Skip to main content
NCBI home page
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2014 Aug;80(16):5078–5085. doi: 10.1128/AEM.00659-14

Novel Three-Component Rieske Non-Heme Iron Oxygenase System Catalyzing the N-Dealkylation of Chloroacetanilide Herbicides in Sphingomonads DC-6 and DC-2

Qing Chen 1, Cheng-Hong Wang 1, Shi-Kai Deng 1, Ya-Dong Wu 1, Yi Li 1, Li Yao 1, Jian-Dong Jiang 1, Xin Yan 1, Jian He 1,✉, Shun-Peng Li 1
Editor: M J Pettinari
PMCID: PMC4135782  PMID: 24928877

Abstract

Sphingomonads DC-6 and DC-2 degrade the chloroacetanilide herbicides alachlor, acetochlor, and butachlor via N-dealkylation. In this study, we report a three-component Rieske non-heme iron oxygenase (RHO) system catalyzing the N-dealkylation of these herbicides. The oxygenase component gene cndA is located in a transposable element that is highly conserved in the two strains. CndA shares 24 to 42% amino acid sequence identities with the oxygenase components of some RHOs that catalyze N- or O-demethylation. Two putative [2Fe-2S] ferredoxin genes and one glutathione reductase (GR)-type reductase gene were retrieved from the genome of each strain. These genes were not located in the immediate vicinity of cndA. The four ferredoxins share 64 to 72% amino acid sequence identities to the ferredoxin component of dicamba O-demethylase (DMO), and the two reductases share 62 to 65% amino acid sequence identities to the reductase component of DMO. cndA, the four ferredoxin genes, and the two reductases genes were expressed in Escherichia coli, and the recombinant proteins were purified using Ni-affinity chromatography. The individual components or the components in pairs displayed no activity; the enzyme mixture showed N-dealkylase activities toward alachlor, acetochlor, and butachlor only when CndA-His6 was combined with one of the four ferredoxins and one of the two reductases, suggesting that the enzyme consists of three components, a homo-oligomer oxygenase, a [2Fe-2S] ferredoxin, and a GR-type reductase, and CndA has a low specificity for the electron transport component (ETC). The N-dealkylase utilizes NADH, but not NADPH, as the electron donor.

INTRODUCTION

Chloroacetanilide herbicides are a class of highly efficient preemergence herbicides that are widely used in corn, cotton, soybean, and many other crops for the control of annual grass and broadleaf weeds (1). The majority of commonly used chloroacetanilide herbicides, such as alachlor, acetochlor, butachlor, and metolachlor, are N-alkoxyalkyl-N-chloroacetyl-substituted aniline derivatives in structure. Due to their widespread use, long persistence, and high water solubility, some of these herbicides and their metabolites have frequently been detected in soil and underground water (2). Chloroacetanilide herbicides are suspected to be carcinogenic; e.g., alachlor and acetochlor are characterized as class B2 (probable human carcinogens), whereas butachlor and metolachlor are listed as class L2 (likely to be carcinogenic to humans) and class C (possible human carcinogens), respectively, by the U.S. Environmental Protection Agency (3–5). Furthermore, these herbicides have high levels of chronic toxicity toward some aquatic organisms, and the residues in soil frequently injure subsequent rotation crops, especially in sandy soils with low organic matter contents (3–5). Therefore, the degradation mechanisms for chloroacetanilide herbicides in the environment have received considerable attention.

Microbial metabolism is the most important factor in the degradation of chloroacetanilide herbicides in the environment (6). A variety of bacterial strains that are able to degrade butachlor, alachlor, acetochlor, and metolachlor have been characterized (7–11). The microbial degradation of chloroacetanilide herbicides can be initiated by two reactions: formation of a glutathione conjugate (12) or N-dealkylation (9–11). In the N-dealkylation pathway, these herbicides are N-dealkylated to 2-chloro-N-(2,6-diethylphenyl)acetamide (CDEPA) (for alachlor and butachlor) or 2-chloro-N-(2-methyl-6-ethylphenyl)acetamide (CMEPA) (for acetochlor and metolachlor), which are then converted to 2,6-diethylaniline (DEA) or 2-methyl-6-ethylaniline (MEA), respectively (9–11). A gene, cmeH, encoding an amidase that catalyzes the amide bond cleavage of CDEPA or CMEPA was cloned from Sphingobium quisquiliarum DC-2 (11). However, the molecular basis for the N-dealkylation of chloroacetanilide herbicides in microorganisms is still unknown.

In living organisms, N-dealkylation by members of the cytochrome P450 and Rieske non-heme iron oxygenase (RHO) families is an important metabolic or detoxification mechanism for many N-alkyl-containing natural or xenobiotic compounds (13–15). RHOs are characterized by utilizing Rieske-type non-heme Fe(II) as the catalytic center, and they are important enzymes for the degradation of xenobiotics and the biosynthesis of bioactive natural compounds (14, 16). To date, more than 130 RHOs have been reported, but only a few RHOs are N-demethylases. Summers et al. described three RHO monooxygenases, NdmA, NdmB, and NdmC, which catalyze the N-1-, N-3-, and N-7-specific demethylation of caffeine, respectively, in Pseudomonas putida CBB5 (17). Recently, Gu et al. identified an N-demethylase, PudmA, catalyzing the demethylation of phenylurea herbicides in Sphingobium sp. strain YBL2 (18). To the best of our knowledge, there is no description of an RHO that is involved in the N-dealkylation of chloroacetanilide herbicides.

Previously, two sphingomonads, Sphingomonas wittichii DC-6 and Sphingobium quisquiliarum DC-2, were isolated from activated sludge of a wastewater treatment facility of a herbicide manufacturer (10, 11). Strain DC-6 mineralizes chloroacetanilide herbicides such as alachlor, acetochlor, and butachlor, while strain DC-2 can only transform them to the final product, DEA or MEA. In both strains, the initial metabolic reaction is N-dealkylation. In this study, a three-component RHO responsible for the N-dealkylation of alachlor, acetochlor, and butachlor was identified in the two sphingomonads.

