Cell Death-Inducing DFFA-Like Effector b Is Required for Hepatitis C Virus Entry into Hepatocytes

ABSTRACT

The molecular mechanism of the hepatic tropism of hepatitis C virus (HCV) remains incompletely defined. In vitro hepatic differentiation of pluripotent stem cells produces hepatocyte-like cells (HLCs) permissive for HCV infection, providing an opportunity for studying liver development and host determinants of HCV susceptibility. We previously identified the transition stage of HCV permissiveness and now investigate whether a host protein whose expression is induced during this transition stage is important for HCV infection. We suppressed the expression of a liver-specific protein, cell death-inducing DFFA-like effector b (CIDEB), and performed hepatocyte function and HCV infection assays. We also used a variety of cell-based assays to dissect the specific step of the HCV life cycle that potentially requires CIDEB function. We found CIDEB to be an essential cofactor for HCV entry into hepatocytes. Genetic interference with CIDEB in stem cells followed by hepatic differentiation leads to HLCs that are refractory to HCV infection, and infection time course experiments revealed that CIDEB functions in a late step of HCV entry, possibly to facilitate membrane fusion. The role of CIDEB in mediating HCV entry is distinct from those of the well-established receptors, as it is not required for HCV pseudoparticle entry. Finally, HCV infection effectively downregulates CIDEB protein through a posttranscriptional mechanism.

IMPORTANCE This study identifies a hepatitis C virus (HCV) entry cofactor that is required for HCV infection of hepatocytes and potentially facilitates membrane fusion between viral and host membranes. CIDEB and its interaction with HCV may open up new avenues of investigation of lipid droplets and viral entry.

INTRODUCTION

Viruses depend on host factors to gain entry into host cells, and the interaction between viral glycoproteins and cellular entry factors is important for this process and contributes to viral tropism. Of the two glycoproteins (E1 and E2) encoded by hepatitis C virus (HCV), E2 is a major target for neutralizing antibodies with well-defined epitopes, both linear and conformational (reviewed in reference 1); two of the HCV receptors, CD81 and scavenger receptor BI (SRB1), were identified through direct interaction with E2 (2, 3), and the crystal structure of a core domain of E2 has been recently solved (4). The structure and function of E1 are less well understood, but it may facilitate the correct folding (5, 6) and receptor binding (7) of E2. It has also been reported to interact with cell surface proteins (8, 9).

Following attachment and receptor binding, HCV enters the cell via endocytosis with the help of additional entry cofactors (10–14). Details of the membrane fusion process of HCV entry remain poorly defined. Both the E1 and E2 proteins contain putative fusion peptides (15–17) and may participate in membrane fusion, and the crystal structure of HCV E2 suggests that HCV glycoproteins may use a fusion mechanism that is distinct from that of related positive-strand RNA viruses, including flaviviruses (4). In addition, HCV may require an additional postbinding trigger to complete membrane fusion under low-pH conditions in the endosomes (18). Although it is not clear whether cellular proteins directly participate in the membrane fusion process, it has been proposed that removal of cholesterol from the virion by Niemann-Pick C1-like 1 (NPC1L1) is necessary before fusion can occur (14).

The cell death-inducing DFFA-like effector (CIDE) family proteins, CIDEA, CIDEB, and CIDEC/fat-specific protein 27 (Fsp27), were identified based on their homology to the N-terminal domain of DNA fragmentation factors (DFF) (reviewed in reference 19). Although these proteins induce cell death when overexpressed, the physiological function of the CIDE proteins is related to energy expenditure and lipid metabolism in vivo (20–23). All three CIDE proteins associate with lipid droplets (LDs), and CIDEC/Fsp27 in particular plays a role in the growth of lipid droplets by facilitating the fusion of the lipid monolayers of two contacting droplets (24, 25). Of the three CIDE proteins, CIDEB expression is enriched in liver tissues and cell lines of liver origin (26, 27). In addition, CIDEB has been reported to interact with nonstructural protein 2 (NS2) of HCV in a yeast-two hybrid system (28), although the interaction was not detectable in HCV-infected cells (29).

We and others recently developed a new HCV cell culture model by converting pluripotent stem cells into differentiated human hepatocyte (DHH)-like cell or hepatocyte-like cell (HLC) cultures (30–32). We also identified a critical transition stage during the hepatic differentiation process when the DHH/HLCs become permissive for HCV infection (30). Here, we identify human CIDEB as a protein whose expression correlates with the transition stage and that is required for HCV entry. CIDEB knockdown inhibited membrane fusion of HCV particles produced in cell culture (HCVcc) (33–36) without affecting the entry of HIV-HCV pseudotyped particles (HCVpp) (37, 38).

MATERIALS AND METHODS

Stem cells and hepatic differentiation.

The human embryonic stem cell (ESC) line WA09 (H9) was obtained from WiCell Research Institute and differentiated into hepatocyte-like cells using a previously published protocol (30). Huh-7.5 cells were kindly provided by Charles Rice (Rockefeller University) and Apath LLC.

Antibodies and inhibitors.

Anti-ApoE antibody (monoclonal antibody [MAb] 33) was kindly provided by Guangxiang Luo (University of Alabama at Birmingham). The following antibodies were purchased: anti-JFH core, anti-NS3, and anti-NS5A for HCV (BioFront Technologies Inc., FL); anti-CIDEB, anti-hemagglutinin (HA), anti-ApoB, and anti-GAPDH (glyceraldehyde-3-phosphate dehydrogenase) (Santa Cruz Biotechnology, TX); anti-CLDN1 (Invitrogen, NY); anti-CD81 (BD Pharmingen, NJ); anti-Rab5 (BD Transduction Laboratories, NJ); and anti-double-stranded RNA (dsRNA) (English & Scientific Consulting, Szirak, Hungary). Fluorescein isothiocyanate (FITC)- and tetramethyl rhodamine isocyanate (TRITC)-conjugated anti-rabbit and anti-mouse immunoglobulins (IgG) were purchased from Sigma-Aldrich, and Alexa Fluor 647-conjugated anti-mouse IgG was purchased from Invitrogen. ITX-5061 was a gift from Flossie Wong-Staal of iTherX Inc. (San Diego, CA).

Immunofluorescence analysis (IFA).

Cells were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) at room temperature for 10 min and blocked and permeabilized with PBTG (PBS containing 0.1% Triton X-100, 10% normal goat serum, and 1% bovine serum albumin [BSA]) at room temperature for 2 h. West Nile virus (WNV)-infected cells were fixed as described above and then permeabilized with PBS containing 0.1% Triton X-100 for 10 min, washed three times with PBS, and then blocked with PBS containing 5% horse serum. The cells were incubated with primary antibodies (anti-Rab5 or anti-dsRNA) at 4°C overnight or at room temperature for 2 h. Isotype mouse or rabbit IgGs were used as negative controls. After four washes with PBS, a FITC-, TRITC-, or Alexa Fluor-conjugated secondary antibody was added and incubated at room temperature for 1 h. The coverslips were then mounted with VectaShield (H-1200; Vector Laboratories, CA) or Prolong Gold antifade reagent (Invitrogen). For LD staining, cells were similarly fixed and stained using Bodipy (boron-dipyrromethene) 530/550 (diluted 1:2,000 in PBS) at room temperature for 15 min before mounting and observation by confocal microscopy.

PAS staining and albumin ELISA.

Periodic acid-Schiff (PAS) staining was done on day 16 and day 18 control (Ctrl) and stable CIDEB knockdown (CIDEB^KD) DHH/HLCs using a commercial kit (Sigma-Aldrich, MO) according to the instructions provided by the manufacturer. Albumin enzyme-linked immunosorbent assay (ELISA) was performed with a human albumin ELISA kit (Bethyl Laboratories, TX), according to the manufacturer's instructions.

RNA interference and cDNA rescue.

A HIV-based lentiviral vector was used to express short hairpin RNAs (shRNAs). The mRNA target sequences were as follows: sh-CIDEA, 5′-AAC ACG CAU UUC AUG AUC UUG -3′; sh-CIDEB, 5′-AAA GUA CUC AGG GAG CUC CUU-3′; RNA duplex si-CIDEB (small interfering RNA targeting CIDEB), 5′-GAU UCA CCU UUG ACG UGU A -3′. Stable cell lines expressing shRNAs were obtained by selection with 1.2 μg/ml (for Huh-7.5 cells) or 0.6 μg/ml (for WA09 cells) puromycin for 3 weeks. The sh-CIDEB-resistant cDNA contained the following sequences at the small interfering RNA (siRNA) target site: 5′-AAA GTc CTg cGc GAa CTC CTT -3′. Lowercase letters represent silent mutations in the targeted sequence, without changing the protein sequence.

Electroporation of viral RNAs.

Viral J6/JFH-1/Gaussia luciferase (G-Luc) RNAs were in vitro transcribed using a Megascript T7 kit (Ambion, TX) and purified by phenol-chloroform extraction. RNA (5 to 10 μg) was electroporated into 4 × 10⁶ cells in a volume of 400 μl using a Gene Pulser Xcell Electroporation System (Bio-Rad, CA). For replication kinetics analyses, the culture medium was changed at 4 h postelectroporation, and at the indicated times, 100 μl of supernatant was collected for assessment of Gaussia luciferase activity using a luciferase assay system (Promega, WI).

HCVcc and HCVser infections.

A JFH-1-based HCVcc [(JFH1/Ad16)] was kindly provided by Guangxiang Luo, and a high-titer stock was produced in Huh-7.5 cells as previously described (39). HCV genotype 1b serum with an RNA titer of 1.8 × 10⁶ copies/ml (HCVser) was obtained from a commercial supplier (Teragenix, FL). Infection of DHH/HLCs and Huh-7.5 cells was performed as previously described (30). For the infection time course, cells were incubated with virus at 4°C for 2 h with gentle shaking and then shifted to 37°C after thorough but gentle washing with PBS. At the indicated times (except for 0 h), the cells were trypsinized and then washed by PBS to remove surface-bound virions. The cell pellets were then subjected to RNA extraction or Western blot analysis. For the 0-h sample, cells were washed with PBS and collected with TRIzol reagent, and cell RNA was extracted.

GFP-VSV and WNV infection.

WNV (strain NY-99) was obtained from Robert Tesh (University of Texas Medical Branch), and a stock virus pool was produced in BHK WI2 cells. Infection was detected by Western blotting using goat anti-WNV NS3 antibody (R&D System). Green fluorescent protein (GFP)-vesicular stomatitis virus (VSV) was kindly provided by Fanxiu Zhu (Florida State University) and amplified in HeLa cells. Infection was assessed by fluorescence microscopy.

HCVpp production and infection.

HCVpp were produced in 293-FT cells as previously reported (38). The cells were pretreated with 10 μg/ml of anti-CD81 antibody for 4 h and then infected with HCVpp supplemented with the same antibody at a final concentration of 10 μg/ml. Infectivity titers were determined at 72 h postinfection using a firefly luciferase assay system (Promega, WI).

Membrane fusion assay using DiD-labeled JFH-1 HCVcc.

The HCV fusion assay was performed as previously described (14). Briefly, high-titer HCVcc was labeled with DiD (Invitrogen, NY) according to the manufacturer's instructions. DiD-HCVcc particles were then purified by density gradient centrifugation before being used for infection. Cells grown on coverslips in 12-well cell culture plates were infected with DiD-HCVcc. Fusion spots were counted from multiple representative fields under a Zeiss 510 confocal fluorescence microscope.

Generation of CIDEB knockout 7.5 cells (CIDEB^KO) by TALEN.

Transcription activator-like effector nuclease (TALEN) constructs were purchased from Cellectis (Paris, France) and designed to target exon 3 of the human CIDEB genomic locus, which contains the start codon. The sequences of the DNA binding regions of the TALEN constructs are available upon request. Huh-7.5 cells in 6-well plates were cotransfected with TALEN- and GFP-expressing plasmids according to the manufacturer's instructions. The cells were maintained at 37°C and 5% CO₂ and then collected 48 h posttransfection and resuspended in PBS containing 5% fetal bovine serum (FBS). GFP-positive cells were enriched by fluorescence-activated cell sorting, followed by a recovery period in medium containing 20% FBS. Single-cell clones were generated by serial dilution in 96-well plates and analyzed for CIDEB expression by Western blotting. Single-cell clones negative for CIDEB expression were analyzed by DNA sequencing to confirm insertions or deletions in the TALEN-targeted region of the CIDEB gene.

Quantitative real-time PCR (qRT-PCR).

For cellular mRNAs, cDNA was produced from 500 to 1,000 ng total RNA, using poly(dT) and an Invitrogen Superscript III first-strand kit according to the manufacturer's instructions. The same procedure was used for HCV RNAs, except that gene-specific primers were used (HCV NS3-RT, GGGTCCAGGCTGAAGTCGAC). Quantitative PCR was performed using an Applied Biosystems 7500 Fast real-time PCR system, with Invitrogen SYBR green PCR master mix and gene-specific primers (NS3-Rev, CGGGATGGGGGGTTGTCACTG, and NS3-Fwd, CTACCTCCATTCTCGGCATCGG; GAPDH-Rev, GGATGACCTTGCCCACAGC, and GAPDH-Fwd, TCACTGCCACCCAGAAGACTG) at 0.5 μM each in a 20-μl reaction mixture. A 60°C to 95°C melt curve analysis following PCR was performed using default settings. For CIDEB mRNAs, relative quantitation was performed using the ΔΔC_T method with GAPDH as the endogenous control. For HCV RNA quantitation, a similar method was used, and the relative fold change was calculated by normalizing to control, uninfected cells.

Statistical analysis.

qRT-PCR data were calculated into relative fold change based on C_T (cycle threshold) values. Data are presented as means ± standard deviations (SD) and are either the average of data from three independent experiments or as indicated in a figure legend. The Student t test was used for statistical analysis of the data. A P value of <0.05 was considered significant, and P values of <0.01 and <0.001 were considered highly significant.

RESULTS

CIDEB expression is induced during hepatic differentiation and is required for HCV infection of hepatocyte-like cells.

We recently identified a transition stage during the hepatic differentiation process (days 7 to 11 postdifferentiation) when the cells became permissive for HCV infection (30). A liver-specific gene, encoding CIDEB, was among the genes that were upregulated at the RNA level during the differentiation process (data not shown). The CIDEB gene has been recently reported to be upregulated by human serum treatment of hepatoma cells (40), which may promote the differentiation of these cells. In addition, CIDEB is associated with lipid droplets and may interact with HCV NS2. We chose CIDEB for further studies based on these considerations. Consistent with the observation by Phan et al., we were unable to detect an interaction between CIDEB and NS2 in HCV-infected Huh-7.5 cells (data not shown). We did, however, observe a steady increase in the expression of CIDEB during the differentiation process. The CIDEB protein became detectable by Western blotting around day 7 and approached the level in the hepatoma cell line Huh-7.5 around day 11 (Fig. 1A). We then analyzed whether induction of CIDEB was required for the transition to HCV permissiveness. A lentivirus shRNA directed at CIDEB mRNA was transduced into the human pluripotent stem cell line WA09 to produce a stable cell line which, upon differentiation, produced DHH/HLCs with reduced CIDEB expression (DHH/CIDEB^KD) (Fig. 1B). We subjected the day 11 DHH/HLCs to infection by JFH-1-based HCVcc or virions derived from an HCV genotype 1b patient serum. Knockdown of CIDEB effectively inhibited infection of DHH/HLCs by both HCVcc and serum-derived HCV (Fig. 1B and C). The CIDEB knockdown cells retained their ability to store glycogen (Fig. 1D) and to secrete albumin (Fig. 1E), which are two representative indicators of hepatic functions. These results indicate that the inability of these DHH/HLCs to support HCV infection was due to CIDEB knockdown rather than to general defects due to hepatocyte differentiation or in hepatic functions.

FIG 1.

CIDEB is required for HCV infection of DHHs. (A) Expression of CIDEB protein increased during the hepatic differentiation process. D, day. (B and C) Knockdown of CIDEB in DHHs suppressed infection by HCVcc (B) and by HCV patient serum (C). Modified WA09 cells (sh-Ctrl and sh-CIDEB) were subjected to hepatic differentiation and at day 11 postdifferentiation were infected by HCVcc (multiplicity of infection [MOI] = 1) or HCVser (MOI = 0.5 RNA copy) for 4 to 6 h and cultured for another 48 h before being collected for detection of infection by Western blotting or qRT-PCR. The values represent means ± SD; n = 2 independent experiments. **, P < 0.01. GT, genotype. (D) Glycogen storage in DHH/Ctrl and DHH/CIDEB^KD cells. DHHs collected at day 16 postdifferentiation were fixed for periodic acid-Schiff staining, and cell images were taken with a 10× objective. (E) Albumin secretion by DHH/Ctrl and DHH/CIDEB^KD cells. Cell culture media were harvested from day 16 and day 18 DHHs and analyzed by albumin ELISA. The data were normalized to DHH/Ctrl cells at day 16, and the values represent means ± SD; n = 3 independent experiments.

