that LacR controls msgA expression in the lac operon.

FIG 2.

msgA transcriptional activity in the ΔlacR mutant. A wild-type strain, its ΔlacR mutant, and its lacR complementation strain were grown for 24 h at 37°C in MOPS-BHI medium. The expression levels of msgA in PC574 carrying pSETN1 (WT), the ΔlacR mutant carrying pSETN1 (ΔlacR), and the ΔlacR mutant carrying placR (Comp.) are indicated relative to the gyrB expression level. The results are plotted on a logarithmic scale in the vertical axis. The data are shown as means and standard deviations (SD) from 6 replicates.

Purification of MsgA.

Because a stronger glycosidase activity possibly related to MsgA was observed in the ΔlacR mutant, MsgA was purified from this mutant. Most β-GlcNAcase activity of MsgA was cell associated, but approximately 20% of total β-GlcNAcase activity was observed in the culture supernatant. In addition, approximately 2.4% of the cell-associated β-GlcNAcase activity could be extracted by treatment with a high-ionic-strength buffer containing 0.01% NP-40. Therefore, we purified MsgA from both the culture supernatant and cells. The ΔlacR mutant could produce a larger amount of ILY (18), and the predicted pI values of MsgA and ILY were similar: 9.17 and 9.48, respectively. Indeed, MsgA and ILY were copurified using cation-exchange chromatography (data not shown); accordingly, the ΔlacR Δily double mutant was used for purification. MsgA was purified using cation-exchange chromatography followed by Superdex 200 gel filtration chromatography. The results showed that MsgA was eluted in the large-molecular-mass fractions with a calculated molecular mass of approximately 300 kDa, and its four glycosidase activities were also eluted in these fractions (data not shown). The purity and molecular mass of MsgA were verified by SDS-PAGE (Fig. 3). We succeeded in obtaining highly purified MsgA, and no contaminating proteins were detected despite the use of a sensitive fluorescent staining technique. The molecular mass of the purified protein was approximately 232 kDa, and this mass was lower than the estimated molecular mass (243 kDa) of the mature form. The N- and/or C-terminal region of MsgA might have been truncated by a processing enzyme.

FIG 3.

Analysis of purified MsgA by SDS-PAGE. An aliquot (70 ng) of the MsgA preparation after the Superdex 200 gel filtration was analyzed by electrophoresis in an 8% SDS–slab gel. The gel was stained with Oriole fluorescent gel stain. M, protein molecular mass markers.

Glycosidase activity of LacZ and GH20 domains of MsgA.

MsgA has two predicted catalytic domains (LacZ and GH20) responsible for its glycosidase activity (Fig. 1B), and these domains appear to exhibit different activities. Therefore, we purified the truncated MsgA, which contained either the LacZ domain (LacZD) or the GH20 domain (HexD) indicated in Fig. 1B and determined the specific glycosidase activities of each domain (Table 4). Purified LacZD exhibited weaker activity than MsgA, with as little as 10% β-Gal and 36% β-Fuc activities. The domain downstream of our truncated region (e.g., Big4) might require the correct folding and/or stabilization of LacZD. In addition, slight but significant β-GlcNAcase and β-GalNAcase activities were also observed, although these were less than 0.1% the activity of MsgA. HexD exhibited both β-GlcNAcase and β-GalNAcase activities and had comparable enzymatic activity to MsgA. In contrast to LacZD, this domain did not exhibit any β-Gal and β-Fuc activities. These results strengthen our hypothesis that β-Gal, β-Fuc, β-GlcNAcase, and β-GalNAcase activities are derived from MsgA.

TABLE 4.

Specific glycosidase activities of MsgA and truncated MsgA

Enzyme	Sp act, mean (SD) U/nMa
	MsgA	LacZD	HexD
β-d-Galactosidase	28.3 (2.79)	2.9 (0.05)	<0.01
β-d-Fucosidase	2.2 (0.31)	0.8 (0.11)	<0.01
N-Acetyl-β-d-glucosaminidase	44.2 (6.32)	0.4 (0.06)	47.3 (3.40)
N-Acetyl-β-d-galactosaminidase	11.4 (1.63)	0.1 (0.02)	13.4 (1.43)

^aSpecific glycosidase activities of purified proteins are expressed as U/nM protein (see Materials and Methods).