MATERIALS AND METHODS

Chemicals and media.

Alachlor, acetochlor, pretilachlor, butachlor, propisochlor, metolachlor, CDEPA, DEA, and MEA were purchased from Sigma-Aldrich (Shanghai, China); CMEPA was purchased from Alfa-Aesar (Tianjin, China). All chemicals and reagents were of analytical grade. Luria-Bertani (LB) agar and LB broth were obtained from Difco Laboratories (Detroit, MI). The minimal salts medium (MSM) consisted of the following components (in g liter−1): K2HPO4, 1.5; KH2PO4, 0.5; NH4NO3, 1.0; NaCl, 1.0; MgSO4·7H2O, 0.2; and yeast extract, 0.02; pH 7.0.

Bacterial strains, plasmids, and culture conditions.

The strains and plasmids used in this study are listed in Table 1. Escherichia coli strains were routinely grown aerobically at 37°C in LB broth or on LB agar. The sphingomonads were grown aerobically at 30°C in LB medium, unless otherwise indicated.

TABLE 1.

Strains and plasmids used in this study

Strain or plasmid Description Source or reference
Strains
    Sphingomonas wittichii DC-6 (= KACC 16600) Degrades alachlor, acetochlor, and butachlor; Smr 10
    Sphingomonas wittichii DC-6Mut Mutant of DC-6 unable to degrade alachlor, acetochlor, and butachlor; Smr This study
    Sphingobium quisquiliarum DC-2 (= KACC 17149) Degrades acetochlor, butachlor, and alachlor; Smr 11
    Escherichia coli DH5α F− recA1 endA1 thi-1 supE44 relA1 deoR Δ(lacZYA-argF)U169 ϕ80dlacZΔM15 TaKaRa
    Escherichia coli BL21(DE3) F− ompT hsdS(rB− mB−) gal dcm lacY1 (DE3) Invitrogen
    Escherichia coli HB101(pRK600) Conjugation helper strain; Cmr This lab
Plasmids
    pBBR1MCS-5 Broad-host-range cloning vector; Gmr 26
    pBBRcndA pBBR1MCS-5 derivative containing cndA; Gmr This study
    pET29a(+) Expression vector; Kmr Novagen
    pETcndA pET-29a(+) derivative carrying cndA; Kmr This study
    pETcndB1 pET-29a(+) derivative carrying cndB1; Kmr This study
    pETcndB2 pET-29a(+) derivative carrying cndB2; Kmr This study
    pETfdx-1 pET-29a(+) derivative carrying fdx-1; Kmr This study
    pETfdx-2 pET-29a(+) derivative carrying fdx-2; Kmr This study
    pETcndC1 pET-29a(+) derivative carrying cndC1; Kmr This study
    pETred-1 pET-29a(+) derivative carrying red-1; Kmr This study
Open in a new tab

Sequencing, assembly, annotation, and genome comparison.

DNA manipulation was performed according to standard protocols, as described by Sambrook and Russell (19). Draft genome sequencing was performed by Shanghai Majorbio Bio-pharm Technology Co., Ltd. (Shanghai, China), using an Illumina HiSeq 2000 system. Shotgun libraries of 300 bp were constructed for each strain, and the raw reads was assembled using SOAP de novo software (version 1.05; http://soap.genomics.org.cn/soapdenovo.html). De novo gene prediction was performed through the use of Glimmer software (version 3.0; http://ccb.jhu.edu/software/glimmer/index.shtml). Functional annotation was accomplished by BLAST analysis of protein sequences in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, Swiss-Prot database, Non-Redundant protein database (NR), and Cluster of Orthologous Groups (COG) database using an E-value cutoff of 1E−5. To find the missing DNA fragment in strain DC-6Mut, an all-versus-all analysis was carried out between the genomes of strains DC-6 and DC-6Mut using the MAUVE (version 1.2.3) software package with its default settings (20). The analysis of nucleotide and deduced amino acid sequences was performed with Omiga software (version 3.0). DNA walking was performed by self-formed adaptor PCR (21). For the phylogenetic analysis, all protein sequences were aligned by use of the Clustal X (version 2.0) program (22); the phylogenetic tree was constructed by the neighbor-joining method (23) with a Kimura two-parameter distance model (24) in MEGA software (version 5.0) (25).

Functional complement of the DC-6Mut defect with CndA.

A 1,047-bp KpnI-EcoRI-digested PCR fragment containing cndA was ligated into the corresponding site of broad-host-range plasmid pBBR1MCS-5 (26). The resulting plasmid, pBBRcndA, was transformed into E. coli DH5α. The inserted fragment of pBBRcndA was verified by sequencing, and pBBRcndA was then introduced into DC-6Mut by triparental mating with pRK600 as the helper. The abilities of the strains harboring pBBRcndA to degrade alachlor, acetochlor, and butachlor were determined by a whole-cell biotransformation test as described by Liu et al. (27), with some modifications. Briefly, the post-log-phase cells were harvested by centrifugation, washed with MSM, and resuspended in 30 ml MSM to a final optical density at 600 nm of 1.0. The cell suspension was added to 0.5 mM each substrate, and the mixture was incubated aerobically on a rotary shaker at 30°C and 150 rpm. Samples were taken at regular intervals, and the concentrations of the substrates were determined by high-performance liquid chromatography (HPLC) analysis, as described below.

Expression of the oxygenase, ferredoxin, and reductase genes and purification of the recombinant proteins.

The genes coding for the oxygenase, ferredoxins, and reductases were amplified from the genomic DNA of strain DC-6 or DC-2 with the primers listed in Table 2 using PrimeSTAR HS DNA polymerase. The amplified products were digested with NdeI and XhoI (or HindIII) and ligated into the corresponding site of plasmid pET29a(+). All the recombinant plasmids were sequenced to verify that the coding sequence of each gene was in frame with the vector sequence that encodes a C-terminal His6 tag and then transformed into E. coli BL21(DE3). The expression of the genes and purification of the recombinant proteins were carried out according to the methods described by Fang and Zhou (28). The molecular weight was determined by SDS-PAGE, and the protein concentrations were quantified by the Bradford method using bovine serum albumin as the standard (29).

TABLE 2.

PCR primers used in this study

Primer DNA sequence (5′ to 3′)a Purpose
pBBRcndAf CGGGGTACCATGTTTCTCCAGAATGCCTGGTACG Forward primer to amplify cndA with a KpnI site
pBBRcndAr CCGGAATTCCTACCCCGCCGACACAGCGACGACCTTG Reverse primer to amplify cndA with an EcoRI site
pET-NdeI-cndA-f GGAATTCCATATGTTTCTCCAGAATGCCTGGTACG Forward primer to amplify cndA with an NdeI site
pET-XhoI-cndA-r AATCCCCTCGAGCCCCGCCGACACAGCGACGACCTTG Reverse primer to amplify cndA with an XhoI site
pET-NdeI-cndB1-f GATCTAGGGACCCATATGCCGACCATCATCGTCACC Forward primer to amplify cndB1 with an NdeI site
pET-XhoI-cndB1-r CATGACCTGAAACTCGAGATCCTCCGGCGCGATGGCGAC Reverse primer to amplify cndB1 with an XhoI site
pET-NdeI-cndB2-f ATCTAGGGACCCATATGCCCAAGTTGGTTGTCGTTA Forward primer to amplify cndB2 with an NdeI site
pET-XhoI-cndB2-r CATGACCTGAAACTCGAGATCTTCCGGCGCGATCGTGAC Reverse primer to amplify cndB2 with an XhoI site
pET-NdeI-fdx-1-f ATCTAGGGACCCATATGCCCAAGTTGATTGTGGTCAACC Forward primer to amplify fdx-1 with an NdeI site
pET-XhoI-fdx-1-r CATGACCTGAAACTCGAGGTCTTCCGGCGCGATGGTGACG Reverse primer to amplify fdx-1 with an XhoI site
pET-NdeI-fdx-2-f ATCTAGGGACCCATATGACGACGATTGAAGTGACCACCC Forward primer to amplify fdx-2 with an NdeI site
pET-XhoI-fdx-2-r CATGACCTGAAACTCGAGATCTTCGGGCGCGAGTGTCACC Reverse primer to amplify fdx-2 with an XhoI site
pET-NdeI-cndC1-f GGAATTCCATATGGCCCAGTATGACGTTCTGATCG Forward primer to amplify cndC1 with an NdeI site
pET-HindIII-cndC1-r AATCCCAAGCTTGGCAGGGAGCAGGGTCTTCAACGG Reverse primer to amplify cndC1 with an HindIII site
pET-NdeI-red-1-f ATCTAGGGACCCATATGAACCATTATGACGTTGTGATCG Forward primer to amplify red-1 with an NdeI site
pET-XhoI-red-1-r CATGACCTGAAACTCGAGGGCCAGACCGACTTCCTTGAGA Reverse primer to amplify red-1 with an XhoI site
Open in a new tab
a

Restriction sites are underlined.

Enzyme activity assays.

The activity of the oxidative N-dealkylase toward various chloroacetanilide herbicides was determined in a 1-ml mixture containing 20 mM acetate buffer (pH 7.0), 0.19 μg oxygenase, 0.64 μg ferredoxin, 0.18 μg reductase, 1 mM NADH, 0.5 mM Fe2+, and 1 mM Mg2+. The assays were initiated by addition of the substrate at a final concentration of 0.5 mM to the enzyme mixture; the reactions were performed at 30°C for 60 min and then terminated by boiling at 100°C for 3 min. The disappearance of the substrates was monitored by HPLC, and the products were identified by gas chromatography-mass spectrometry (GC-MS) as described below. One unit of N-dealkylase activity was defined as the consumption of 1 nmol substrate per minute.

Biochemical characterization.

The pH range of the enzyme was determined by incubating the enzyme with 0.5 mM acetochlor as the substrate for 60 min at 30°C at between pH 3.8 and 10.6. Three different buffering systems were used: 20 mM citric acid buffer (pH 3.8 to 5.8), 20 mM acetate buffer (pH 5.4 to 8.6), and 20 mM glycine–NaOH buffer (pH 7.8 to 10.6). The relative activity was calculated by assuming that the activity observed at pH 7.0 was 100%. The optimal reaction temperature was determined under standard conditions at pH 7.0 and different temperatures (5 to 70°C at 5°C intervals); the relative activity was calculated by assuming that the activity observed at 30°C was 100%. The effects of potential inhibitors on the enzyme were determined by addition of various monovalent and divalent cations (each at 1.0 mM) and the metal-chelating agent EDTA (10 mM) to the reaction mixture and incubation at 30°C for 60 min. N-Dealkylase activity was assayed as described above and expressed as a percentage of the activity obtained in the absence of the added compounds.

HPLC and GC-MS analyses.

The samples were freeze-dried, dissolved in 500 μl methanol, and filtered through a 0.22-μm-pore-size Millipore membrane to remove particles. A separation column (4.6 mm by 250 mm by 5 μm; Kromasil 100-5 C18) was used for HPLC analysis. The mobile phase was a mixture of methanol and water at 80:15 (vol/vol), and the flow rate was 0.8 ml per min. The detection wavelength was 225 nm, and the injection volume was 20 μl. GC-MS analysis was performed in electron ionization (EI) mode (70 eV) with a Finnigan gas chromatograph equipped with an MS detector. Gas chromatography was conducted using an RTX-5MS column (15 m by 0.25 mm by 0.25 μm; Restek Corp.). The column temperature was programmed to increase from 50°C (1.5 min hold) to 220°C at 20°C per min, held for 1 min, and then increased to 260°C at 50°C per min and held at 260°C for 10 min. Helium was used as the carrier gas at a constant flow rate of 1.0 ml per min. The samples were analyzed in split mode (1:20) at an injection temperature of 220°C and an EI source temperature of 250°C and scanned in the mass range from m/z 50 to m/z 400.