The C-terminal domain of CIDEB is required for HCV infection in vitro.

To facilitate mechanistic studies, we next analyzed whether CIDEB is required for HCV infection of Huh-7.5 cells. Transient knockdown of CIDEB by shRNA produced Huh-7.5 cells that were less permissive to HCV infection, in accordance with results obtained with the DHH/HLCs. In contrast, knockdown of the transglutaminase 2 (TGM-2) gene, another gene detected by our microarray analysis as being highly upregulated at the transition stage (30), had no effect on HCV infection, nor did an shRNA directed at CIDEA mRNA (Fig. 2A). In addition, the inhibitory effect of CIDEB shRNA in Huh-7.5 cells was recapitulated by siRNA duplexes that targeted a different region of the CIDEB mRNA (Fig. 2B). To further rule out possible off-target effects of the CIDEB shRNA, we investigated whether viral infection could be rescued in Huh-7.5/CIDEB^KD cells by restoration of CIDEB expression. Coexpression of a full-length CIDEB cDNA containing silent mutations in the shRNA-targeted site but not of a truncation mutant with a C-terminal domain deletion partially rescued HCV infection (Fig. 2C). Inhibition of HCV infection was also observed in two independently generated stable Huh-7.5/CIDEB^KD cell lines (Fig. 2D). Collectively, these results indicate that CIDEB is required for HCV infection of both stem cell-derived DHH/HLCs and Huh-7.5 cells and that the C-terminal domain of CIDEB, which differentiates the CIDE proteins from the DFF family of proteins, is required for CIDEB's proviral function.

FIG 2.

CIDEB knockdown inhibits HCVcc infection of Huh-7.5 cells. (A) Transduction of Huh-7.5 cells with a CIDEB-directed shRNA suppressed CIDEB expression and HCV infection. Huh-7.5 cells were transduced with lentiviral vectors targeting luciferase, CIDEA, CIDEB, or TGM2. Four days after transduction, the cells were challenged with HCVcc, and viral infections were analyzed by Western blotting at 24 h postinfection. (B) A synthetic siRNA duplex that targets a different site on CIDEB mRNA than the shRNA inhibited infection. Huh-7.5 cells were transfected with duplex siRNA and then infected with HCVcc at 48 h posttransfection. Infected cells were then harvested for detection of HCV NS3 and CIDEB by Western blotting at 24 h postinfection. (C) Rescue of HCV infection by full-length CIDEB cDNA that contained silent mutations in the shRNA-targeted site. Huh-7.5 cells were first transduced with lentiviral vectors targeting luciferase, TGM2, or CIDEB for 4 days and then transfected with an expression plasmid containing the indicated cDNA. At 16 h posttransfection, the cells were infected with HCVcc, and infected cells were collected 20 h later for the detection of viral infection. The C-terminally truncated cDNA of CIDEB also lacks the shRNA target site (CIDEB 517 to 537). HA-CIDEB*, shRNA-resistant HA-tagged CIDEB; CIDEB (endo), endogenously expressed CIDEB. (D) Huh-7.5 cell lines with stable CIDEB knockdown were less susceptible to HCV infection. Huh-7.5 cells were transduced with lentiviral vectors targeting CIDEB, followed by puromycin selection for 2 weeks. Two independently generated cell lines (#01 and #03) were infected with HCVcc for 24 h and then harvested for the detection of viral infection by Western blotting. All HCVcc infections were done at an MOI of 5.

CIDEB functions early during the HCV infection cycle, prior to viral protein translation and RNA replication.

We next investigated the specific step during the HCV infection cycle that was inhibited by knockdown of CIDEB. Comparison of infection time courses in control cells expressing an shRNA directed at firefly luciferase (Huh-7.5/Ctrl) and stable CIDEB knockdown cells (Huh-7.5/CIDEB^KD) revealed that reduction of HCV RNA signal began in the knockdown cells between 12 and 16 h after infection. A similar reduction time course was observed in cells with knockdown of a known HCV entry factor, claudin 1 (Huh-7.5/CLDN1^KD) (Fig. 3A). HCV proteins could not be detected at 8 h and 12 h postinfection of Huh-7.5/CIDEB^KD cells, while they were readily detectable in the wild-type cells at these time points, indicating suppression or delay of protein expression caused by CIDEB knockdown (Fig. 3B, top). The difference in time points at which the RNA or proteins were affected suggested that CIDEB knockdown did not affect RNA internalization but blocked a step prior to viral protein translation. Interestingly, HCV protein expression was not affected by CIDEB knockdown if the HCV RNA was introduced into Huh-7.5/Ctrl and Huh-7.5/CIDEB^KD cells by electroporation for up to 24 h after transfection (Fig. 3B, bottom), indicating that the role of CIDEB in the HCV life cycle is specific to a virion-mediated early step. Consistent with the above-mentioned results, the replication kinetics of a full-length J6/JFH-based genome in Huh-7.5/CIDEB^KD cells, as measured by expression of the reporter gene (Gaussia luciferase) inserted into the genome, was also comparable to that in Huh-7.5/Ctrl cells when the RNA genome was introduced by electroporation (Fig. 3C). In contrast, knockdown of cyclophilin A, a cellular cofactor required for HCV replication (41–43), efficiently suppressed replication after both infection and viral RNA electroporation. Importantly, performing a mock electroporation prior to infection did not affect the inhibition of infection by CIDEB knockdown (Fig. 3D), indicating that the electroporation process did not simply eliminate CIDEB^KD cells. We conclude from these results that CIDEB is not required for the initial translation of input RNA or subsequent RNA replication.

FIG 3.