Enzymatic parameter of purified MsgA.

The optimal pH for each glycosidase activities in crude cell extracts from S. intermedius were previously reported to be 5.5 to 6.0 for β-Gal and 5.0 to 5.5 for both β-GlcNAcase, and β-GalNAcase, respectively (23). Accordingly, the enzymatic parameters of these glycosidases have been analyzed and reported at pH 5.5. We also investigated the optimal pH for MsgA glycosidase activities using purified enzyme and confirmed that those for β-Gal and for β-GlcNAcase were around 6.0 and 5.0, respectively (data not shown). Consequently, the kinetic parameters and the optimal reaction temperatures of purified MsgA were measured using a 0.1 nM enzyme solution at pH 5.5. The initial rate of reaction of MsgA with the fluorogenic substrates was measured at various temperatures and concentrations of the substrates. K_m and V_max with the 4 substrates were determined using Lineweaver-Burk plots, and k_cat was calculated (Table 5). K_m values of β-Gal, β-GlcNAcase, and β-GalNAcase showed a similar tendency, which was previously reported for a cell suspension (23). MsgA showed the lowest K_m with 4-MU-N-acetyl-β-d-glucosaminide and the highest k_cat with 4-MU-β-d-galactopyranoside. Because this enzyme showed the highest K_m value with 4-MU-β-d-fucoside and the lowest k_cat with 4-MU-N-acetyl-β-d-galactosaminide compared to the other enzymatic activities, these two activities do not seem to be the main function of MsgA. Therefore, the primary function of MsgA in vivo seems to be the removal of N-acetyl-d-glucosamine and galactose residues from oligosaccharide chains, such as N- and O-linked glycans.

TABLE 5.

Kinetic parameters of purified MsgA with fluorogenic substrates^a

Substrate	Km (mM)	kcat (s−1)	kcat/Km (s−1 mM−1)
4-MU-β-d-galactopyranoside	0.548	244.7	446.5
4-MU-β-d-fucoside	2.613	64.2	24.6
4-MU-N-acetyl-β-d-glucosaminide	0.024	134.2	5591.7
4-MU-N-acetyl-β-d-galactosaminide	0.144	46.3	321.5

^aAssays were performed in 70 mM citrate buffer (pH 5.5) at 37°C with 1 nM MsgA.

The effect of temperature on enzymatic activities of MsgA was also assessed (Fig. 4). β-Gal and β-Fuc activities are thermolabile: the optimal temperature was 40°C, and both enzymatic activities almost disappeared at 49°C (Fig. 4A). In contrast, β-GlcNAcase and β-GalNAcase activities are thermostable: the optimum temperatures were 58 and 55°C, respectively (Fig. 4B). Their enzymatic activities declined gradually with increase of reaction temperature: >80% of the original activity was preserved until 67°C, but the enzymatic activities dropped sharply above 70°C and almost disappeared at 76°C.

FIG 4.

Optimal temperature for enzymatic activities of MsgA. 4-MU-linked fluorogenic substrates (250 mM) and MsgA (1 nM) were incubated at the indicated temperatures. Enzymatic activity is shown as a percentage of the maximum for each fluorogenic substrate. (A) β-Gal (open circles) and β-Fuc (closed circles) activities. (B) β-GlcNAcase (open squares) and β-GalNAcase (closed squares) activities. The data are shown as means and SD from 3 replicates.

Degradation of sugar chains on human α₁AT.