Nucleotide sequence accession numbers.

The GenBank accession numbers of the 19,932-bp DNA fragment containing the oxygenase gene cndA is KJ461679. The GenBank accession numbers of the ferredoxin genes cndB1, cndB2, fdx-1, and fdx-2 are KJ020542, KJ020543, KJ186091, and KJ186092, respectively. The GenBank accession numbers of the reductase genes cndC1 and red-1 are KJ020540 and KJ020538, respectively. The draft genome sequences of strain DC-6 and strain DC-2 have been deposited in DDBJ/EMBL/GenBank under accession numbers JMUB00000000 and JNAC00000000, respectively. The versions described in this paper have accession numbers JMUB01000000 and JNAC01000000, respectively.

RESULTS

Screen of a mutant strain (DC-6Mut) defective in herbicide degradation.

When grow on LB agar supplemented with 0.5 mM butachlor, sphingomonads DC-6 and DC-2 produce a visible transparent halo around the colony because butachlor, which has a low level of solubility in water, is mineralized or transformed into the water-soluble product DEA. Occasionally, we found that a few colonies of strain DC-6 lost the ability to produce the transparent halo after successive streaking on LB agar; one such mutant was designated DC-6Mut (see Fig. S1 in the supplemental material). Whole-cell transformation experiments showed that DC-6Mut could completely degrade CMEPA, CDEPA, MEA, and DEA, which are the metabolites of chloroacetanilide herbicides, but not alachlor, acetochlor, or butachlor, indicating that the gene responsible for the initial step (N-dealkylation) of chloroacetanilide herbicide degradation was lost or disrupted in mutant DC-6Mut.

Genome comparison of strains DC-6, DC-6Mut, and DC-2.

The draft genomes of strains DC-6, DC-6Mut, and DC-2 are 6,334,837 bp, 6,325,634 bp, and 5,004,271 bp in length, respectively. By comparing the genomes of strains DC-6 and DC-6Mut, a 3,496-bp fragment of strain DC-6 was found to be absent in mutant DC-6Mut, which was confirmed by PCR. Subsequently, the genomic regions flanking the 3,496-bp fragment were obtained by DNA walking, and finally, a 19,932-bp fragment was assembled. Sequence comparison and PCR analysis revealed that a portion (18,183 bp) of the 19,932-bp sequence was also present in the genome of strain DC-2 and a 4,265-bp fragment within the 18,183 bp was missing in mutant DC-6Mut (Fig. 1).

FIG 1.

FIG 1

Open in a new tab

Organization of the genes involved in N-dealkylation of chloroacetanilide herbicides. Arrows, relative length and transcription direction of each gene or ORF.

ORF analysis of the missing fragment.

A search for open reading frames (ORFs) revealed that an oxygenase gene, designated cndA, was present in the 4,265-bp fragment (Table 3; Fig. 1). cndA consists of 1,047 bp and encodes a protein of 348 amino acids. BLAST analysis showed that CndA shares homologies with the oxygenase components of some RHOs catalyzing N- or O-demethylation reactions, e.g., VanA (vanillate O-demethylase, 42% amino acid sequence identity) from Pseudomonas sp. strain ATCC 19151 (30); DdmC (dicamba O-demethylase, 40% identity) from Pseudomonas maltophilia DI-6 (31); PudmA (phenylurea herbicide N-demethylase, 30% identity) from Sphingobium sp. strain YBL2 (18); and NdmA (27% identity), NdmB (25% identity), and NdmC (24% identity), which are involved in the N-1-, N-3-, and N-7-specific demethylation of caffeine in Pseudomonas putida CBB5 (17), respectively. Sequence alignment revealed that CndA contains conserved sequences for a Rieske [2Fe-2S] domain (CXHX17CX2H) and a non-heme Fe(II) domain (DX2HX4H) (see Fig. S2 in the supplemental material), suggesting that CndA is a member of the RHO family. Notably, two classes of transposon genes are found upstream and downstream of cndA. Upstream of cndA, there were two genes, istA1 and istB1. IstA1 and IstB1 share 100% and 99% amino acid sequence identities to the sequences of IstA and IstB from Rhizobium sp. strain AC100, respectively (32). Downstream of cndA, there are also two genes, tnpA1 and tnpA2. TnpA1 and TnpA2 exhibit 99% identities to the IS6100 transposase-like proteins from E. coli (33). The results indicated that the cndA gene is located in a transposable element. The homologies of CndA with some N- or O-demethylation oxygenases, the existence of cndA in DC-6 and DC-2, and its absence in mutant DC-6Mut suggested that cndA is most likely the oxygenase component of an RHO that is responsible for the N-dealkylation of chloroacetanilide herbicides.

TABLE 3.

Deduced function of each ORF within the 19,932-bp sequence containing the 4,265-bp missing fragment

Gene name, proposed product(s) Position in the 19,932-bp fragment Product size (no. of amino acids) Homologous protein (GenBank accession no.), source % identity
orf1, hypothetical protein 238–744 168 Hypothetical protein (WP_016698448.1), Actinoalloteichus spitiensis 29
orf2, hypothetical protein 925–1359 145 Hypothetical protein (WP_010339728.1), Sphingobium yanoikuyae 72
orf3, conserved hypothetical protein 2959–4308 450 Conserved hypothetical protein (XP_002536264.1), Ricinus communis 47
itsA1, transposase 5593–7113 506 Transposase (BAB85624.1), Rhizobium sp. AC100 100
itsB1, IstB-like ATP-binding protein 7103–7882 259 Helper protein (BAB85625.1), Rhizobium sp. AC100 99
cndA, oxygenase 7988–9034 348 Vanillate monooxygenase (YP_001262782.1), Sphingomonas wittichii RW1 48
tnpA1, transposase 9658–10451 258 Transposase IS6100 (YP_003108355.1), Escherichia coli 99
tnpA2, transposase 11562–12356 264 Transposase IS6100 (YP_003108355.1), Escherichia coli 99
orf4, hypothetical protein 12790–13809 339 Hypothetical protein (YP_006962357.1), Pseudomonas sp. strain K-62 33
orf5, hypothetical protein 14079–15440 453 Hypothetical protein G432_22025 (YP_007618333.1), Sphingomonas sp. strain MM-1 100
orf6, resolvase 15440–16075 212 Resolvase domain-containing protein (YP_007618300.1), Sphingomonas sp. MM-1 100
tn3A, transposase 16177–19104 976 Transposase Tn3 family protein (YP_007618331.1), Sphingomonas sp. MM-1 100
Open in a new tab

CndA could functionally complement the DC-6Mut defect.

To identify the function of CndA, the recombinant plasmid pBBRcndA containing cndA was introduced into mutant DC-6Mut. Whole-cell transformation experiments revealed that strain DC-6Mut(pBBRcndA) restored the ability to degrade alachlor, acetochlor, and butachlor (see Fig. S3 to S5 in the supplemental material), confirming that CndA is involved in the N-dealkylation of chloroacetanilide herbicides. Furthermore, similar to strain DC-6, DC-6Mut(pBBRcndA) was able to form a visible transparent halo around the colonies on LB agar supplemented with 0.5 mM butachlor (see Fig. S1 in the supplemental material), also demonstrating the N-dealkylation activity of CndA. However, E. coli DH5α harboring pBBRcndA failed to degrade butachlor, which is obviously due to the absence of a suitable electron transport component (ETC).

Identification of the ferredoxin and reductase required for CndA.

All reported RHOs require an ETC to facilitate electron transfer. However, it is interesting that in the immediate vicinity of cndA there was no evidence for genes coding for ferredoxin or reductase that could serve as the ETC. The strategy to identify the ferredoxin and reductase components was based on the assumption that since the function of CndA is dealkylation and it showed the highest sequence identities with the oxygenase components of some reported N- or O-demethylases, the ETC for CndA should share homology with the ETC components of these N- or O-demethylases. Thus, the ferredoxin and reductase components of DMO (31), vanillate O-demethylase (30) and caffeine N-demethylases (17), respectively, were used to search the genomes of strains DC-6 and DC-2. Vanillate O-demethylase and caffeine N-demethylases are two-component RHOs consisting of an oxygenase and an FNRC (ferredoxin-NADP+ reductase with the [2Fe-2S] ferredoxin domain connected to the C terminus of the NAD domain)-type reductase; when VanB, the reductase of vanillate O-demethylase, and NdmD, the reductase of caffeine N-demethylases, were used for the search, no target reductase was retrieved. DMO is a three-component RHO consisting of an oxygenase (DdmC), a [2Fe-2S]-type ferredoxin (DdmB), and a glutathione reductase (GR)-type reductase (DdmA). When DdmB and DdmA were used for the search, two ferredoxins, designated CndB1 and CndB2, and one reductase, designated CndC1, were retrieved from strain DC-6, and another two ferredoxins, designated Fdx-1 and Fdx-2, and one reductase, designated Red-1, were retrieved from strain DC-2. The four ferredoxins share 64 to 72% amino acid sequence identities with DdmB and form a subclade with DdmB in the phylogenetic tree of the ferredoxin components of many RHOs; the two reductases share 59 to 65% amino acid sequence identities with DdmA and RedA2 and are clustered in a subclade with the two reductases in the phylogenetic tree of the reductase components of many RHOs (Fig. 2 and 3).

FIG 2.

FIG 2

Open in a new tab

Phylogenetic tree constructed on the basis of the alignment of CndB1, CndB2, Fdx-1, and Fdx-2 with the ferredoxin components of some characterized RHOs. The trees were constructed by the neighbor-joining method. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The names of the proteins and the strains (presented as protein designation.strain designation) as well as their GI numbers (in parentheses) are displayed in the phylogenetic tree.

FIG 3.

FIG 3

Open in a new tab

Phylogenetic tree constructed on the basis of the alignment of CndC1 and Red-1 with the reductase components of some characterized RHOs. The trees were constructed by the neighbor-joining method. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The names of the proteins and the strains (presented as protein designation.strain designation) as well as their GI numbers (in parentheses) are displayed in the phylogenetic tree.

Expression of cndA and ferredoxin and reductase genes and reconstruction of the chloroacetanilide herbicide N-dealkylase in vitro.

cndA and the four ferredoxin and two reductase genes retrieved were expressed in E. coli BL21(DE3) using the pET29a(+) expression system, and the recombinant proteins were purified by Ni-affinity chromatography (see Fig. S6 in the supplemental material). The purified ferredoxins and reductases were mixed with CndA-His6 in various combinations in vitro. The results of enzyme assays showed that the enzyme mixture displayed no N-dealkylase activity when tested individually or in pairs. N-dealkylase activity was obtained only when the mixture contained CndA-His6, one of the four ferredoxins, and one of the two reductases, indicating that the chloroacetanilide herbicide N-dealkylase consists of three components: a homo-oligomer oxygenase, a [2Fe-2S] ferredoxin, and a GR-type reductase. The combination of CndA, CndB1, and CndC1 showed the highest N-dealkylase activities, which were approximately 2 to 29% higher than those of the combinations of CndA with other ferredoxins and reductases (Table 4). Comparison of the N-dealkylation rates of alachlor, acetochlor, and butachlor and their molecular structures suggested a possible negative correlation between the length of the N-alkoxymethyl and the catalytic efficiency of the enzyme toward these substrates. The N-dealkylase was unable to degrade pretilachlor, propisochlor, metolachlor, and some other N- or O-methyl-containing compounds, such as caffeine, vanillate, dicamba, and isoproturon. GC-MS analysis demonstrated that the N-dealkylase converted alachlor to CDEPA and methoxymethanol, acetochlor to CMEPA and ethoxymethanol, and butachlor to CDEPA and butoxymethanol (see Fig. S7 to S9 in the supplemental material).

TABLE 4.

Activities of different combinations of oxygenase, ferredoxin, and reductase for alachlor, acetochlor, and butachlor

Enzymea Activity (nmol/min/mg)
Alachlor Acetochlor Butachlor
CndA-B1-C1 205.3 ± 20.5 145.9 ± 12.7 112.4 ± 16.4
CndA-B1-R1 195.7 ± 7.4 143.2 ± 19.4 91.8 ± 6.5
CndA-B2-C1 186.3 ± 12.4 124.7 ± 7.8 87.1 ± 9.4
CndA-B2-R1 176.5 ± 15.7 119.5 ± 18.4 83.3 ± 21.5
CndA-F1-C1 167.1 ± 19.3 141.6 ± 20.2 79.6 ± 5.3
CndA-F1-R1 169.4 ± 21.2 138.1 ± 11.5 85.4 ± 17.1
CndA-F2-C1 174.8 ± 15.6 132.5 ± 23.7 86.9 ± 14.7
CndA-F2-R1 161.5 ± 6.6 129.1 ± 17.6 79.2 ± 12.6
Open in a new tab
a

Abbreviations: B1, CndB1; B2, CndB2; C1, CndC1; F1, Fdx-1; F2, Fdx-2; R1, Red-1.

Characterization of the N-dealkylase.

The effects of 1.0 mM monovalent and divalent cations and 10 mM the metal-chelating agent EDTA on N-dealkylase (a mixture of CndA, CndB1, and CndC1) are shown in Table S1 in the supplemental material. The N-dealkylase activity was notably enhanced by Fe2+ and Mg2+, but it was not obviously affected by monovalent cations K+, Na+, and Li+. Divalent cations Ca2+, Cr2+, Co2+, and Mn2+ showed moderate inhibition of the enzyme, whereas heavy metal ions Ag+, Cu2+, Pb2+, Hg2+, Ni2+, and Zn2+ severely inhibited the activity. EDTA significantly inhibited the N-dealkylase activity, indicating that the enzyme requires metal ions for its activity. The N-dealkylase activity was detected from 5 to 65°C and at pH values ranging from 3.8 to 10.6, with the greatest N-dealkylase activity being detected at 35°C and pH 7.0 (see Fig. S10A and B in the supplemental material). NADH, but not NADPH, supported the N-dealkylase activity, indicating that the N-dealkylase is specific for NADH. Mg2+ and Fe2+ were necessary for N-dealkylase activity. Flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN) produced little or no stimulation of the N-dealkylase activity.

DISCUSSION

In the present study, we identified and characterized an RHO-type N-dealkylase catalyzing the N-dealkylation of the chloroacetanilide herbicides alachlor, acetochlor, and butachlor. The chloroacetanilide herbicide N-dealkylase consists of a homo-oligomer oxygenase (CndA), a [2Fe-2S] ferredoxin, and a GR-type reductase and is obviously different from previously reported oxidative herbicide N-dealkylases, such as PudmAB (18), CYP116B1 (15), and CYP116A1 (34). PudmAB, catalyzing the N-demethylation of phenylurea herbicides, is a hetero-oligomeric oxygenase consisting of an alpha subunit and a beta subunit (18); CYP116B1 and CYP116A1, catalyzing the hydroxylation of S-ethyl dipropylthiocarbamate and S-propyl dipropylthiocarbamate, are cytochrome P450-based N-dealkylases (15, 34). In the phylogenetic tree of CndA with the oxygenase components of 71 characterized RHOs (see Fig. S11 in the supplemental material), CndA is clustered with the oxygenase components of many RHOs responsible for the C—O/C—N bond-cleaving reactions and forms a subclade with VanA (30), DdmC (31), TsaM (35), and NdmA, NdmB, and NdmC (17). However, the chloroacetanilide herbicide N-dealkylase differs in some essential genetic and biochemical characteristics from these RHOs. First, CndA shares only 24 to 42% amino acid sequence identities with these oxygenases. Second, CndA has a substrate spectrum that is different from the substrate spectra of these RHOs. Third, the chloroacetanilide herbicide N-dealkylase is a three-component RHO, while all of its neighbors in the subclade, except DMO, are two-component RHOs. Furthermore, the chloroacetanilide herbicide N-dealkylase has some biochemical characteristics different from those of its most related neighbor, DMO (31); e.g., the chloroacetanilide herbicide N-dealkylase cannot transform dicamba, which is the preferred substrate of DMO, and the chloroacetanilide herbicide N-dealkylase utilizes NADH, but not NADPH, for reduction, whereas DMO can utilize both NADH and NADPH.

RHOs are remarkably diverse with respect to their functions and structures. In the RHO classification system based on the sequence phylogenetic information as well as the interactions between components (16), RHOs were classified into five distinct types: type I (a homo-oligomeric or hetero-oligomeric oxygenase and an FNRC-type reductase), type II {an oxygenase and an FNRN (ferredoxin-NADP+ reductase with the [2Fe-2S] ferredoxin domain connected to the N terminus of the flavin-binding domain)-type reductase}, type III (a homo-oligomeric or hetero-oligomeric oxygenase, a [2Fe-2S]-type ferredoxin, and an FNRN-type reductase), type IV (an hetero-oligomeric oxygenase, a [2Fe-2S]-type ferredoxin, and a GR-type reductase), and type V (an hetero-oligomeric oxygenase, a [3Fe-4S]-type ferredoxin, and a GR-type reductase). The chloroacetanilide herbicide N-dealkylase and DMO are most related to type IV RHOs but distinguishable from reported type IV RHOs in terms of oxygenase type. Thus, we suggest that type IV should be amended and subdivided into two subtypes, type IVαβ (the oxygenase component is hetero-oligomeric) and type IVα (the oxygenase component is homo-oligomeric), to accommodate the chloroacetanilide herbicide N-dealkylase and DMO.