CIDEB acts at an early step of the HCV infection cycle. (A) Time course analysis of HCV infection in control, CIDEB^KD, and CLDN1^KD cells. The viral inoculum was added to cells at −2 h at 4°C, and the cells were shifted to 37°C at 0 h after extensive washing. At the indicated times (with the exception of the 0-h samples), cells were trypsinized and then washed to remove surface-bound virions. For the 0-h samples, cells were collected without trypsinization for the detection of virions bound to the cell surface prior to entry. The data were normalized to the value obtained for the control cells at −2 h, and the values represent means ± SD; n = 3 independent experiments. **, P < 0.01. (B) Core expression from viral RNA delivered by infection or transfection in control and CIDEB^KD cells. The cells were either infected with HCVcc or electroporated with JFH1 RNA. Total cell lysates were collected at the indicated times after the addition of virus (top) or electroporation (bottom) and subjected to Western blotting. (C) Intracellular replication of transfected HCV RNA in control, CIDEB^KD, and CyPA^KD cells. At the indicated times after electroporation with wt or replication-deficient (GND) Jc1 G-Luc RNA, cell culture media were collected for luciferase assay. The values represent means ± SD; n = 3 independent experiments. All HCVcc infections were done at an MOI of 30. (D) Infection of CIDEB^KD cells were still suppressed after a round of mock electroporation. Ctrl and CIDEB^KD cells were mock electroporated and cultured for 40 h before HCVcc was used to infect the recovered cells. Detection of NS3, GAPDH, and CIDEB was done at 8 and 12 h postinfection.

CIDEB knockdown does not affect virion attachment, RNA replication, or virion production.

To investigate whether CIDEB is involved in HCV binding to the cell surface, we determined the effect of CIDEB knockdown on viral attachment. HCVcc particles were incubated with Huh-7.5/Ctrl and Huh-7.5/CIDEB^KD cells for 2 h at low temperature to allow binding but prevent entry. After extensive washing, the amount of virus bound was determined by qRT-PCR with HCV-specific primers. The level of virion binding to Huh-7.5/CIDEB^KD cells was comparable to that to Huh-7.5/Ctrl cells (Fig. 4A). To determine whether CIDEB is important for sustained HCV RNA replication, shRNAs directed at CIDEA, luciferase, or CIDEB mRNA were introduced into a stable subgenomic replicon cell line harboring an NS5A-GFP fusion (44). Knockdown of CIDEB did not affect subgenomic RNA replication, as measured by NS5A-GFP expression (Fig. 4B). Furthermore, knockdown of CIDEB did not affect the establishment of persistent RNA replication by subgenomic RNAs of various genotypes in Huh-7.5 cells, as measured by a colony formation assay (Fig. 4C). These results further confirmed that CIDEB is not important for HCV RNA replication in Huh-7.5 cells.

FIG 4.

CIDEB knockdown does not affect virion attachment, RNA replication, and virion production. (A) HCV attachment is not affected by CIDEB knockdown. Control and CIDEB^KD cells were exposed to HCVcc (MOI = 30) at 4°C for 2 h with gentle shaking and then harvested for analysis of viral RNA using qRT-PCR. The data were normalized to the value obtained for control cells without HCVcc exposure. Heparin (75 μg/ml)-treated cells were used as a positive control for inhibition of virus binding (65). The values represent means ± SD; n = 2 independent experiments. (B) CIDEB is not required for RNA replication of HCV replicons. A genotype 1b NS5A-GFP replicon GS5 was transduced with lentiviral vectors targeting luciferase, CIDEA, or CIDEB, and 4 days later, cells were fixed and analyzed by fluorescence microscopy. DAPI, 4′,6-diamidino-2-phenylindole. (C) Stable CIDEB^KD cells supported efficient colony formation by subgenomic replicons of genotypes 1a (H77), 1b (Con1), and 2a (JFH-1). (D) Diagram of the experimental design. Jc1 G-Luc RNA (a full-length HCV genomic RNA containing the Gaussia luciferase gene) was electroporated into both Huh-7.5/Ctrl and Huh-7.5/CIDEB^KD cells, and supernatants collected from the electroporated cells at the indicated times postelectroporation were labeled as Ctrl and CIDEB^KD viruses, respectively. (E and F) The amounts of core proteins in the supernatants were determined with an HCV Core ELISA kit (OrthoDiagnostics) (E) and were used to normalize the inocula used to infect naive Huh-7.5 cells (F). G-Luc activity was measured in the infected cells 48 h after infection. The 0-h supernatant was collected immediately after PBS washes, and the data represent the residual signal from the original inoculum. The values plotted are means ± SD; n = 3 independent experiments. (G and H) LD staining and quantification in Huh-7.5/Ctrl and Huh-7.5/CIDEB^KD cells. Representative images of Bodipy 530/550 staining are shown, and the size and the mean fluorescence intensity of LDs were quantified through the particle-analyzing function of ImageJ software (NIH). **, P < 0.01.

Because CIDEB associates with both intracellular membranes and LDs (45) and LDs have been reported to be the site of HCV assembly (46), we tested the possibility that CIDEB participates in the production of viral particles. HCV RNA was electroporated into both Huh-7.5/Ctrl and Huh-7.5/CIDEB^KD cells, and the culture supernatants at 48 h and 96 h posttransfection were collected for measurement of virus production (Fig. 4D). The total amounts of core secreted into the supernatants of the control and the KD cells were comparable (Fig. 4E). In addition, when reinfection experiments were performed, supernatants collected from Huh-7.5/CIDEB^KD cells showed no significant reduction in virus titers compared to those harvested from Huh-7.5/Ctrl cells (Fig. 4F). We observed that in the Huh-7.5 cells, CIDEB knockdown reduced both the number and the mean intensity of neutral lipid staining of the LDs (Fig. 4G and H); nevertheless, neither core secretion nor infectivity appeared to be affected. Taken together, these results demonstrate that inhibition of HCV infection by the CIDEB shRNA was not due to defects in viral attachment, viral RNA translation, viral RNA replication, or viral particle production.

CIDEB is required for HCV membrane fusion.

CIDEB may participate in the HCV life cycle in a step that occurs postattachment but before initial RNA translation, such as membrane fusion. To investigate whether CIDEB is required for fusion between the HCV envelope and the host membrane, we used a virus-host membrane fusion assay that takes advantage of a self-quenching lipophilic dye, DiD (14, 47). HCVcc particles were labeled and purified as previously reported (14) and then used to infect Huh-7.5/Ctrl cells. Punctate fusion signals became detectable around 2 h postbinding, and the number of puncta increased over the next 4 h (Fig. 5A). The detected punctate signals colocalized with endosome markers (Fig. 5B), where HCV membrane fusion occurs (48). Pretreatment of cells with various entry inhibitors (an anti-CD81 antibody, a small-molecule inhibitor of SRBI ITX-5061, or anti-ApoE) all effectively inhibited the punctate signals at 6 h postbinding (Fig. 5C). In addition, punctate signals were also significantly reduced when NH₄Cl, an inhibitor of endosomal acidification and pH-dependent membrane fusion, was added to the media of virus-bound Huh-7.5 cells prior to the temperature shift (Fig. 5C). Collectively, these results indicated that the punctate signals detected resulted from productive fusion between the endosomal membrane and the viral envelope. When DiD-labeled HCV particles were incubated with Huh-7.5/CIDEB^KD cells, the number of puncta detected at 6 h was reduced by greater than 70% compared to the number detected in Huh-7.5/Ctrl cells (Fig. 5D). As expected, knockdown of cyclophilin A (Huh-7.5/CyPA^KD) had no effect on virus fusion efficiency. These results suggest that CIDEB is functionally important at or before the membrane fusion step that is required for HCV RNA to escape from the endocytic vesicles and become available as a template for translation and replication.

FIG 5.

HCV entry and membrane fusion are inhibited in CIDEB^KD cells. (A) The fusion spots of DiD-labeled HCVcc increased over time after initiation of cell entry by a temperature shift. Control cells were exposed to DiD-labeled HCVcc (MOI = 20) at 4°C for 2 h and then washed and shifted to 37°C to initiate internalization. At the indicated times, cells were fixed for fluorescence microscopy. The average number of spots per 100 cells was calculated, and the values shown represent means ± SD; n = 3 independent experiments. p.t.s., post-temperature shift. (B) Colocalization of DiD fusion signals with the endosome marker Rab5. Control cells were treated as indicated for panel A. At 4 h postbinding, cells were fixed and stained with anti-Rab5 antibody (green). The arrows indicate colocalization between DiD signal and Rab5. The boxed area in the middle image is enlarged on the right. (C) The DiD HCV fusion signal was sensitive to pH perturbation and HCV entry inhibitors. The numbers of DiD signals at 2 and 6 h after the temperature shift were determined. NH₄Cl was added to the medium at a final concentration of 20 mM; anti-ApoE (at a final concentration of 50 μg/ml) was incubated with virus for 2 h, and the entry inhibitors (anti-CD81 at 10 μg/ml and ITX-5061 at 1 μM) were incubated with cells for 2 h before the temperature shift. The number of DiD signals was determined and normalized to the value obtained for DMSO (dimethyl sulfoxide)-treated cells at 2 h. The values are the relative fold change and represent means ± SD; n = 2 independent experiments. *, P < 0.05. (D) HCV fusion was inhibited in CIDEB^KD but not in CyPA^KD cells. Experiments were performed as indicated for panel A. Medium from Huh-7.5 cells cultured for 48 h was processed using the same DiD labeling procedure and used as the control background fluorescence signal. The data represent the average number of spots per 100 cells (means ± SD; n = 3 independent experiments). *, P < 0.05; ***, P < 0.001.

CIDEB is not required for infection of Huh-7.5 cells by WNV or VSV.

We next investigated whether CIDEB is also important for infection by other RNA viruses. WNV and VSV, both of which efficiently infect Huh-7.5 cells, were studied. Expression of WNV NS3 was comparable in Huh-7.5/CIDEB^KD cells and in Huh-7.5 parental cells following infection (Fig. 6A). Yields of extracellular WNV were also not significantly affected by CIDEB knockdown (Fig. 6B). Similar results were obtained for VSV (Fig. 6C) and an HIV pseudotype bearing VSV glycoprotein (VSV-G) (Fig. 6D, right). Interestingly, the entry of HIV particles pseudotyped with HCV glycoproteins (HCVpp) was also not inhibited by CIDEB knockdown (Fig. 6D, left), while blocking CD81 or suppression of CLDN1 expression inhibited HCVpp entry as expected.

FIG 6.

CIDEB knockdown does not affect infection by WNV, GFP-VSV, or HIV-based pseudotyped viruses. (A) CIDEB knockdown in Huh-7.5 cells did not suppress WNV NY99 infection. Huh-7.5/Ctrl and Huh-7.5/CIDEB^KD cells in 6-well plates were infected with WNV NY-99 at an MOI of 1. At the indicated times after infection, cells were lysed with RIPA buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 0.1% SDS, and 1% NP-40), and intracellular viral protein was detected by Western blotting using anti-WNV NS3 antibody. (B) CIDEB knockdown in Huh-7.5 cells did not inhibit the production of WNV. Confluent monolayers of Huh-7.5/Ctrl and Huh-7.5/CIDEB^KD cells in 6-well plates were infected with WNV strain NY-99 (MOI = 1) for 30 min at 37°C and washed 3 times with medium, and 2 ml of medium was added per well. Aliquots of culture fluid harvested from duplicate wells at 8, 10, 16, 24, 32, and 48 h after infection were assayed for infectivity by plaque assay on BHK cells (66). (C) Efficient infection of the CIDEB^KD cells by a GFP-tagged VSV. Huh-7.5/Ctrl and Huh-7.5/CIDEB^KD cells were infected with GFP-VSV (MOI = 1) and then fixed and processed for fluorescence microscopy at the indicated time postinfection (p.i.). (D) HCVpp and VSV-Gpp infection of CIDEB^KD cells. Huh-7.5/Ctrl, Huh-7.5/CIDEB^KD, and Huh-7.5/CLDN1^KD cells were infected with HIV-luciferase particles pseudotyped with HCV E1/E2 or VSV-G. Firefly luciferase activities were measured 72 h postinfection. The values of HCVpp and VSV-Gpp infection in control cells were normalized to 100% for each of the respective pseudotypes. Anti-CD81 antibody was added at a final concentration of 10 μg/ml 4 h before infection and then maintained throughout the experiment. The values are the relative percentages over that for infection in control cells and represent means ± SD; n = 2 independent experiments. **, P < 0.01; ***, P < 0.001.

CIDEB knockout blocks HCV infection in vitro.

As RNA interference only suppresses but does not abolish gene expression, we used TALEN to create CIDEB knockout cell lines to further demonstrate the functional requirement for CIDEB in HCV infection. We designed a pair of TALENs targeting the first coding exon (exon 3) of the CIDEB gene (Fig. 7A) and then delivered the TALEN-expressing plasmids into Huh-7.5 cells, followed by single-cell cloning using published procedures (49, 50). Western blotting was used to identify CIDEB knockout clones. Four out of 16 clones analyzed had no detectable CIDEB signal on Western blots, indicating complete gene knockout (Fig. 7B). We selected clone 3 for infection with HCVcc. DNA sequencing revealed that there were three copies of the CIDEB gene in these Huh-7.5-based cells, and all three contained an insertion that, albeit different in each copy, created frameshifts and introduced premature stop codons (data not shown). HCV infection was blocked in these cells (Fig. 7C). Inhibition of infection in the knockout cells was first detected between 12 and 16 h postinfection (Fig. 7D), the same time observed in the knockdown cells (Fig. 3A). As expected, the extent of inhibition of HCV infection in the knockout cells was greater than that in the knockdown cells (Fig. 7D versus 3A). In contrast, neither VSV nor WNV infection was significantly inhibited in CIDEB knockout cells (Fig. 7E and F). These data demonstrate that CIDEB is dispensable for cell survival but specifically required for HCV infection.

FIG 7.

Knockout of CIDEB blocks HCV infection in cell culture. (A) Schematic representation of TALEN constructs targeting the genomic sequence immediately downstream of the CIDEB start codon, located in exon 3. (B) Knockout of CIDEB by TALEN. Four of the 16 clones analyzed had no detectable CIDEB Western blot signal. (C) Inhibition of HCV infection by CIDEB knockout in Huh-7.5 cells. Wild-type and CIDEB^KO-003 cells were infected with HCVcc (MOI = 5), and cell lysates prepared at the indicated times postinfection were used to detect HCV NS3 expression by Western blotting. (D) Comparison of the time course of HCV infection in wild-type and CIDEB^KO cells. Experiments were performed as described in the legend to Fig. 3A. The data were normalized to the value for wild-type cells obtained at −2 h and represent means ± SD; n = 2 independent experiments. **, P < 0.01. (E) GFP-tagged VSV efficiently infected CIDEB^KO cells. Experiments were carried out as described in the legend to Fig. 6C. Representative images are shown. (F) Knockout of CIDEB does not affect WNV infection. Control and CIDEB^KO-012 cells were infected with WNV NY-99 (MOI = 1) for 24 h, fixed, permeabilized, and incubated with an anti-dsRNA antibody to detect sites of viral RNA replication. Hoechst 33342 dye (Invitrogen) was used to detect nuclei. The images were acquired with an inverted fluorescence microscope (Zeiss 510) using a 100× oil immersion objective.

HCV infection downregulates CIDEB at the protein level.

We observed a significant reduction in intracellular CIDEB protein levels in HCV-infected cells starting approximately 24 h postinfection (Fig. 8A), whereas CIDEB mRNA was actually slightly upregulated in infected cells (Fig. 8B), indicating that downregulation of CIDEB occurs at the posttranscriptional level. To investigate whether infection per se is required for the downregulation, we also electroporated Huh-7.5 cells with HCV genomic RNA and then determined CIDEB protein levels 24 h or 48 h later. Two wild-type (wt) genomes (JFH-1 and wt G-Luc) expressed HCV proteins (NS3 is shown) and decreased CIDEB protein levels as early as 24 h (Fig. 8C). The polymerase mutant GND, which carries a defective replicase, was not able to replicate or express any detectable HCV protein and did not affect CIDEB protein levels.

FIG 8.

Downregulation of CIDEB protein by HCV infection. (A) CIDEB protein levels were reduced in HCV-infected cells. Huh-7.5 cells were exposed to HCVcc (MOI = 10) at 4°C for 2 h and then shifted to 37°C to initiate infection. Cell lysates were prepared at the indicated times postinfection and used to detect viral infection and CIDEB expression by Western blotting. (B) CIDEB mRNA is not downregulated by HCV infection. Experiments were carried out as described for panel A, except that the cells were subjected to RNA extraction and qRT-PCR was used to analyze CIDEB mRNA levels. (C) CIDEB was downregulated by active viral RNA replication. Huh-7.5 cells were electroporated with replication-competent (JFH1 and G-Luc wt) or defective (GND) genomes. At the indicated times, the cells were lysed and analyzed by Western blotting. The GND mutant contained mutations in the RNA-dependent RNA polymerase gene that abolished replication and cumulative protein expression.

DISCUSSION

Studying the molecular determinants of the transition of cells into a permissive state for viral infections during directed differentiation is a novel approach for identifying host factors contributing to viral tropism. The identification of a new entry cofactor for HCV in the present study represents a proof of concept for this approach. Our demonstration that HCV-resistant DHH/HLCs could be produced in vitro by coupling genetic modification of stem cells with hepatic differentiation has implications for the clinical utility of stem cell-based therapy.

Although the mechanism by which CIDEB facilitates HCV entry remains unclear at this time, it appears to be distinct from those of many of the previously reported entry cofactors. Overall, our data point to a late step of the viral entry process at which CIDEB functions. The RNA time course data suggest that internalization is not affected, but we cannot rule out other steps of the endocytic pathway, such as trafficking of the endosomes to the proper site for membrane fusion and uncoating. The membrane topology of CIDEB (i.e., it is associated with the cytosolic side of the intracellular vesicular membranes) argues against a direct interaction between CIDEB and the HCV glycoproteins displayed on the incoming virions. On the other hand, the observation that CIDEC/Fsp27 is located at junctions between connecting LDs and facilitates fusion of the LD membranes (24, 25) suggests the intriguing possibility that CIDEB can participate in a similar hemifusion event that is part of a virus-uncoating process. In any case, since we did not detect any redistribution of CIDEB to plasma or endosomal membranes upon HCV infection, the presence of another transmembrane protein that bridges an interaction between CIDEB and HCV glycoproteins would be necessary. The effect of CIDEB on HCV entry could also be indirect. Note that CIDEB is not required for the entry of HCVpp, a surrogate system that largely recapitulates the HCV entry requirement for glycoproteins and cellular cofactors. The NPC1L1 protein is another HCV entry cofactor that is not required for HCVpp entry (14), and given the association between lipids and both CIDEB and NPC1L1, it is possible that these proteins act by altering the lipid content of either viral or cellular membranes. We have indeed observed an inhibitory effect of CIDEB knockdown on the number and size of LDs in Huh-7.5 cells and will follow up the intriguing possibility that this organelle may participate in virus entry.

An interaction between CIDEB and HCV NS2 identified by a yeast two-hybrid screen was previously reported (28). However, a more recent study by Phan et al. (29) could not detect this interaction in infected cells. Our results are consistent with those of Phan et al., since we also could not detect any interaction between NS2 and CIDEB in either 293FT or Huh-7.5 cells cotransfected with these proteins (data not shown). It was somewhat surprising that CIDEB knockdown had no effect on HCV particle production, given the association of CIDEB with LDs, which have been reported to be the sites of HCV virion assembly (46). However, the localization of HCV core on the surfaces of LDs is not universally required for producing high-titer HCVcc (51), and a potential role of LDs in viral entry was suggested by a recent study that demonstrated that depletion of sterol regulatory element binding protein 1 (SREBP-1) and SREBP-2 could inhibit both the formation of LDs and HCV infection in Huh-7.5 cells (52). The inhibition of HCV infection observed extended beyond suppression of viral assembly and suggested a reduction in viral entry, as well.

Because shRNAs do not completely abrogate the expression of a gene, a gene knockout system offers a more definitive answer about a host factor's function both in normal physiology and during viral infections. Meganucleases that combine the power of sequence-specific DNA binding with the ability to generate double-stranded breaks has emerged as an enabling technology of genome editing in human cells. They include zinc finger nuclease (50, 53, 54), TALENs (55–59), and the CRISPR-Cas9 system (60, 61). We used TALEN technology to generate CIDEB-knockout Huh-7.5 cells and confirmed the inhibition of HCV infection and the lack of a significant effect on WNV or VSV infections in these cells. Interestingly, a very low level of HCV infection was still detectable in the knockout cells after prolonged infection periods. The reason for this phenomenon is currently unknown but may be related to alternative infection cell entry routes, such as the one recently reported for HCV, which is mediated by exosomes secreted by infected cells (62).

HCV entry into (upon exogenous expression of claudin 1) and virus RNA replication in nonhepatic 293T cells have been reported (10, 63). Recently, the combination of expression of HCV receptors, microRNA-122, and ApoE has made these cells permissive for the full life cycle of HCV infection (64). Using antibodies that readily detected CIDEB in Huh-7.5 cells and DHH/HLCs derived from hepatic differentiation, we did not detect CIDEB expression in either parental 293T cells or the modified 293T cells that expressed miR-122 (64) by Western blotting (data not shown). In addition to the possibility that the entry pathway used by HCV is different in nonliver cells and does not require CIDEB, it is also possible that another related protein(s) functions in place of the liver-specific CIDEB.

Given the strong apoptotic effect of CIDEB protein when expressed at high levels, downregulation of CIDEB after infection may promote the survival of infected cells and contribute to the establishment of chronic infections. In this regard, it is interesting that the expression of HCV transgenes in mice also contributed to CIDEB downregulation by an adenovirus infection (28). The mode of action for the downregulation of CIDEB in the infected cells appears to be posttranscriptional, although the precise mechanism remains to be determined. Examples may include translational silencing and accelerated protein degradation.

In summary, we have identified a new HCV entry cofactor whose upregulation contributes to, although is not sufficient for, the hepatic tropism of HCV. CIDEB acts at a late step of viral entry and may, among other possibilities, facilitate fusion between HCV and endosome membranes. The identification of CIDEB adds to the list of cellular factors important for productive entry of HCV into hepatocytes and provides a starting point to investigate the potential role of LDs in viral entry and fusion.