It has been shown that glycosidase activities of S. intermedius, such as those of NanA, β-Gal, and β-GlcNAcase, are necessary for procurement and utilization of the monosaccharides sialic acid, N-acetyl-d-glucosamine, and galactose, respectively, which are constituents of carbohydrate side chains of glycoproteins (15). Our data indicated that MsgA participates in degradation of glycans. Therefore, we analyzed the degradation of glycans by MsgA using human α₁AT, a protein abundantly present in plasma and containing biantennary complex-type N-glycans (30). Because a significant amount of MsgA (ca. 20% of total activity) and NanA activity (ca. 41% of total activity) from wild-type cells existed in the culture supernatant under our experimental conditions, α₁AT was incubated with the culture supernatant of the wild type and ΔmsgA and ΔnanA mutants at 37°C (Fig. 5). The molecular mass of α₁AT was gradually reduced when the protein was incubated with the culture supernatant from the wild-type strain, and an approximately 5.9-kDa and 8.2-kDa reductions were observed after 24 h and 48 h of incubation, respectively (Fig. 5A). Because the smaller size of α₁AT corresponded to the bands with significant reduction in the signal intensity of PAS staining, the glycosidases produced by S. intermedius seem to remove N-glycosylated sugar chains (Fig. 5B). Only a marginal reduction in molecular mass (ca. 1.8 kDa) of α₁AT was observed after incubation with the ΔmsgA culture supernatant. The reduction of molecular mass of α₁AT was not observed after incubation with the ΔnanA culture supernatant.

FIG 5.

Comparison of molecular masses and amounts of α₁AT glycans after incubation with culture supernatant from the ΔmsgA and ΔnanA mutants and their parental strains. α₁AT (1 mg/ml) was incubated with each culture supernatant (A) or culture supernatant containing 2 nM purified MsgA (B) for the indicated time periods. WT, culture supernatant from wild-type strain PC574; ΔmsgA, supernatant from PC574 ΔmsgA; ΔnanA, supernatant from PC574 ΔnanA; ΔmsgA+MsgA, supernatant from PC574 ΔmsgA in the presence MsgA; ΔnanA+MsgA, supernatant from PC574 ΔnanA in the presence of MsgA.

We also analyzed whether purified MsgA could remove N-glycosylated sugar chains of α₁AT. The results shown in Fig. 5A suggest that NanA activity is necessary for the degradation of these sugar chains. Therefore, purified MsgA was supplemented in the culture supernatant from ΔmsgA mutants, which contained intrinsic NanA activity (Fig. 5B). MsgA-supplemented culture supernatant could reduce the molecular mass of α₁AT and the signal intensity of PAS staining to the wild-type level. In addition, MsgA-supplemented culture supernatant from the ΔnanA mutant did not exhibit any molecular mass reduction or signal intensity of PAS staining. These results strongly suggest that MsgA has exoglycosidase activities and that the NanA activity to remove sialic acid residues is required to initiate the degradation of glycans.

DISCUSSION

It has been reported that among the AGS species, only S. intermedius and S. constellatus subsp. pharyngis exhibit the cell-associated β-Gal, β-Fuc, β-GlcNAcase, and β-GalNAcase activities (14). Our data suggest that these four glycosidase activities in S. constellatus subsp. pharyngis are also due to a single enzyme: MsgA. Indeed, S. constellatus subsp. pharyngis strains (C232, C818, C1050, and SK1060) have an MsgA homolog (around 99% similarity) in their chromosome. A homology search using the msgA nucleotide sequence showed that AGS strains other than S. intermedius and S. constellatus subsp. pharyngis also have conserved highly homologous pseudogenes of msgA (∼99% similarity), although the search did not yield any bacterial strains outside AGS. These pseudogenes are located in the lac operon, just like in S. intermedius and S. constellatus subsp. pharyngis, and have been inactivated by frameshift mutations (data not shown). S. intermedius is the only species with NanA activity among AGS (3), and the nucleotide homology search also indicated that nanA was present only in S. intermedius among AGS (data not shown). Judging from the lack of removal activity of sialic acid residues from glycans by NanA in AGS species other than S. intermedius, perhaps the ancestors of these species had not been able to obtain monosaccharides from N- and O-linked glycoproteins by using MsgA. Therefore, MsgA had possibly been less useful for ancestors of AGS, except for S. intermedius; this might be the reason why the loss-of-function mutation of msgA happened in AGS. Paddick et al. showed that the microbiota that includes S. intermedius, which produces NanA, β-Gal, and β-GlcNAcase, could survive under dental restoration conditions by extracting sugars from serum glycoproteins coming from the pulp through a patient's dental tubules to the infected dentine (16). This finding also supports our idea that MsgA and NanA have a crucial function for existence in the normal habitat of S. intermedius, such as the human oral cavity.

MsgA showed weak β-Fuc activity (Table 4, 5). Nevertheless, it does not belong to GH1 or GH30, which have β-Fuc activity (the CAZy database). It has been reported that E. coli LacZ, which has a GH2 domain, recognizes and catalyzes a reaction with β-d-fucosyl moieties weakly (31, 32). We showed that truncated MsgA containing only LacZD demonstrated β-Fuc activity (Table 4). This indicates that the GH2 catalytic domain of MsgA has weak β-Fuc activity. In addition, the optimum temperature of both β-Gal and β-Fuc activities was 40°C (Fig. 4). This was different from the optimum temperatures of the other two glycosidase activities, which were approximately 55°C. These data also support our proposal that the β-Fuc activity is derived from the GH2 catalytic domain of MsgA. LacZD showed a slight but significant N-acetyl-β-d-hexosaminidase activity (Table 4). Since some GH2 glycosidases are known to have an exo-N-acetyl-β-d-hexosaminidase activity (the CAZy database), this domain may weakly recognize β1,4-linked N-acetyl-d-hexosamine residues. Although the β-Gal activity of MsgA showed the highest k_cat among the four glycosidase activities of MsgA, it also showed a lower K_m value with 4-MU-β-d-galactopyranoside (Table 5). Therefore, the degree of substrate recognition specificity by the GH2 catalytic domain of MsgA seems to be low, and this may be the reason for the weak β-Fuc and N-acetyl-β-d-hexosaminidase activities observed. It has been reported that S. intermedius shows a weak β-d-mannosidase activity, which is likely to degrade 4-MU-β-d-mannopyranoside (33). Some GH2 glycosidases are known to have a β-d-mannosidase activity (the CAZy database). Therefore, we evaluated the degradation of this fluorescent substrate by MsgA, but the result was negative (data not shown).

MsgA contains a predicted signal peptide-like sequence in its N-terminal region (Fig. 1B). In accordance with this, approximately 20% of the total activity was observed in the culture supernatant, while nearly 80% of MsgA activity is cell associated. A Blocks Database search showed that the C-terminal region of MsgA has a Gram-positive coccus surface protein anchor signature (IPB001899B), but the cell-wall-sorting motif LPXTG for sortases (IPB001899A) that precedes the surface protein anchor signature was not present (34, 35). Further studies of the MsgA C-terminal region using point or deletion mutants will be helpful to elucidate the localization of MsgA.

It has been reported that the genes involved in basic metabolic processes, such as catabolism of complex carbohydrates, are crucial to the pathogenicity of many streptococci (36–39). Therefore, transcriptional control factors, such as CcpA and LacR, are believed to have an important role in regulation of the pathogenicity of streptococci. Because expression of ily of S. intermedius is also controlled by CcpA and LacR, the concentration and type of utilizable sugar around the cells could regulate ily expression, which seems to have an important function in the pathogenicity. The msgA gene is located in the lac operon and regulated by LacR (Fig. 1A and 2; Table 3). It has been shown that the glycosidase activities associated with MsgA are downregulated in a glucose-rich medium but increased if mucin that has O-linked glycans is added to the culture medium as a carbon source (23). Because many N- and O-linked glycans contain β-d-galactosyl moieties, MsgA may cleave off the galactose and cooperate with NanA (Fig. 5). The resulting galactose might inactivate LacR, and this change should upregulate production of MsgA and ILY. Therefore, it is considered that MsgA and NanA not only play a role in the procurement of utilizable carbohydrates in the normal habitat and presumably in colonized deep-seated organs, such as liver and brain, but also control pathogenicity of S. intermedius by regulating ily expression. The functions of the surface-associated exoglycosidases NanA, β-Gal (BgaA), and β-GlcNAcase (StrH) have been characterized in S. pneumoniae (28, 40–44). It is believed that the functions of these glycosidases include participation in pneumococcal colonization and pathogenesis by deglycosylating human glycoconjugates in order to unmask receptors for adherence and to avoid opsonophagocytic killing by human neutrophils (41, 43), as well as detachment of sugars from oligosaccharides to obtain nutrients. Therefore, because MsgA of S. intermedius possessing these glycosidase activities might also play a similar role in pathogenesis, further research on its involvement in infectivity, cytotoxicity toward cultured human cells, and evasion of phagocytic killing seems to be worthwhile.