In the opinion of Kweon et al., three-component RHOs (types IV and V) are more evolutionarily advanced and more efficient than two-component RHOs (types I and II) because the ferredoxin component is relatively short and simple compared to the reductase component and thus has been evolutionarily chosen as a buffer between the reductase and oxygenase components for rapid adaptation to environmental transitions (16). It is interesting that chloroacetanilide herbicides and the substrates of many recently reported three-component RHOs, such as phenylurea herbicides (18), dicamba (31), and dioxin (36), are synthetic xenobiotics that have been present in the environment for no more than 100 years. The fact that bacteria have evolved three-component RHOs to degrade these xenobiotics provides new evidence to support the proposal presented above that three-component RHOs have the potential to promptly adapt to environmental change.

cndA is highly conserved and located in a putative transposable element which is present in the genomes of both sphingomonads DC-6 and DC-2. These two sphingomonads were isolated from the same activated sludge sample (10, 11). These results indicate that cndA can be horizontally transferred among sphingomonads. In general, the genes encoding the components of RHOs are clustered together and organized in a transcriptional unit (36, 37). However, the genes coding for the ferredoxins and reductase that served as the ETC are not located in the immediate vicinity of cndA. Similar phenomena have also been found in some other RHO genes responsible for the metabolism of xenobiotics (18, 31, 36). In addition, CndA can use more than one [2Fe-2S]-type ferredoxin and GR-type reductase as the ETC, suggesting that CndA has a low specificity for ETC. Such a gene organization may increase the gene utilization flexibility and efficiency and may thus facilitate the rapid evolution of new catabolic pathways to degrade xenobiotics in bacteria.

Supplementary Material

Supplemental material
supp_80_16_5078__index.html (2KB, html)

ACKNOWLEDGMENTS

We are grateful to NingYi Zhou (School of Life Sciences & Biotechnology, Shanghai Jiao Tong University, Shanghai, China) for valuable suggestions on the enzyme study.

This work was supported by grants from the National Natural Science Foundation of China (31270157) and the National High Technology Research and Development Program of China (2012AA101403).

Footnotes

Published ahead of print 13 June 2014

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.00659-14.

REFERENCES

  • 1.Tomlin CDS. 2006. The pesticide manual: a world compendium, 14th ed. British Crop Protection Council, Farnham, Surrey, United Kingdom [Google Scholar]
  • 2.Hildebrandt A, Guillamón M, Lacort S, Tauler R, Barceló D. 2008. Impact of pesticides used in agriculture and vineyards to surface and groundwater quality (north Spain). Water Res. 42:3315–3326. 10.1016/j.watres.2008.04.009 [DOI] [PubMed] [Google Scholar]
  • 3.US Environmental Protection Agency. 1995. R.E.D. facts: metolachlor. Report EPA-738-F-95-007. US Environmental Protection Agency, Washington, DC: http://www.epa.gov/pesticides/reregistration/REDs/factsheets/0001fact.pdf [Google Scholar]
  • 4.U.S. Environmental Protection Agency. 1998. R.E.D. facts: alachlor. Report EPA-738-F-98-018. US Environmental Protection Agency, Washington, DC: http://www.epa.gov/oppsrrd1/REDs/factsheets/0063fact.pdf [Google Scholar]
  • 5.US Environmental Protection Agency. 2006. Report of the Food Quality Protection Act (FQPA) tolerance reassessment progress and risk management decision (TRED) for acetochlor. Report EPA738-R-00-009. US Environmental Protection Agency, Washington, DC: http://www.epa.gov/pesticides/reregistration/REDs/acetochlor_tred.pdf [Google Scholar]
  • 6.Beestman GB, Deming JM. 1974. Dissipation of acetanilide herbicides from soils. Agron. J. 66:308–311. 10.2134/agronj1974.00021962006600020035x [DOI] [Google Scholar]
  • 7.Wang YS, Liu JC, Chen WC, Yen JH. 2008. Characterization of acetanilide herbicides degrading bacteria isolated from tea garden soil. Microb. Ecol. 55:435–443. 10.1007/s00248-007-9289-z [DOI] [PubMed] [Google Scholar]
  • 8.Dwivedi S, Singh BR, Al-Khedhairy AA, Alarifi S, Musarrat J. 2010. Isolation and characterization of butachlor-catabolizing bacterial strain Stenotrophomonas acidaminiphila JS-1 from soil and assessment of its biodegradation potential. Lett. Appl. Microbiol. 51:54–60. 10.1111/j.1472-765X.2010.02854.x [DOI] [PubMed] [Google Scholar]
  • 9.Zhang J, Zheng JW, Liang B, Wang CH, Cai S, Ni YY, He J, Li SP. 2011. Biodegradation of chloroacetanilide herbicides by Paracoccus sp. FLY-8 in vitro. J. Agric. Food Chem. 59:4614–4621. 10.1021/jf104695g [DOI] [PubMed] [Google Scholar]
  • 10.Chen Q, Yao L, Wang CH, Deng SK, Chu CW, He J. 2013. Isolation and characterization of acetochlor-degrading strain Sphingomonas sp. DC-6 and preliminary studies on its metabolic pathway. J. Agric. Sci. Technol. 15:67–74 [Google Scholar]
  • 11.Li Y, Chen Q, Wang CH, Cai S, He J, Huang X, Li SP. 2013. Degradation of acetochlor by consortium of two bacterial strains and cloning of a novel amidase gene involved in acetochlor-degrading pathway. Bioresour. Technol. 148:628–631. 10.1016/j.biortech.2013.09.038 [DOI] [PubMed] [Google Scholar]
  • 12.Stamper DM, Tuovinen OH. 1998. Biodegradation of the acetanilide herbicides alachlor, metolachlor, and propachlor. Crit. Rev. Microbiol. 24:1–22. 10.1080/10408419891294163 [DOI] [PubMed] [Google Scholar]
  • 13.Denisov IG, Makris TM, Sligar SG, Schlichting I. 2005. Structure and chemistry of cytochrome P450. Chem. Rev. 105:2253–2278. 10.1021/cr0307143 [DOI] [PubMed] [Google Scholar]
  • 14.Barry SM, Challis GL. 2013. Mechanism and catalytic diversity of Rieske non-heme iron-dependent oxygenases. ACS Catal. 3:2362–2370. 10.1021/cs400087p [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Warman AJ, Robinson JW, Luciakova D, Lawrence AD, Marshal KR, Warren MJ, Cheesman MR, Rigby SE, Munro AW, McLean KJ. 2012. Characterization of Cupriavidus metallidurans CYP116B1—a thiocarbamate herbicide oxygenating P450-phthalate dioxygenase reductase fusion protein. FEBS J. 279:1675–1693. 10.1111/j.1742-4658.2012.08543.x [DOI] [PubMed] [Google Scholar]
  • 16.Kweon O, Kim SJ, Baek S, Chae JC, Adjei MD, Baek DH, Kim YC, Cerniglia CE. 2008. A new classification system for bacterial Rieske non-heme iron aromatic ring-hydroxylating oxygenases. BMC Biochem. 9:11. 10.1186/1471-2091-9-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M. 2012. Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids. J. Bacteriol. 194:2041–2049. 10.1128/JB.06637-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Gu T, Zhou CY, Sørensen SR, Zhang J, He J, Yu PW, Yan X, Li SP. 2013. The novel bacterial N-demethylase PudmAB is responsible for the initial step of N,N-dimethyl-substituted phenylurea herbicides degradation. Appl. Environ. Microbiol. 79:7846–7856. 10.1128/AEM.02478-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Sambrook J, Russell D. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [Google Scholar]
  • 20.Darling AC, Mau B, Blattner FR, Perna NT. 2004. Mauve: multiple alignment of conserved genomic sequence with rearrangements. Genome Res. 14:1394–1403. 10.1101/gr.2289704 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Wang SM, He J, Cui ZL, Li SP. 2007. Self-formed adaptor PCR: a simple and efficient method for chromosome walking. Appl. Environ. Microbiol. 73:5048–5051. 10.1128/AEM.02973-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Larkin M, Blackshields G, Brown N, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23:2947–2948. 10.1093/bioinformatics/btm404 [DOI] [PubMed] [Google Scholar]
  • 23.Saitou N, Nei M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406–425 [DOI] [PubMed] [Google Scholar]
  • 24.Kimura M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16:111–120. 10.1007/BF01731581 [DOI] [PubMed] [Google Scholar]
  • 25.Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28:2731–2739. 10.1093/molbev/msr121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM, II, Peterson KM. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175–176. 10.1016/0378-1119(95)00584-1 [DOI] [PubMed] [Google Scholar]
  • 27.Liu H, Wang SJ, Zhang JJ, Dai H, Tang H, Zhou NY. 2011. Patchwork assembly of nag-like nitroarene dioxygenase genes and the 3-chlorocatechol degradation cluster for evolution of the 2-chloronitrobenzene catabolism pathway in Pseudomonas stutzeri ZWLR2-1. Appl. Environ. Microbiol. 77:4547–4552. 10.1128/AEM.02543-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Fang T, Zhou NY. 2014. Purification and characterization of salicylate 5-hydroxylase, a three-component monooxygenase from Ralstonia sp. strain U2. Appl. Microbiol. Biotechnol. 98:671–679. 10.1007/s00253-013-4914-x [DOI] [PubMed] [Google Scholar]
  • 29.Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248–254. 10.1016/0003-2697(76)90527-3 [DOI] [PubMed] [Google Scholar]
  • 30.Brunel F, Davison J. 1988. Cloning and sequencing of Pseudomonas genes encoding vanillate demethylase. J. Bacteriol. 170:4924–4930 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Herman PL, Behrens M, Chakraborty S, Chrastil BM, Barycki J, Weeks DP. 2005. A three-component dicamba O-demethylase from Pseudomonas maltophilia, strain DI-6: gene isolation, characterization, and heterologous expression. J. Biol. Chem. 280:24759–24767. 10.1074/jbc.M500597200 [DOI] [PubMed] [Google Scholar]
  • 32.Hashimoto M, Fukui M, Hayano K, Hayatsu M. 2002. Nucleotide sequence and genetic structure of a novel carbaryl hydrolase gene (cehA) from Rhizobium sp. strain AC100. Appl. Environ. Microbiol. 68:1220–1227. 10.1128/AEM.68.3.1220-1227.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Woodford N, Carattoli A, Karisik E, Underwood A, Ellington MJ, Livermore DM. 2009. Complete nucleotide sequences of plasmids pEK204, pEK499, and pEK516, encoding CTX-M enzymes in three major Escherichia coli lineages from the United Kingdom, all belonging to the international O25:H4-ST131 clone. Antimicrob. Agents Chemother. 53:4472–4482. 10.1128/AAC.00688-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Nagy I, Schoofs G, Compernolle F, Proost P, Vanderleyden J, de Mot R. 1995. Degradation of the thiocarbamate herbicide EPTC (S-ethyl dipropylcarbamothioate) and biosafening by Rhodococcus sp. strain NI86/21 involve an inducible cytochrome P-450 system and aldehyde dehydrogenase. J. Bacteriol. 177:676–687 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Tralau T, Cook AM, Ruff J. 2001. Map of the IncP1β plasmid pTSA encoding the widespread genes (tsa) for p-toluenesulfonate degradation in Comamonas testosteroni T-2. Appl. Environ. Microbiol. 67:1508–1516. 10.1128/AEM.67.4.1508-1516.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Armengaud J, Happe B, Timmis KN. 1998. Genetic analysis of dioxin dioxygenase of Sphingomonas sp. strain RW1: catabolic genes dispersed on the genome. J. Bacteriol. 180:3954–3966 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Tang HZ, Wang LJ, Wang WW, Yu H, Zhang KZ, Yao YX, Xu P. 2013. Systematic unraveling of the unsolved pathway of nicotine degradation in Pseudomonas. PLoS Genet. 9:e1003923. 10.1371/journal.pgen.1003923 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material
supp_80_16_5078__index.html (2KB, html)
AEM.00659-14_zam999105578so1.pdf (1.2MB, pdf)

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES