Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2014 Aug;88(15):8421–8432. doi: 10.1128/JVI.01130-14

Blocking Herpes Simplex Virus 2 Glycoprotein E Immune Evasion as an Approach To Enhance Efficacy of a Trivalent Subunit Antigen Vaccine for Genital Herpes

Sita Awasthi 1, Jialing Huang 1, Carolyn Shaw 1, Harvey M Friedman 1,✉
Editor: L Hutt-Fletcher
PMCID: PMC4135967  PMID: 24829358

ABSTRACT

Herpes simplex virus 2 (HSV-2) subunit antigen vaccines targeting virus entry molecules have failed to prevent genital herpes in human trials. Our approach is to include a virus entry molecule and add antigens that block HSV-2 immune evasion. HSV-2 glycoprotein C (gC2) is an immune evasion molecule that inhibits complement. We previously reported that adding gC2 to gD2 improved vaccine efficacy compared to the efficacy of either antigen alone in mice and guinea pigs. Here we demonstrate that HSV-2 glycoprotein E (gE2) functions as an immune evasion molecule by binding the IgG Fc domain. HSV-2 gE2 is synergistic with gC2 in protecting the virus from antibody and complement neutralization. Antibodies produced by immunization with gE2 blocked gE2-mediated IgG Fc binding and cell-to-cell spread. Mice immunized with gE2 were only partially protected against HSV-2 vaginal challenge in mice; however, when gE2 was added to gC2/gD2 to form a trivalent vaccine, neutralizing antibody titers with and without complement were significantly higher than those produced by gD2 alone. Importantly, the trivalent vaccine protected the dorsal root ganglia (DRG) of 32/33 (97%) mice between days 2 and 7 postchallenge, compared with 27/33 (82%) in the gD2 group. The HSV-2 DNA copy number was significantly lower in mice immunized with the trivalent vaccine than in those immunized with gD2 alone. The extent of DRG protection using the trivalent vaccine was better than what we previously reported for gC2/gD2 immunization. Therefore, gE2 is a candidate antigen for inclusion in a multivalent subunit vaccine that attempts to block HSV-2 immune evasion.

IMPORTANCE Herpes simplex virus is the most common cause of genital ulcer disease worldwide. Infection results in emotional distress for infected individuals and their partners, is life threatening for infants exposed to herpes during childbirth, and greatly increases the risk of individuals acquiring and transmitting HIV infection. A vaccine that prevents genital herpes infection will have major public health benefits. Our vaccine approach includes strategies to prevent the virus from evading immune attack. Mice were immunized with a trivalent vaccine containing an antigen that induces antibodies to block virus entry and two antigens that induce antibodies that block immune evasion from antibody and complement. Immunized mice demonstrated no genital disease, and 32/33 (97%) animals had no evidence of infection of dorsal root ganglia, suggesting that the vaccine may prevent the establishment of latency and recurrent infections.

INTRODUCTION

The efficacy of the herpes simplex virus 2 (HSV-2) glycoprotein D (gD2) subunit antigen vaccine for prevention of genital herpes was evaluated in three large human trials (1, 2). In 2002, the first two trials reported that the gD2 vaccine prevented HSV-2 genital disease in HSV-1/HSV-2-seronegative women; however, this result was not reproduced in the 2012 Herpevac trial for women that showed gD2 vaccine efficacy in preventing genital disease caused by HSV-1 but not HSV-2 (1, 2). These results have created uncertainty about the best approach for the development of an effective prophylactic vaccine for genital herpes. Live-virus vaccines are being pursued and have the advantage of presenting a large number of antigens, which eliminates guesswork as to which antigens are most immunogenic, yet have the disadvantage of not targeting particular antigens that are critical for initiating infection (3–7). Other approaches have evaluated DNA plasmid vaccines, a prime-boost combination using plasmids and subunit antigens, or combinations of DNA and inactivated whole-virus vaccines (8–11).

Our subunit vaccine approach is intended to improve the immunogenicity and efficacy of a gD2-based subunit antigen vaccine by inducing potent immunity to three antigens, two of which prevent HSV immune evasion from antibody and complement. Complement C3 is the most abundant protein in the complement cascade. During activation of the complement cascade, C3 is cleaved to generate C3b, which leads to the activation of the membrane attack complex, which results in virus neutralization and lysis of infected cells (12, 13). The complement system serves as a critical link between innate and acquired immunity by stimulating B- and T-cell responses (14, 15). HSV-1 glycoprotein C (gC1) and glycoprotein E (gE1) and HSV-2 gC2 and gE2 are type 1 membrane glycoproteins, each with a large ectodomain comprising >400 amino acids that extends outward from the virion envelope or infected-cell surface. HSV gC1 and gC2 are immune evasion molecules that bind C3b to inhibit complement activation (16–20). In mice, gC1 is a virulence factor based on its ability to bind C3b (21). HSV gE1 and gE2 function as IgG Fc receptors (22, 23). We reported previously that gE1 inhibits activities mediated by the IgG Fc domain by a process described as antibody bipolar bridging (24). HSV-1 mutant strains that are defective in IgG Fc receptor activity are more susceptible to antibody and complement neutralization and antibody-dependent cellular cytotoxicity (ADCC) in vitro and less virulent in vivo because of increased susceptibility to complement and ADCC (25–27).

We demonstrated in mice that were passively immunized with gC1 monoclonal antibodies or actively immunized with gC1 subunit antigen that blocking gC1 immune evasion reduced the severity of infection (28, 29). The success of these studies led us to evaluate whether blocking immune evasion domains on gC2 improved the effectiveness of a bivalent HSV-2 subunit antigen vaccine consisting of gC2 and gD2. The bivalent vaccine provided better protection against vaginal HSV-2 infection in mice and guinea pigs than either single-subunit antigen alone (30). We now assess the benefit of adding gE2 to the vaccine formulation to induce antibodies that bind to gE2 and block its immune evasion properties.

Our approach of combining gD2 with immunogens that block antibody (gE2) and complement (gC2) immune evasion differs from those of others who immunized with combinations of glycoprotein subunit antigens involved in virus entry, including HSV-2 glycoprotein B (gB2), gD2, and glycoproteins H and L (gH2/gL2). Immunization with multiple antigens involved in virus entry failed to improve the protection provided by gD2 alone (31). We base our vaccine approach on the observation that most viral vaccines effective against mucosal infection, such as HSV-2, depend on antibodies for protection (32, 33). In addition, the gC2 and gE2 immune evasion molecules that we are targeting are expressed on the virion envelope and at the infected cell surface; therefore, they are accessible to blocking antibodies, while T-cell immune evasion molecules are located within infected cells and are difficult to access.

Many pathogens encode immune evasion molecules, but to date, no licensed vaccine has specifically targeted immune evasion molecules. Our results indicate that gE2 functions in synergy with gC2 to protect the virus from antibody and complement neutralization. The addition of gE2 to a gC2/gD2 subunit antigen vaccine provides strong protection against HSV-2 vaginal challenge, preventing death and genital disease, and a high level of protection to lumbosacral dorsal root ganglia (DRG), which serve as the site of HSV-2 latency. This degree of protection has not been reported previously, suggesting that blocking immune evasion may prove to be an effective vaccine strategy.

MATERIALS AND METHODS

Cells, virus strains, and growth curves.

Vero and COS cells were grown in Dulbecco's modified Eagle's medium containing 5% fetal calf serum. The wild-type (WT) and mutant HSV-2 strains were previously described, including HSV-2 WT strain 2.12; the HSV-2 2.12gE2-del mutant strain, in which gE2 amino acids 124 to 495 were replaced by the green fluorescent protein (GFP) gene under the control of a cytomegalovirus (CMV) promoter; and the HSV-2 2.12gCnull mutant, in which gC2 sequences from 1 bp prior to the ATG start site to 16 bp prior to the stop codon were replaced by the lacZ gene under the control of the HSV-1 ICP6 promoter (3, 34). A double mutant strain with deletions of both gC2 and gE2 protein-coding sequences was constructed by coinfection of Vero cells with HSV-2 2.12gE2-del and HSV-2 2.12gCnull, each at a multiplicity of infection (MOI) of 1. Recombinant viruses were plaque purified by staining monolayers in 12-well plates at 48 h with 300 μg/ml X-gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) for 12 to 24 h and picking blue (X-gal) and green (GFP) plaques under a fluorescence microscope. After 4 rounds of purification, a virus pool of the double mutant strain was prepared in Vero cells. DNA sequencing and Western blotting confirmed proper construction. For Western blot assays, purified virus stocks were prepared on a 10%-30%-60% sucrose step gradient (35). Single-step growth curves were performed in Vero cells at an MOI of 3. At 1, 4, 8, 16, and 24 h, cells and supernatant fluids were harvested, and virus titers were determined by a plaque assay on Vero cells (3).

Expression of gC2, gD2, and gE2 subunit antigens in baculovirus (bac).

Bac-gC2(426t) (gC2 subunit antigen) and bac-gD2(306t) (gD2 subunit antigen) express gC2 and gD2, respectively, derived from HSV-2 strain 333 and are truncated prior to the transmembrane domain (30, 36–38). Bac-gE2(24-405t) (gE2 subunit antigen) was prepared in pVT-bac by cloning HSV-2 strain 2.12 gE2 amino acids 24 to 405 with a six-histidine tag at the 3′ end prior to the stop codon. This cloning strategy replaces the gE2 signal peptide with the honeybee melittin signal peptide and truncates gE2 prior to the predicted transmembrane domain. The resulting plasmid was used to transfect Sf9 cells with Baculogold DNA to generate a recombinant baculovirus. To prepare purified gE2 subunit antigen, Sf9 cells were infected at an MOI of 4, supernatant fluids were purified on a nickel column and eluted with imidazole, and fractions containing gE2 subunit antigen were pooled, dialyzed, and concentrated by using a 10,000-molecular-weight (MW)-cutoff filter unit (Millipore) (38, 39).

Antibodies and human complement.

Human anti-HSV IgG (Talecris Biotherapeutics), mouse anti-His monoclonal antibody (MAb) (Qiagen), rabbit anti-GFP (Abcam), rabbit anti-LacZ (Millipore), and rabbit anti-actin (Abcam) were purchased. Antibody UP2151 to gC2 and antibody R265 to gE2 were prepared in rabbits by using 50 μg bac-gC2(426t) or bac-gE2(24-405t) administered with complete Freund's adjuvant for the first immunization and incomplete Freund's adjuvant for subsequent immunizations (Cocalico Biologicals). Animals were bled after the third immunization and after each subsequent immunization until titers plateaued, and animals were then terminally bled. Mouse and guinea pig anti-gD2 sera were obtained from animals immunized three times at 2-week intervals with bac-gD2(306t) administered with CpG and alum (30). GlaxoSmithKline (GSK) provided human anti-gD2 sera taken at month 7, which is 1 month after the third and final immunization. These sera were obtained from five subjects enrolled in a dose-ranging study using 20, 40, or 80 μg of gD2 with monophosphoryl lipid A (MPL) and alum (HSV-014) and from one subject immunized with 20 μg gD2 with MPL-alum to evaluate diluent volumes (HSV-015) (40). Human serum from an HSV-1/HSV-2-seronegative donor was the source of complement.

Synergy, neutralization, cell-to-cell spread, and ELISA.

Assays to detect synergy of gC2 and gE2 were performed by using 100 PFU of virus and various concentrations of human anti-HSV IgG and human complement in a checkerboard manner using 8 concentrations of antibody and 8 concentrations of complement (64 combinations of antibody and complement per virus) to detect the lowest concentration of antibody at each concentration of complement that reduced the virus titer by 50% (41). Neutralization assays to assess antibody bipolar bridging or the neutralizing activities of anti-gC2 and anti-gE2 sera were performed by using 5 to 6 log10 PFU of virus, a single dilution of antibody at 1:40, and 10% human serum from an HSV-1/HSV-2-seronegative donor as the source of complement (24, 26, 27). In synergy and neutralization assays, virus was incubated with antibody and complement for 1 h at 37°C prior to infection (27). Cell-to-cell spread assays were performed by infecting Vero cells with approximately 30 PFU of HSV-2 for 1 h and then adding a 1:40 dilution of rabbit anti-gE2, or preimmune rabbit serum as a control, in a methylcellulose overlay that prevented cell-free virus from spreading in the supernatant fluids (42). Plaque size was determined at 72 h by using an inverted light microscope fitted with an eyepiece micrometer (35). An enzyme-linked immunosorbent assay (ELISA) was used to assess antibody responses to bac-gC2(426t), bac-gD2(306t), or bac-gE2(24-405t) after immunization. Wells were coated with 100 ng of purified subunit antigen at 4°C overnight, blocked with 5% milk, and incubated with serial dilutions of serum for 1 h at room temperature, and bound antibody was detected by using horseradish peroxidase (HRP)-conjugated secondary antibodies and 2,2′-azinobis(3-ethylbenzthiazolinesulfonic acid) (ABTS) (Roche) (30). ELISA was used to detect binding of gE2 to nonimmune IgG. Wells were coated with 1 μg/ml of human or mouse IgG prepared by purification on a protein G column (Pierce), purchased guinea pig IgG (Santa Cruz Biotechnology), or 10% bovine serum albumin (BSA) at 4°C overnight; blocked with 5% milk; and incubated with 200 ng, 400 ng, or 800 ng bac-gE2(24-405t) or bac-gD2(306t) for 1 h at room temperature, and bound gE2 was detected by using R265 anti-gE2 or R122 anti-gD2 serum followed by HRP-conjugated donkey anti-rabbit IgG.

SDS-PAGE and Western blotting.

A total of 1 × 106 PFU of sucrose gradient-purified virus or 20 μg of cell lysate from infected Vero cells was resolved on 10% sodium dodecyl sulfate-polyacrylamide (SDS-PAGE) gels and transferred onto Immobilon-P membranes (Millipore), probed with antibodies, and detected by using HRP-labeled secondary antibodies and ECL reagent (Amersham, GE Healthcare) (35). Coomassie blue staining was performed according to the manufacturer's instructions (Bio-Rad).

Rosetting assay to detect IgG Fc receptor activity.

COS cells were infected with HSV-2 2.12 at an MOI of 2, and 17 h later, sheep erythrocytes coated with rabbit anti-sheep erythrocyte IgG (MP Biomedicals, Inc.) were added for 1 h at 37°C using a 100-to-1 ratio of erythrocytes to COS cells. A rosette was defined as four or more erythrocytes bound to an infected COS cell (43). To determine if antibody blocked rosetting, rabbit anti-gE2 IgG or rabbit nonimmune IgG was incubated with HSV-2-infected COS cells for 1 h at 37°C prior to the addition of antibody-coated erythrocytes (24).

Immunization, vaginal challenge, and genital disease scoring.

Laboratory animals were handled in accordance with the guidelines of the Institutional Animal Care and Use Committee of the University of Pennsylvania. Immunization studies were performed by using female BALB/c mice that were 8 to 9 weeks old at the time of the first immunization. The gC2, gD2, and gE2 subunit antigens were individually incubated with 50 μg of CpG oligonucleotide TCCATGACGTTCCTGACGTT (Coley Pharmaceutical) and 25 μg of alum per μg protein in a final volume of 50 μl (Alhydragel; Accurate Chemical and Scientific Corp.) and combined just prior to immunization. Mice were immunized intramuscularly (i.m.) at 2-week intervals in the gastrocnemius muscle. Mock immunizations were performed by using CpG and alum without antigen (30).

Five days prior to infection, mice were inoculated subcutaneously with 2 mg of medroxyprogesterone (Sicor Pharmaceuticals, Inc.). Immediately prior to infection, the vagina was cleared by using a sterile swab moistened with phosphate-buffered saline (PBS). Mice were observed for survival, and viral titers were obtained by swabbing the vagina at the indicated times postinfection. Each animal was swabbed at only one time postinfection, after which mice were euthanized to harvest DRG. Animals were scored daily for vaginal disease on a scale of 0 to 4 by assigning 1 point each for erythema, exudate, hair loss, and necrosis of genital tissues (4).

Real-time qPCR for determination of HSV-2 DNA copy numbers.

Mouse DRG samples were analyzed by using duplex quantitative PCR (qPCR) to amplify the HSV-2 Us9 gene and the mouse adipsin gene. Standard curves were prepared by using purified HSV-2 DNA (Advanced Biotechnologies) and mouse lung genomic DNA as the source of the adipsin gene (BioChain Institute) (30). The DRG HSV-2 DNA copy number was expressed as log10 DNA copies per 104 copies of the adipsin gene. Samples that did not yield a positive signal in duplicate wells by 40 cycles were considered negative.

Statistical analysis.

GraphPad Prism software was used to calculate P values. The Student t test was used for data in Fig. 2A and C and 5B and C; one-way analysis of variance (ANOVA) with Dunn's multiple-comparison test was used for data in Fig. 4C and 6C and D; the Mann-Whitney test was used for data in Fig. 5D, 6B, and 8E; the log-rank (Mantel-Cox) test for Kaplan-Meier curve comparison was used for data in Fig. 6A; two-way ANOVA with a Bonferroni test for multiple comparisons was used for data in Fig. 7A; and the Kruskal-Wallis test with Dunn's multiple-comparison test was used for data in Fig. 7B and C.

FIG 2.

FIG 2

HSV-2 gE2 functions as an IgG Fc receptor, as a purified protein, on infected cells and on the virus. (A) ELISA to evaluate binding of gE2 at 800 ng, 400 ng, 200 ng, or 0 ng (PBS) to wells coated with human (n = 4), mouse (n = 3), or guinea pig (n = 3) nonimmune IgG. As controls, gD2 was added at 800 ng, 400 ng, 200 ng, or 0 ng (PBS) to wells coated with nonimmune human IgG (n = 2), or gE2 was added to wells coated with 10% BSA (n = 1). OD, optical density. (B) Rosetting assay to detect IgG Fc receptor activity on cells infected with HSV-2 strain 2.12 or HSV-2 gE2-del or on uninfected cells. The results are the averages of data from two separate experiments. (C) Neutralization assays to assess gE2 IgG Fc receptor activity on WT virus. HSV-2 strain 2.12 (WT) or the HSV-2 gE2-del mutant was incubated with Dulbecco's modified Eagle's medium (DMEM), Dulbecco's modified Eagle's medium with 10% human complement (DMEM-C), a 1:40 dilution of heat-inactivated serum from mice (n = 7) or guinea pigs (n = 4) immunized with bac-gD2(306t) or humans (n = 6) immunized with the GSK gD2 vaccine, or a 1:40 dilution of heat-inactivated anti-gD2 mouse, guinea pig, or human serum with 10% human complement from an HSV-1/HSV-2-seronegative donor.

FIG 5.

FIG 5

Properties of gE2 antibodies. (A) Cartoon of possible mechanisms for anti-gE2 IgG blocking of rosetting of IgG-coated erythrocytes (RBC) to gE/gI on HSV-2-infected cells. Anti-gE2 binds by the Fc domain (i), by the F(ab′)2 domain (ii), and by both domains (antibody bipolar bridging) (iii). (B) Anti-gE2 IgG blocks rosetting in a dose-dependent fashion. Results shown are the means ± standard errors of the means from 3 experiments. NIG, nonimmune IgG. (C) Neutralization of HSV-2 strain 2.12 by a 1:40 dilution of rabbit anti-gC2, rabbit anti-gE2, or both antibodies at a final concentration of 1:40 with or without 10% human complement (C) from an HSV-1/HSV-2-seronegative donor. Results are the means ± standard deviations from 4 experiments. (D) gE2 antibody (Ab) blocks cell-to-cell spread of HSV-2 strain 2.12.

FIG 4.

FIG 4

HSV-2 gC2 and gE2 act in synergy to prevent antibody and complement neutralization. (A) WT HSV-2. Shown is a cartoon of gC2 inhibiting complement activation and gE2 promoting antibody bipolar bridging. HSV-2 gC2 binds to C3b and blocks the interaction between C3b and downstream complement proteins. An IgG molecule binds by its F(ab′)2 domain to gD2 and by its Fc domain to gE2 that is part of the gE/gI complex comprising the HSV-2 IgG Fc receptor. (B) HSV-2 gC2null-gE2-del. A cartoon of the HSV-2 gC2/gE2 double-deletion strain shows enhanced complement activation and generation of the C5–C9 membrane attack complex. The triangle represents an antigenic epitope on gD2. (C) HSV-2 strain 2.12 (WT), the single-deletion strains HSV-2 2.12 gE2-del (gE2-del) and HSV-2 2.12gCnull (gC2null), and the double-deletion strain HSV-2 2.12gCnull-gE2-del (gC2null-gE2-del) were incubated with various concentrations of human anti-HSV-2 IgG and human complement. The 1× antibody concentration refers to the amount required to neutralize virus by 50% in the absence of complement. 1× complement refers to a 25% concentration of HSV-1/HSV-2-seronegative serum. The plots represent the lowest dilution of complement that results in 50% neutralization at each dilution of antibody. Results shown are the means ± standard errors of the means from 3 experiments.

FIG 6.

FIG 6

Genital challenge with HSV-2 strain MS after immunization of mice with gE2 or gC2/gD2/gE2 subunit antigens. (A) Survival after challenge with 5 × 104 PFU of HSV-2 strain MS of mock-immunized mice or mice immunized with gE2 or gC2/gD2/gE2 subunit antigens. Five mice were in each group. (B) Genital disease scores in the same mice as those for panel A. (C) Vaginal swab titers performed on day 4 postchallenge on five additional mice per group. (D) Lumbosacral DRG HSV-2 DNA copy numbers for the same 5 mice as those for panel C.

FIG 8.

FIG 8

Lumbosacral DRG HSV-2 DNA copy numbers. (A to D) DRG were harvested on day 2 (n = 5 per group), day 4 (n = 8 per group), day 5 (n = 5 for the mock group, and n = 15 for the gD2 and gC2/gD2/gE2 groups), and day 7 (n = 5 per group). Results represent means ± standard errors of the means. (E) Table summarizing the numbers of DRG that contained HSV-2 DNA and the means ± standard errors of the means of the HSV-2 DNA copy numbers in DRG.

FIG 7.

FIG 7

Immunization of mice with gD2 or gC2/gD2/gE2 subunit antigens and genital challenge with HSV-2 strain MS. (A) Neutralization assays were performed prior to vaginal challenge. Results shown are for 6 sera per group; C represents 10% human complement from an HSV-1/HSV-2-seronegative donor. (B) Vaginal swab titers obtained on days 1, 2, 4, 5, and 7 postinfection. Five mice were in each group, except for 8 mice on day 4. Results represent means ± standard errors of the means. Cultures were performed only once for each mouse. (C) Genital disease scores of mice after challenge. The numbers of animals evaluated each day were 28 on day 1, 23 on day 2, 18 on day 3 and day 4, 10 on day 5, and 5 on day 6 and day 7.

RESULTS

Production of bac-gE2(24-405t) protein and gE2 antibody.

Our goal is to determine whether immunization with gE2 induces antibodies that bind to HSV-2 gE2 and block IgG Fc binding. We expressed gE2 in baculovirus [bac-gE2(24-405t)] and verified that the correct gE2 sequences were inserted. The bac-gE2(24-405t) protein was purified on a nickel column, and fractions were eluted, pooled, concentrated, and assessed by Coomassie blue staining (Fig. 1A) and Western blotting using anti-His antibody (Fig. 1B). The results showed a major band that was approximately 95% pure and of the expected size.

FIG 1.

FIG 1

Production of bac-gE2(24-405t) protein and Western blotting using rabbit gE2 antibody R265. (A) Coomassie blue staining of purified bac-gE2(24-405t). MW, molecular weight marker (in thousands). (B) Western blotting to detect bac-gE2(24-405t) using anti-His antibody. (C) Western blotting using anti-gE2 R265 to detect gE2 in Vero cells infected with HSV-2 strain 2.12, HSV-2 2.12gE2-del (gE2-del), or gE2 in purified viruses.

Rabbits were immunized with bac-gE2(24-405t) to produce gE2 antibody R265, which had an ELISA endpoint titer of ≥1:163,840. The anti-gE2 serum was evaluated by Western blotting and demonstrated binding to gE2 in HSV-2-infected cells but not in cells infected with the HSV-2 gE2 deletion strain (Fig. 1C). Similarly, gE2 was detected on purified WT virus but not on gE2 deletion strain gE2-del (Fig. 1C).

HSV-2 gE2 binds IgG Fc, expresses an IgG Fc receptor on infected cells, and participates in antibody bipolar bridging.

We evaluated whether gE2 binds the Fc domain of murine, guinea pig, and human IgG (Fig. 2A). Various concentrations of gE2 or gD2, as a control, were added to ELISA wells that were coated with human, murine, or guinea pig IgG or with BSA. HSV-2 gE2 bound to IgG from all three species in a dose-dependent fashion (for comparison of 800 ng IgG with no gE2 [PBS], P < 0.001 for human IgG, P < 0.01 for murine IgG, and P = 0.032 for guinea pig IgG) (Fig. 2A). As controls, gE2 did not bind to BSA, and gD2 did not bind to human IgG.

We evaluated whether HSV-2-infected cells express an IgG Fc receptor. COS cells were infected with HSV-2 at an MOI of 2 and evaluated for IgG Fc receptor expression by a rosetting assay. Thirty-six percent of cells infected with WT virus formed rosettes, while uninfected COS cells or cells infected with a gE2 deletion virus failed to form rosettes (Fig. 2B). Therefore, HSV-2 infection induces expression on an IgG Fc receptor at the infected-cell surface that requires gE2.

We evaluated whether gE2 expressed on the virus inhibits neutralization of WT virus by anti-gD2 antibodies in the presence of human complement. This experiment is based on the hypothesis that gE2 functions as an IgG Fc receptor to bind the Fc domain of an antibody molecule that is bound by its F(ab′)2 domain to gD2 (referred to as antibody bipolar bridging) (see model in Fig. 4A) (24). We postulate that in the presence of gE2, antibody bipolar bridging blocks the IgG Fc domain such that it is not available to activate complement, while in the absence of gE2, the IgG Fc domain is available to activate complement, leading to greater virus neutralization (see model in Fig. 4B) (26, 27).

We performed antibody and complement neutralization assays using mouse, guinea pig, and human anti-gD2 sera. The mouse and guinea pig samples were obtained from animals immunized with a gD2 subunit antigen administered with CpG-alum as the adjuvant (30), while the human sera were obtained from subjects immunized with the GSK gD2 subunit vaccine with MPL-alum as the adjuvant. We postulated that if the Fc domain of mouse, guinea pig, or human anti-gD2 IgG fails to bind to gE2, complement would enhance neutralization, and results would be similar using the WT or a gE2 deletion virus.

In the absence of antibody, complement alone had no effect against WT HSV-2 or the gE2-del strain (Fig. 2C). Mouse, guinea pig, and human gD2 antibodies used at a 1:40 dilution without human complement neutralized WT and gE2 deletion viruses, lowering the titers of WT virus by 1.5, 1.3, and 1.7 log10 copies using mouse, guinea pig, and human gD2 antibodies, respectively, and neutralized gE2-del virus by 0.9, 0.9, and 3.4 log10 copies, respectively (the P value was not significant for comparisons of neutralization of WT and gE2-del viruses by gD2 antibody for mice and guinea pigs; P < 0.001 for human gD2 antibody). Importantly, mouse, guinea pig, and human anti-gD2 with 10% human complement had only a small additional effect compared with that of antibody alone on WT virus; however, complement greatly enhanced antibody neutralization of gE2-del virus, reducing the titers using mouse antibody by 4.2 log10 copies, guinea pig antibody by 3.5 log10 copies, and human antibody by 1.7 log10 copies compared with antibody alone (P < 0.001 for comparison of complement enhancement of antibody neutralization of WT and gE2-del viruses using mouse and guinea pig sera, and P < 0.01 using human sera) (Fig. 2C). The results support the hypothesis that the HSV-2 IgG Fc receptor participates in antibody bipolar bridging of murine, guinea pig, and human antibodies to block complement activation.

Characterization of an HSV-2 gC2 and gE2 double-deletion mutant strain.

A double-deletion mutant strain, HSV-2 2.12 gCnull-gE2-del, was generated by coinfection of Vero cells with single mutant virus strains HSV-2 2.12 gCnull and HSV-2 2.12 gE2-del. PCR amplification of viral DNA demonstrated that the HSV-2 2.12 gCnull-gE2-del strain contained LacZ and GFP sequences in the correct locations, replacing the gC2 or gE2 protein-coding sequence, respectively (result not shown). Vero cells were infected with the gC2/gE2 double-deletion virus and evaluated by Western blotting. The double mutant strain expressed GFP and LacZ proteins and did not produce gC2 or gE2 protein (Fig. 3A). Single-step growth curves were performed in Vero cells to assess replication kinetics. No differences in growth were detected between the WT, each single-deletion strain, and the double-deletion strain (Fig. 3B).

FIG 3.

FIG 3

Characterization of mutant virus strains. (A) Western blot of the gC2/gE2 double-deletion strain. Denaturing Western blots were probed for GFP, LacZ, gC2, gE2, or actin. The WT is HSV-2 strain 2.12, gC2null is HSV-2 2.12gCnull, gE2-del is HSV-2 2.12 gE2-del, and gC2null-gE2-del is HSV-2 2.12gCnull-gE2-del. (B) Single-step growth kinetics of WT HSV-2 strain 2.12 and mutant strains derived from HSV-2 2.12, including HSV-2 2.12gCnull (gC2null), HSV-2 2.12gE2-del (gE2-del), and HSV-2 2.12 gCnull-gE2del (gC2null-gE2-del), in Vero cells.

HSV-2 gC2 and gE2 act in synergy to prevent antibody and complement neutralization.

HSV-2 gC2 binds C3b to inhibit complement activation, while gE2 binds the IgG Fc domain and inhibits complement activation by preventing C1q binding (Fig. 4A) (18, 25, 34, 37). Glycoproteins gC2 and gE2 interfere with different steps in the complement cascade; therefore, we postulated that gC2 and gE2 might act in synergy to protect the virus from antibody and complement neutralization (Fig. 4B). We determined the concentration of antibody required for 50% neutralization of virus in the absence of complement (considered a 1× concentration), which occurred at 50 μg/ml for the WT and gE2-del strains and at 25 μg/ml for gC2null and the double-deletion strains. A checkerboard assay was used to assess for synergy by incubating 100 PFU of virus with various concentrations of human anti-HSV antibody and complement from an HSV-1/HSV-2-seronegative human donor. Antibody was used at 8 concentrations ranging from a 2× concentration to no antibody, while human complement was used at 8 concentrations ranging from 25% serum to no serum. The results are plotted as the lowest concentration of complement that resulted in 50% neutralization at each dilution of antibody (Fig. 4C). Complement enhanced antibody neutralization of each virus in the following order: double deletion > gC2 deletion > gE2 deletion > WT (P < 0.05 for comparison of the double-deletion strain with WT virus; the P value was not significant for other comparisons) (Fig. 4C).

Antibody to gE2 blocks rosetting of IgG-coated erythrocytes.

Rabbit anti-gE2 IgG was evaluated for its ability to block IgG Fc receptor activity. Blocking can occur by several mechanisms, since anti-gE2 IgG can bind by (i) its Fc domain, (ii) its F(ab′)2 domain, or (iii) by both the F(ab′)2 and Fc domains (antibody bipolar bridging) (Fig. 5A). If rabbit anti-gE2 IgG also binds only by its Fc domain, we expect to detect similar blocking of IgG-coated erythrocytes between anti-gE2 IgG and rabbit nonimmune IgG. In contrast, if rabbit anti-gE2 IgG also binds to gE2 by its F(ab′)2 domain or by antibody bridging, we expect anti-gE2 IgG to have a greater effect on blocking rosetting than rabbit nonimmune IgG.

In the absence of any antibody, 27% of infected cells formed rosettes. Anti-gE2 IgG blocked rosetting in a dose-dependent fashion, with the greatest inhibition occurring at 250 μg/ml IgG, which had rosettes around 2% of infected cells, compared with 19% at 4 μg/ml (P < 0.01). In contrast, 4 μg/ml rabbit nonimmune IgG had little effect on blocking rosetting (the P value was not significant for comparisons of doses of 250 μg/ml and 4 μg/ml) (Fig. 5B). The results demonstrate that anti-gE2 IgG blocks rosetting more effectively than nonimmune rabbit IgG, which indicates that the F(ab′)2 domain contributes to the blocking (mechanism ii and/or iii) (Fig. 5A).

Anti-gE2 IgG enhances the neutralizing activity of anti-gC2 IgG in the presence of complement.

We evaluated whether anti-gE2 IgG enhances the neutralizing activity of anti-gC2 IgG in the presence and absence of complement. We hypothesized that neutralization with the two antibodies will be greater than that with either antibody alone, particularly in the presence of complement, since gC2 and gE2 antibodies block evasion from complement. Ten percent human complement in the absence of antibody neutralized WT virus by 0.1 log10 copies (Fig. 5C). Rabbit anti-gC2 IgG at a 1:40 dilution neutralized HSV-2 by 1.3 log10 copies in the absence of complement and by 2.8 log10 copies in the presence of complement; therefore, complement enhanced antibody neutralization by 1.5 log10 copies. Rabbit anti-gE2 at a 1:40 dilution had little neutralizing activity in the absence of complement (0.3 log10 copies) and 0.8 log10 copies in the presence of complement, which indicates that complement enhanced antibody neutralization by 0.5 log10 copies. When anti-gC2 and anti-gE2 were used together, each at a final concentration of 1:40, antibody neutralized HSV-2 by 2.4 log10 copies without complement and by 4.4 log10 copies with complement; therefore, complement enhanced antibody neutralization by 2 log10 copies using both antibodies (P < 0.001 for comparison of complement enhancement of neutralization by gE2 antibody [0.5 log10 copies] with complement enhancement of neutralization by gC2 and gE2 antibodies [2 log10 copies], and P = 0.035 for comparison of complement enhancement of neutralization by gC2 antibody [1.5 log10 copies] with complement enhancement of neutralization by gC2 and gE2 antibodies [2 log10 copies]). The results indicate that anti-gC2 and anti-gE2 together in the presence of complement are more potent in neutralizing HSV-2 than either antibody alone.

Antibody to gE2 blocks HSV-2 cell-to-cell spread.

HSV-2 gE is required for efficient virus spread from cell to cell (3). We evaluated whether gE2 antibody blocks HSV-2 cell-to-cell spread. The plaques that formed in cells incubated with rabbit anti-gE2 at a 1:40 dilution were significantly smaller than those formed by using a 1:40 dilution of rabbit preimmune serum (P < 0.001) (Fig. 5D), although the number of plaques that formed did not differ. Therefore, anti-gE2 is highly effective at blocking cell-to-cell spread, although it does not neutralize the virus, indicating that it does not prevent virus entry.

Immunization with bac-gE2(24-405t) partially protects mice against HSV-2 genital infection.

BALB/c mice (10 mice/group) were mock immunized or immunized three times at 2-week intervals with 5 μg gE2 alone (monovalent group) or with a trivalent vaccine containing 5 μg gC2, 5 μg gE2, and 2 μg gD2, each administered with CpG and alum. Mice were bled 2 weeks after the third immunization to evaluate whether administering three antigens at the same time blunted antibody responses to any of the subunit antigens. ELISA titers to gD2 were low (1:1,000) compared with titers of 1:32,000 observed in our previous studies (30). Therefore, an additional immunization with 2 μg gD2 was given to the trivalent subunit antigen group, which resulted in HSV-2 gD2 ELISA titers 2 weeks later that were considerably higher (1:36,000).

Mice were then infected intravaginally with 5 × 104 PFU (104 50% lethal doses [LD50]) of HSV-2 strain MS. All mice in the monovalent and trivalent groups survived, while all mock-immunized mice died by day 8 (P < 0.001 for comparison of the trivalent- and gE2-immunized groups with the mock-immunized group) (Fig. 6A). Mock-immunized mice had severe genital disease, while the monovalent gE2 group was partially protected, and the trivalent group was totally protected against genital disease (P = 0.012 for comparison of the trivalent group with the mock group, and P < 0.01 for comparison of trivalent group with the gE2 group; the P value was not significant for comparison of the gE2 group with the mock group) (Fig. 6B). Vaginal swabs were obtained for virus titers, and lumbosacral DRG were harvested for determination of HSV-2 DNA copy numbers in five mice per group, which were euthanized on day 4. Vaginal titers and DRG HSV-2 DNA copy numbers were only minimally reduced in the gE2 group compared with mock-immunized animals; however, vaginal titers and DRG copy numbers were undetectable in the trivalent group (P < 0.01 for comparison of vaginal titers or DRG copy numbers in the trivalent group with the mock or gE2 group; the P value was not significant for comparison of vaginal titers or DRG copy numbers of the gE2 group and the mock group) (Fig. 6C and D). While the trivalent vaccine provided strong protection against vaginal challenge, the monovalent gE2 antigen did not significantly outperform mock immunization in preventing genital disease, lowering vaginal swab titers, or protecting DRG, which indicates that gE2 by itself is not a suitable vaccine candidate.

Comparison of gD2 monovalent with gC2/gD2/gE2 trivalent subunit immunization.

We performed additional immunization and challenge experiments to compare the gD2-alone group with the trivalent subunit antigen group. All antigens were used at a concentration of 5 μg per dose, and mice were challenged with a 3-fold-higher titer (1.5 × 105 PFU) of HSV-2 strain MS than that reported in Fig. 6 to further assess the protection provided by the trivalent vaccine. Two weeks after the third immunization, mice were bled and tested by ELISA for antibody responses. The gE2 antibody titers in the trivalent group were lower than those in the first experiment (1:1,900 compared with 1:14,000); therefore, the trivalent group received a fourth immunization with 5 μg gE2 antigen, which increased the gE2 titers to 1:48,000. The gD2 ELISA titers were 1:40,000 in the gD2-alone and trivalent groups prior to challenge.

Neutralizing antibody titers with and without 10% human complement were determined by using serum obtained 2 weeks after the final immunization. The 50% neutralizing titers for the gD2 group were 1:1,280 without complement and 1:5,120 with complement. In the trivalent vaccine group, >70% neutralization was detected without complement and >80% was detected with complement at a 1:5,120 dilution, which was the highest dilution tested (P < 0.01 for comparison of gC2/gD2/gE2 and gD2 neutralization without complement at 1:2,560 and 1:5,120 dilutions, and P < 0.01 for comparison of gC2/gD2/gE2 and gD2 neutralization with complement at 1:1,280, 1:2,560, and 1:5,120 dilutions) (Fig. 7A).

Vaginal swab titers were performed on days 1, 2, 4, 5, and 7 on mice prior to harvesting of lumbosacral DRG for HSV-2 DNA copy number determinations. Vaginal swab titers were highest in the mock-immunized mice, while they were comparable in the monovalent and trivalent groups (P < 0.001 for comparison of gD2 and trivalent groups with the mock-immunized group on each day) (Fig. 7B). Animals were scored daily for genital disease until they were euthanized. Severe disease developed in the mock group, while disease was mild in the gD2-immunized mice, and no disease developed in the trivalent group (P < 0.01 for comparison of trivalent and mock groups, and P = 0.01 for comparison of gD2 and mock groups; the P value was not significant for comparison of gD2 and trivalent groups) (Fig. 7C).

The DRG HSV-2 DNA copy number was determined for the animals that were euthanized on days 2, 4, 5, and 7 postchallenge (same animals as those reported in Fig. 7C). The DNA copy number was highest in mock-immunized mice and lowest in the trivalent vaccine group (Fig. 8). Impressively, only 1 of 33 mice in the trivalent group had HSV-2 DNA detected in DRG, indicating that 97% of the animals were protected despite the very high HSV-2 challenge dose. Six of 33 (18%) animals in the gD2 group had HSV-2 DNA detected in DRG, while 21/23 (91%) mock-immunized animals had HSV-2 DNA detected in DRG (P < 0.001 for comparison of the trivalent and gD2 groups with the mock group, and P = 0.11 for comparison of the trivalent group with the gD2 group) (Fig. 8E). The geometric mean HSV-2 DNA copy number was 0.08 copies per 104 mouse adipsin genes in the trivalent group, compared with 0.48 copies in the gD2 group and 3.57 copies in the mock group (P < 0.001 for comparison of trivalent and gD2 groups with the mock group, and P = 0.049 for comparison of the trivalent group with the gD2 group) (Fig. 8E).

DISCUSSION

Important goals for a prophylactic genital herpes vaccine are to prevent genital disease and to reduce or eliminate asymptomatic shedding of HSV-2 DNA, which contributes to sexual transmission of the virus (44–46). The lumbosacral DRG function as the virus reservoir for recurrent lesions and asymptomatic shedding of HSV-2 DNA. To reach the DRG, the virus must first replicate in the genital mucosa and then infect axons innervating the genital tissues. In the current study, no mouse developed genital disease in the trivalent subunit antigen group, and only 1 of 33 mice in the studies reported in Fig. 8 and 0/5 mice in the studies reported in Fig. 6 had HSV-2 DNA detected in DRG. However, the trivalent gC2/gD2/gE2 vaccine did not induce sterile immunity based on HSV-2 vaginal cultures, which detected 1 to 2 log10 HSV-2 copies on days 2 and 4 postchallenge (Fig. 7). In our experience, isolation of virus on day 2 or 4 reflects local replication in genital tissues rather than residual virus from the inoculum. An important conclusion from these observations is that vaccines have the potential to protect neurons and prevent DRG infection despite local replication in genital tissues.

We immunized mice in the trivalent vaccine group a fourth time with gD2 in one experiment and with gE2 in another experiment. The fact that additional immunizations were required to achieve ELISA titers detected by using the antigen by itself suggests that we have not yet determined the optimal concentration of antigens and/or adjuvants to induce a maximum antibody response when the three antigens are mixed together.

Mice immunized with gD2 alone had mild genital disease and low HSV-2 vaginal titers, and only 6/33 mice had HSV-2 DNA detected in DRG. This degree of protection by gD2 alone exceeded that noted in our previous murine study that used the same gD2 antigen and adjuvants; however, the highest dose of gD2 was 2 μg in our previous study, compared with 5 μg in the current study (30). Previously, we noted that protection against death and vaginal disease was dose dependent for comparisons of gD2 immunization at 50 ng, 100 ng, and 250 ng (30). Based on our current results using 5 μg of gD2, we postulate that protection by gD2 in mice is dose dependent over a 100-fold range of concentrations from 50 ng to 5 μg.

The neutralizing antibody titers are consistent with the hypothesis that protection after gD2 immunization is dose dependent. Mice immunized with 250 ng gD2 in our previous study had HSV-2-neutralizing titers of 1:320, compared with titers of 1:1,280 when mice were immunized with 5 μg gD2 in the current study (30). In the human trials, the gD2 vaccine was used at a dose of 20 μg (1, 2). We tested neutralizing antibody responses of 30 subjects immunized with gD2 in the recent Herpevac trial for women (40). The serum samples selected were representative of high, intermediate, and low ELISA responders in the study population. The mean HSV-2-neutralizing antibody titer was 1:29, which is considerably lower than the neutralizing antibody titers produced in mice by using 250 ng of gD2. Therefore, in mice, we detected dose-dependent neutralizing antibody responses and dose-dependent protection against genital disease. This observation raises the possibility that 20 μg gD2 may have been too low a dose to provide protection against HSV-2 infection in humans, particularly if body mass matters, since humans weigh approximately 1,700-fold more than mice.

We examined whether gC2 and gE2 are synergistic in protecting HSV-2 against antibody and complement neutralization. Complement enhanced the neutralization of WT, gC2 and gE2 single-deletion, and gC2/gE2 double-deletion viruses, and the effect was greatest for the gC2/gE2 double-deletion strain. The concave shape of the neutralization curve for the double-deletion strain compared with the other curves shown in Fig. 4C indicates that gC2 and gE2 act in synergy to protect WT virus from antibody and complement neutralization (41, 47).

We demonstrated that antibodies to gD2 from mice, guinea pigs, and humans were more effective at neutralizing the gE2 deletion virus than WT virus in the presence of complement. These results are consistent with the concept that gE2 mediates antibody bipolar bridging and protects the virus from complement-enhanced antibody neutralization, as reported previously for gE1 (24, 27, 48, 49). For human serum, we noted that gD2 antibody without complement neutralized the gE2 deletion virus better than the WT virus. We recently reported that gE2 appears to shield domains on WT virus from neutralizing antibodies, which was based on the evaluation of sera from patients enrolled in human gD2 vaccine trials (50). Therefore, the detection of greater neutralization of gE2 deletion virus than WT virus was not surprising; however, it was surprising that human anti-gD2 showed greater neutralization of gE2 deletion virus, while mouse and guinea pig anti-gD2 did not. Possible explanations include that different adjuvants were used for human and animal vaccine studies or that the gD2 antigen used in the human trials contained 284 amino acids, compared with 306 amino acids in the animal studies.

We determined that gC2 and gE2 antibodies together were more potent in neutralizing WT virus in the presence of complement than either antibody alone and that gE2 antibodies bind by their F(ab′)2 domains to block regions on gE2 involved in immune evasion. In addition to immune evasion, gE2 mediates cell-to-cell spread of virus (3). We demonstrated that antibodies to gE2 reduced HSV-2 plaque size, which indicates that anti-gE2 blocks cell-to-cell spread and immune evasion. HSV-2 gE2 immunization by itself was not sufficient to prevent genital disease or DRG infection, yet gE2 protected mice from dying. Perhaps gE2 antibodies blocked the spread of virus to the central nervous system, which prevented death. Survival without prevention of vaginal disease and DRG infection is not sufficient protection, which led us to combine gE2 with gC2 and gD2 to form a trivalent vaccine.

We previously reported that gC1 and gC2 both bind C3b as purified glycoproteins or when expressed on transfected cells; however, only HSV-1 binds C3b on infected cells (51–53). Here we report that HSV-1 and HSV-2 also differ in the expression of IgG Fc receptors on infected cells, since approximately one-third of HSV-2-infected cells express an IgG Fc receptor, compared with two-thirds of HSV-1-infected cells (54, 55). Another difference between gE1 and gE2 is that gE2 binds the Fc domain of mouse and guinea pig IgG, while gE1 does not (56, 57). The observation that gE2 binds guinea pig IgG Fc will enable future studies of gE2-mediated immune evasion in the guinea pig vaginal infection model, which will be useful for determining whether protection of DRG by the trivalent antigen vaccine noted for the murine model will translate into fewer episodes of recurrent genital disease or recurrent vaginal shedding of HSV-2 DNA in guinea pigs.

ACKNOWLEDGMENTS

We thank Fushan Wang for assistance with cloning gE2 DNA into baculovirus and Charles Whitbeck, Huan Lou, Roselyn Eisenberg, and Gary Cohen for assistance with expression and purification of the bac-gE2(24-405t) protein and production of gE2 antibody R265 in rabbits.

This work was supported in part by NIH grants R21 AI105959 and R01 AI104854.

Footnotes

Published ahead of print 14 May 2014

REFERENCES

  • 1.Belshe RB, Leone PA, Bernstein DI, Wald A, Levin MJ, Stapleton JT, Gorfinkel I, Morrow RL, Ewell MG, Stokes-Riner A, Dubin G, Heineman TC, Schulte JM, Deal CD. 2012. Efficacy results of a trial of a herpes simplex vaccine. N. Engl. J. Med. 366:34–43. 10.1056/NEJMoa1103151 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Stanberry LR, Spruance SL, Cunningham AL, Bernstein DI, Mindel A, Sacks S, Tyring S, Aoki FY, Slaoui M, Denis M, Vandepapeliere P, Dubin G. 2002. Glycoprotein-D-adjuvant vaccine to prevent genital herpes. N. Engl. J. Med. 347:1652–1661. 10.1056/NEJMoa011915 [DOI] [PubMed] [Google Scholar]
  • 3.Wang F, Zumbrun EE, Huang J, Si H, Makaroun L, Friedman HM. 2010. Herpes simplex virus type 2 glycoprotein E is required for efficient virus spread from epithelial cells to neurons and for targeting viral proteins from the neuron cell body into axons. Virology 405:269–279. 10.1016/j.virol.2010.06.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Awasthi S, Zumbrun EE, Si H, Wang F, Shaw CE, Cai M, Lubinski JM, Barrett SM, Balliet JW, Flynn JA, Casimiro DR, Bryan JT, Friedman HM. 2012. Live attenuated herpes simplex virus 2 glycoprotein E deletion mutant as a vaccine candidate defective in neuronal spread. J. Virol. 86:4586–4598. 10.1128/JVI.07203-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Hoshino Y, Pesnicak L, Dowdell KC, Burbelo PD, Knipe DM, Straus SE, Cohen JI. 2009. Protection from herpes simplex virus (HSV)-2 infection with replication-defective HSV-2 or glycoprotein D2 vaccines in HSV-1-seropositive and HSV-1-seronegative guinea pigs. J. Infect. Dis. 200:1088–1095. 10.1086/605645 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Halford WP, Puschel R, Gershburg E, Wilber A, Gershburg S, Rakowski B. 2011. A live-attenuated HSV-2 ICP0 virus elicits 10 to 100 times greater protection against genital herpes than a glycoprotein D subunit vaccine. PLoS One 6:e17748. 10.1371/journal.pone.0017748 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Akhrameyeva NV, Zhang P, Sugiyama N, Behar SM, Yao F. 2011. Development of a glycoprotein D-expressing dominant-negative and replication-defective herpes simplex virus 2 (HSV-2) recombinant viral vaccine against HSV-2 infection in mice. J. Virol. 85:5036–5047. 10.1128/JVI.02548-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Shlapobersky M, Marshak JO, Dong L, Huang ML, Wei Q, Chu A, Rolland A, Sullivan S, Koelle DM. 2012. Vaxfectin-adjuvanted plasmid DNA vaccine improves protection and immunogenicity in a murine model of genital herpes infection. J. Gen. Virol. 93:1305–1315. 10.1099/vir.0.040055-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Tirabassi RS, Ace CI, Levchenko T, Torchilin VP, Selin LK, Nie S, Guberski DL, Yang K. 2011. A mucosal vaccination approach for herpes simplex virus type 2. Vaccine 29:1090–1098. 10.1016/j.vaccine.2010.11.076 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Morello CS, Levinson MS, Kraynyak KA, Spector DH. 2011. Immunization with herpes simplex virus 2 (HSV-2) genes plus inactivated HSV-2 is highly protective against acute and recurrent HSV-2 disease. J. Virol. 85:3461–3472. 10.1128/JVI.02521-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Morello CS, Kraynyak KA, Levinson MS, Chen Z, Lee KF, Spector DH. 2012. Inactivated HSV-2 in MPL/alum adjuvant provides nearly complete protection against genital infection and shedding following long term challenge and rechallenge. Vaccine 30:6541–6550. 10.1016/j.vaccine.2012.08.049 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Lachmann PJ, Davies A. 1997. Complement and immunity to viruses. Immunol. Rev. 159:69–77. 10.1111/j.1600-065X.1997.tb01007.x [DOI] [PubMed] [Google Scholar]
  • 13.Friedman HM, Wang L, Pangburn MK, Lambris JD, Lubinski J. 2000. Novel mechanism of antibody-independent complement neutralization of herpes simplex virus type 1. J. Immunol. 165:4528–4536. 10.4049/jimmunol.165.8.4528 [DOI] [PubMed] [Google Scholar]
  • 14.Carroll MC. 2004. The complement system in B cell regulation. Mol. Immunol. 41:141–146. 10.1016/j.molimm.2004.03.017 [DOI] [PubMed] [Google Scholar]
  • 15.Carroll MC. 2004. The complement system in regulation of adaptive immunity. Nat. Immunol. 5:981–986. 10.1038/ni1113 [DOI] [PubMed] [Google Scholar]
  • 16.Fries LF, Friedman HM, Cohen GH, Eisenberg RJ, Hammer CH, Frank MM. 1986. Glycoprotein C of herpes simplex virus 1 is an inhibitor of the complement cascade. J. Immunol. 137:1636–1641 [PubMed] [Google Scholar]
  • 17.Harris SL, Frank I, Yee A, Cohen GH, Eisenberg RJ, Friedman HM. 1990. Glycoprotein C of herpes simplex virus type 1 prevents complement-mediated cell lysis and virus neutralization. J. Infect. Dis. 162:331–337. 10.1093/infdis/162.2.331 [DOI] [PubMed] [Google Scholar]
  • 18.Hung SL, Peng C, Kostavasili I, Friedman HM, Lambris JD, Eisenberg RJ, Cohen GH. 1994. The interaction of glycoprotein C of herpes simplex virus types 1 and 2 with the alternative complement pathway. Virology 203:299–312. 10.1006/viro.1994.1488 [DOI] [PubMed] [Google Scholar]
  • 19.Kostavasili I, Sahu A, Friedman HM, Eisenberg RJ, Cohen GH, Lambris JD. 1997. Mechanism of complement inactivation by glycoprotein C of herpes simplex virus. J. Immunol. 158:1763–1771 [PubMed] [Google Scholar]
  • 20.Friedman HM. 2000. Immunologic strategies for herpes vaccination. JAMA 283:746. 10.1001/jama.283.6.741 [DOI] [PubMed] [Google Scholar]
  • 21.Lubinski J, Wang L, Mastellos D, Sahu A, Lambris JD, Friedman HM. 1999. In vivo role of complement-interacting domains of herpes simplex virus type 1 glycoprotein gC. J. Exp. Med. 190:1637–1646. 10.1084/jem.190.11.1637 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Para MF, Goldstein L, Spear PG. 1982. Similarities and differences in the Fc-binding glycoprotein (gE) of herpes simplex virus types 1 and 2 and tentative mapping of the viral gene for this glycoprotein. J. Virol. 41:137–144 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Harandi AM. 2004. The potential of immunostimulatory CpG DNA for inducing immunity against genital herpes: opportunities and challenges. J. Clin. Virol. 30:207–210. 10.1016/j.jcv.2004.03.001 [DOI] [PubMed] [Google Scholar]
  • 24.Frank I, Friedman HM. 1989. A novel function of the herpes simplex virus type 1 Fc receptor: participation in bipolar bridging of antiviral immunoglobulin G. J. Virol. 63:4479–4488 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Dubin G, Socolof E, Frank I, Friedman HM. 1991. Herpes simplex virus type 1 Fc receptor protects infected cells from antibody-dependent cellular cytotoxicity. J. Virol. 65:7046–7050 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Nagashunmugam T, Lubinski J, Wang L, Goldstein LT, Weeks BS, Sundaresan P, Kang EH, Dubin G, Friedman HM. 1998. In vivo immune evasion mediated by the herpes simplex virus type 1 immunoglobulin G Fc receptor. J. Virol. 72:5351–5359 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lubinski JM, Lazear HM, Awasthi S, Wang F, Friedman HM. 2011. The herpes simplex virus 1 IgG Fc receptor blocks antibody-mediated complement activation and antibody-dependent cellular cytotoxicity in vivo. J. Virol. 85:3239–3249. 10.1128/JVI.02509-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Judson KA, Lubinski JM, Jiang M, Chang Y, Eisenberg RJ, Cohen GH, Friedman HM. 2003. Blocking immune evasion as a novel approach for prevention and treatment of herpes simplex virus infection. J. Virol. 77:12639–12645. 10.1128/JVI.77.23.12639-12645.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Awasthi S, Lubinski JM, Friedman HM. 2009. Immunization with HSV-1 glycoprotein C prevents immune evasion from complement and enhances the efficacy of an HSV-1 glycoprotein D subunit vaccine. Vaccine 27:6845–6853. 10.1016/j.vaccine.2009.09.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Awasthi S, Lubinski JM, Shaw CE, Barrett SM, Cai M, Wang F, Betts M, Kingsley S, Distefano DJ, Balliet JW, Flynn JA, Casimiro DR, Bryan JT, Friedman HM. 2011. Immunization with a vaccine combining herpes simplex virus 2 (HSV-2) glycoprotein C (gC) and gD subunits improves the protection of dorsal root ganglia in mice and reduces the frequency of recurrent vaginal shedding of HSV-2 DNA in guinea pigs compared to immunization with gD alone. J. Virol. 85:10472–10486. 10.1128/JVI.00849-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Bernstein DI, Earwood JD, Bravo FJ, Cohen GH, Eisenberg RJ, Clark JR, Fairman J, Cardin RD. 2011. Effects of herpes simplex virus type 2 glycoprotein vaccines and CLDC adjuvant on genital herpes infection in the guinea pig. Vaccine 29:2071–2078. 10.1016/j.vaccine.2011.01.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Plotkin SA. 2008. Vaccines: correlates of vaccine-induced immunity. Clin. Infect. Dis. 47:401–409. 10.1086/589862 [DOI] [PubMed] [Google Scholar]
  • 33.Belshe RB, Heineman TC, Bernstein DI, Bellamy AR, Ewell M, van der Most R, Deal CD. 2014. Correlate of immune protection against HSV-1 genital disease in vaccinated women. J. Infect. Dis. 209:828–836. 10.1093/infdis/jit651 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Hook LM, Lubinski JM, Jiang M, Pangburn MK, Friedman HM. 2006. Herpes simplex virus type 1 and 2 glycoprotein C prevents complement-mediated neutralization induced by natural immunoglobulin M antibody. J. Virol. 80:4038–4046. 10.1128/JVI.80.8.4038-4046.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.McGraw HM, Friedman HM. 2009. Herpes simplex virus type 1 glycoprotein E mediates retrograde spread from epithelial cells to neurites. J. Virol. 83:4791–4799. 10.1128/JVI.02341-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Tal-Singer R, Peng C, Ponce De Leon M, Abrams WR, Banfield BW, Tufaro F, Cohen GH, Eisenberg RJ. 1995. Interaction of herpes simplex virus glycoprotein gC with mammalian cell surface molecules. J. Virol. 69:4471–4483 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hung SL, Srinivasan S, Friedman HM, Eisenberg RJ, Cohen GH. 1992. Structural basis of C3b binding by glycoprotein C of herpes simplex virus. J. Virol. 66:4013–4027 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Tengvall S, Lundqvist A, Eisenberg RJ, Cohen GH, Harandi AM. 2006. Mucosal administration of CpG oligodeoxynucleotide elicits strong CC and CXC chemokine responses in the vagina and serves as a potent Th1-tilting adjuvant for recombinant gD2 protein vaccination against genital herpes. J. Virol. 80:5283–5291. 10.1128/JVI.02013-05 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Lin X, Lubinski JM, Friedman HM. 2004. Immunization strategies to block the herpes simplex virus type 1 immunoglobulin G Fc receptor. J. Virol. 78:2562–2571. 10.1128/JVI.78.5.2562-2571.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Awasthi S, Belse RB, Friedman HM. 24 April 2014. Better neutralization of HSV-1 than HSV-2 by antibody from subjects immunized with the GlaxoSmithKline gD2 vaccine. J. Infect. Dis. 10.1093/infdis/jiu177 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Orhan G, Bayram A, Zer Y, Balci I. 2005. Synergy tests by E test and checkerboard methods of antimicrobial combinations against Brucella melitensis. J. Clin. Microbiol. 43:140–143. 10.1128/JCM.43.1.140-143.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Cairns TM, Shaner MS, Zuo Y, Ponce-de-Leon M, Baribaud I, Eisenberg RJ, Cohen GH, Whitbeck JC. 2006. Epitope mapping of herpes simplex virus type 2 gH/gL defines distinct antigenic sites, including some associated with biological function. J. Virol. 80:2596–2608. 10.1128/JVI.80.6.2596-2608.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Wang F, Tang W, McGraw HM, Bennett J, Enquist LW, Friedman HM. 2005. Herpes simplex virus type 1 glycoprotein E is required for axonal localization of capsid, tegument, and membrane glycoproteins. J. Virol. 79:13362–13372. 10.1128/JVI.79.21.13362-13372.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Phipps W, Saracino M, Magaret A, Selke S, Remington M, Huang ML, Warren T, Casper C, Corey L, Wald A. 2011. Persistent genital herpes simplex virus-2 shedding years following the first clinical episode. J. Infect. Dis. 203:180–187. 10.1093/infdis/jiq035 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Tronstein E, Johnston C, Huang ML, Selke S, Magaret A, Warren T, Corey L, Wald A. 2011. Genital shedding of herpes simplex virus among symptomatic and asymptomatic persons with HSV-2 infection. JAMA 305:1441–1449. 10.1001/jama.2011.420 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Wald A, Corey L, Cone R, Hobson A, Davis G, Zeh J. 1997. Frequent genital herpes simplex virus 2 shedding in immunocompetent women. Effect of acyclovir treatment. J. Clin. Invest. 99:1092–1097 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Harris MR, Coote PJ. 2010. Combination of caspofungin or anidulafungin with antimicrobial peptides results in potent synergistic killing of Candida albicans and Candida glabrata in vitro. Int. J. Antimicrob. Agents 35:347–356. 10.1016/j.ijantimicag.2009.11.021 [DOI] [PubMed] [Google Scholar]
  • 48.Sprague ER, Wang C, Baker D, Bjorkman PJ. 2006. Crystal structure of the HSV-1 Fc receptor bound to Fc reveals a mechanism for antibody bipolar bridging. PLoS Biol. 4:e148. 10.1371/journal.pbio.0040148 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Ndjamen B, Farley AH, Lee T, Fraser SE, Bjorkman PJ. 2014. The herpes virus Fc receptor gE-gI mediates antibody bipolar bridging to clear viral antigens from the cell surface. PLoS Pathog. 10:e1003961. 10.1371/journal.ppat.1003961 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Awasthi S, Balliet JW, Flynn JA, Lubinski JM, Shaw CE, Distefano DJ, Cai M, Brown M, Smith JF, Kowalski R, Swoyer R, Galli J, Copeland V, Rios S, Davidson RC, Salnikova M, Kingsley S, Bryan J, Casimiro DR, Friedman HM. 2014. Protection provided by a herpes simplex virus 2 (HSV-2) glycoprotein C and D subunit antigen vaccine against genital HSV-2 infection in HSV-1-seropositive guinea pigs. J. Virol. 88:2000–2010. 10.1128/JVI.03163-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Friedman HM, Cohen GH, Eisenberg RJ, Seidel CA, Cines DB. 1984. Glycoprotein C of herpes simplex virus 1 acts as a receptor for the C3b complement component on infected cells. Nature 309:633–635. 10.1038/309633a0 [DOI] [PubMed] [Google Scholar]
  • 52.Eisenberg RJ, Ponce de Leon M, Friedman HM, Fries LF, Frank MM, Hastings JC, Cohen GH. 1987. Complement component C3b binds directly to purified glycoprotein C of herpes simplex virus types 1 and 2. Microb. Pathog. 3:423–435. 10.1016/0882-4010(87)90012-X [DOI] [PubMed] [Google Scholar]
  • 53.Seidel-Dugan C, Ponce de Leon M, Friedman HM, Fries LF, Frank MM, Cohen GH, Eisenberg RJ. 1988. C3b receptor activity on transfected cells expressing glycoprotein C of herpes simplex virus types 1 and 2. J. Virol. 62:4027–4036 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Weeks BS, Sundaresan P, Nagashunmugam T, Kang E, Friedman HM. 1997. The herpes simplex virus-1 glycoprotein E (gE) mediates IgG binding and cell-to-cell spread through distinct gE domains. Biochem. Biophys. Res. Commun. 235:31–35. 10.1006/bbrc.1997.6720 [DOI] [PubMed] [Google Scholar]
  • 55.Saldanha CE, Lubinski J, Martin C, Nagashunmugam T, Wang L, van Der Keyl H, Tal-Singer R, Friedman HM. 2000. Herpes simplex virus type 1 glycoprotein E domains involved in virus spread and disease. J. Virol. 74:6712–6719. 10.1128/JVI.74.15.6712-6719.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Johansson PJ, Myhre EB, Blomberg J. 1985. Specificity of Fc receptors induced by herpes simplex virus type 1: comparison of immunoglobulin G from different animal species. J. Virol. 56:489–494 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Huemer HP, Larcher C, van Drunen Littel-van den Hurk S, Babiuk LA. 1993. Species selective interaction of Alphaherpesvirinae with the “unspecific” immune system of the host. Arch. Virol. 130:353–364. 10.1007/BF01309666 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES