Rapid Detection and Identification of Mucormycetes in Bronchoalveolar Lavage Samples from Immunocompromised Patients with Pulmonary Infiltrates by Use of High-Resolution Melt Analysis

Abstract

Rapid differential diagnostics of pulmonary infiltrates suspected of invasive fungal disease in an immunocompromised host and early initiation of effective antifungal therapy are crucial for patient outcomes. There are no serological tests available to detect mucormycetes; therefore, PCR-based methods are highly suitable. We validated our previously published PCR followed by high-resolution melt analysis (PCR/HRMA) to detect Rhizopus spp., Rhizomucor pusillus, Lichtheimia corymbifera, and Mucor spp. in bronchoalveolar lavage (BAL) samples from immunocompromised patients who were at risk of invasive fungal disease. All PCR/HRMA-positive samples were retested using novel real-time quantitative PCR (RQ PCR) assays specific to the species identified. In total, between January 2009 and December 2012 we analyzed 99 BAL samples from 86 patients with pulmonary abnormalities using PCR/HRMA. Ninety (91%) BAL samples were negative, and 9 (9%) samples were positive. The sensitivity and specificity of PCR/HRMA were 100% and 93%, respectively. By combining the positive results of PCR/HRMA with positive RQ PCR results, the specificity was raised to 98%. PCR/HRMA, due to its high negative predictive value (99%), represents a fast and reliable tool for routine BAL sample screening for the differential diagnosis of pulmonary infiltrates in immunocompromised patients for the four most clinically important mucormycetes.

INTRODUCTION

Invasive mucormycosis (IM), characterized by rapid progression, high morbidity, and mortality, is a serious infectious complication in patients with a hematological malignancy (1). More than 90% of cases are caused by Rhizopus oryzae (or Rhizopus microsporus), followed by Mucor species, Lichtheimia corymbifera, and Rhizomucor pusillus and rarely by some other mucormycetes (2, 3).

Early diagnosis and a prompt start of targeted IM antifungal therapy are crucial for successful patient outcomes. However, definitive diagnosis of these infections in routine clinical practice is very difficult, and the diagnosis is often not confirmed until there is histological proof of mucormycete-like elements in affected tissues or positive cultures (4, 5).

Contrary to invasive aspergillosis diagnosis, where a large number of attempts were made to detect galactomannan, both in serum and bronchoalveolar lavage (BAL) samples, no such serological test is available for mucormycetes. Even β-d-glucan, when used as a panfungal antigen, is negative in IM.

Therefore, one of the most promising tools for early mucormycete detection is the use of molecular methods, mainly various PCR modifications. Until now, only a limited number of mucormycete-specific PCR methods have been published. Moreover, only some of them allow the quantification of the fungal DNA load in samples (6–10), which can be important to differentiate between a real infection and contamination/colonization of the sample/patient.

We recently introduced a semiquantitative method for the specific detection of mucormycetes in tissue samples using high-resolution melt analysis (HRMA) (11). This method is based on amplification of DNA with specific primers in the presence of an intercalating dye. After PCR, the change in fluorescence is measured during controlled melting of the PCR product. The shape of the melting curve depends mainly on the GC content, length, and sequence of the PCR product. The ability of this method to detect and identify the most common pathogenic species has been proven in both cultures and tissue samples. Since this technique is very fast and suitable for routine testing, it might be an ideal tool for screening clinical samples from immunocompromised patients who are at risk of IM.

The most frequent manifestation of IM in this patient group is pulmonary disease; however, obtaining lung tissue samples (e.g., by fine-needle biopsy) can be accompanied by serious complications (bleeding and pneumothorax). Therefore, bronchoscopy with BAL is routinely used for the differential diagnosis of pulmonary abnormalities.

The aim of this study was to validate PCR/HRMA for the screening of BAL samples from hematological malignancy patients with pulmonary infiltrates and assess the clinical relevance of mucormycete detection in BAL. Moreover, we designed new species-specific real-time quantitative PCR (RQ PCR) assays for the most clinically relevant mucormycetes (R. oryzae, R. microsporus, Mucor spp., R. pusillus, and L. corymbifera), which were used to quantify the fungal load in positive samples.

MATERIALS AND METHODS

Mucormycete isolates.

Mucormycete isolates were obtained from the Czech Collection of Microorganisms (CCM), Czech Republic (Absidia [Lichtheimia] corymbifera, CCM8077; Mucor racemosus, CCM8190; Rhizomucor pusillus, CCMF-211; and Rhizopus oryzae, CCM8075) and culture-positive clinical specimens from the Department of Clinical Microbiology, University Hospital Brno, Czech Republic (2 Lichtheimia corymbifera, 3 Rhizopus microsporus, 2 Rhizopus oryzae, and 1 Mucor circinelloides). Fungal cultures were grown for 5 days, and spores were harvested by scraping the agar surfaces of Petri dishes using a sterile microbiological loop, transferred to 1 ml of 0.9% sodium chloride solution, and stored at −70°C.

Clinical samples.

Baseline patient population characteristics are summarized in Table 1. Overall, we tested 99 samples from 86 patients. All patients provided informed consent before the BAL procedure, and the institutional review board approved the study. The samples were processed immediately or stored at −70°C.

TABLE 1.

Demographic characteristics

Characteristica	No. of patients
Male	50
Female	36
AML	33
CLL	10
ALL	9
HL	3
HCL	3
CML	1
MM	9
NHL	12
Other	6
Allogeneic unrelated HSCT	17
Autologous HSCT	7
Induction/reinduction of acute leukemia	25
Consolidation of acute leukemia	6
Chemotherapy	12
Other therapy	9
No therapy	10

^aAML, acute myeloid leukemia; CLL, chronic lymphocytic leukemia; ALL, acute lymphoblastic leukemia; HL, Hodgkin's lymphoma; HCL, hairy cell leukemia; CML, chronic myeloid leukemia; MM, multiple myeloma; NHL, non-Hodgkin's lymphoma; HSCT, hematopoietic stem cell transplantation.

Fungal DNA isolation.

DNA was isolated from the clinical samples in a biological safety cabinet in a separate laboratory. An aliquot of sterile water was processed with each set of samples as a control for potential contamination during the isolation process. Before the isolation step, samples were thawed for 30 min at room temperature, and DNA was isolated from 50 μl of fungal inoculum or 2 ml of BAL fluid using a ZR fungal/bacterial kit (Zymo Research, Irvine, CA, USA). The sample vortexing time with glass beads was extended from 5 to 15 min, and DNA was eluted with 100 μl of elution buffer as described previously (11).

Detection of the human albumin gene.

To verify the DNA isolation process, the human albumin gene was detected in each sample. Quantitative PCR was carried out in a total volume of 25 μl containing 2× ABsolute QPCR mix (Thermo Scientific, UK), 400 nM each primer, 200 nM TaqMan probe, and 5 μl of genomic DNA. PCR was performed as follows: 95°C for 10 min, followed by 50 cycles of 95°C for 15 s and 60°C for 1 min (12). Samples with negative albumin amplification were excluded from the analysis. All clinical samples were analyzed in duplicate.

PCR/HRMA.

PCR amplification was carried out in seminested PCRs followed by HRMA using the protocol described previously (11). Samples were analyzed in duplicate. DNA extracted from 5 mucormycete strains (R. microsporus, R. oryzae, M. racemosus, R. pusillus, and L. corymbifera), at a 100× dilutions in TE buffer (10 mM Tris-Cl, 0.1 mM disodium EDTA [pH 8]), was used as a positive control in every run. A sample was considered positive if at least one parallel PCR produced a melting curve that was different from that of the negative sample. Rotor-Gene 6000 series software (version 1.7) was used to analyze the results.

RQ PCR assays.

We designed new species-specific real-time PCR assays (targeting the internal transcribed spacer 2 [ITS2] region of ribosomal DNA) with Primer Express 3.0 software (Applied Biosystems, USA). The sequences of primers and probes, the sequences used as a template, and the lengths of the PCR products are summarized in Table 2. Due to the intraspecies sequence variability among Lichtheimia isolates, it was necessary to design two different assays. Five microliters of isolated DNA was amplified in duplicate in 25 μl of amplification mixture that contained 12.5 μl of 2× ABsolute QPCR ROX mix (Thermo Scientific, UK), 400 nM primers, and a 200 nM TaqMan MGB probe (for the list of primers and probes used for each assay, see Table 2). Cycling conditions were 15 min at 95°C for 50 cycles (15 s at 95°C and 60 s at 60°C, with acquisition on the green and yellow channels) on the Rotor-Gene 6000. Mucor and Rhizomucor assays were run as multiplex PCRs. Sterile water (B. Braun, Germany) was used as a no-template control (NTC) in each run. Rotor-Gene 6000 series software (version 1.7) was used to analyze the results. Quantification was done using a standard curve; 5 μl of PCR product was cloned into plasmid vector pCR 2.1 (Invitrogen, USA) in 10× dilutions from 2 × 10⁶ to 2 × 10⁰ copies of plasmid DNA/5 μl.

TABLE 2.

Sequences of primers and TaqMan MGB probes (5′ to 3′) of assays used in this study

Target species	Primers and probe	Sequence (5′ → 3′)	Query sequence (GenBank accession no.)	PCR product length (bp)
Rhizopus microsporus	Forward primer	TTCGTGAATCATCGAGTCTTTGA
	Reverse primer	AGCAAGCGTACTCTATAGAAGATCCA	DQ119010.1	66
	MGBa probe	6-FAM-CGCAGCTTGCACTCT-MGBNFQb
Rhizopus oryzae	Forward primer	AGCAAAGTGCGATAACTAGTGTGAA
	reverse primer	TGAAGCAGGCGTACTCTATAGAAAAA	DQ119031.1	102
	MGB probe	6-FAM-CGCAGCTTGCACTCT-MGBNFQ
Mucor spp.	Forward primer	GCAACTTGCGCTCATTGGTA
	Reverse primer	GGATAGAGGGTTTGTTTTGATACTGAA	DQ118996.1	66
	MGB probe	6-FAM-CCAATGAGCACGCCTG-MGBNFQ
Rhizomucor pusillus	Forward primer	CCGTTCAAGCTACCCGAACA
	Reverse primer	AATGCAAGCCCTCAAGGAAA	DQ119000.1	65
	MGB probe	6-VIC-TTTGTATGTTGTTGACCCTTG-MGBNFQ
Lichtheimia corymbifera (assay 1)	Forward primer 1	TTCAGTTGCTGTCATGGCCTTA
	Reverse primer 1	CATCCGGCAAATGACTAAAGC	FJ713084.1	67
	MGB probe 1	6-FAM-ATACATTTAGTCCTAGGCAATT-MGBNFQ
Lichtheimia corymbifera (assay 2)	Forward primer 2	GTTGAGTTGGAACTGGGCTTCT
	Reverse primer 2	AGGACATTGATTTAAGGCCATGA	DQ118983.1	67
	MGB probe 2	6-FAM-TTGATGGCATTTAGTTGCT-MGBNFQ

^aMGB, minor-groove binder.

^b6-FAM, 6-carboxyfluorescein; MGBNFQ, minor-groove binder nonfluorescent quencher.

Statistical analysis.

The sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and positive and negative likelihood ratios were calculated using MedCalc for Windows (online version 12.7.0; MedCalc Software, Ostend, Belgium [http://www.medcalc.org/calc/diagnostic_test.php]). The criteria for a positive test were PCR/HRMA positive only or both PCR/HRMA and RQ PCR positive.

RESULTS

We adopted a previously published nested PCR (6) that is targeted to a conservative part of the mucormycete genome and replaced sequencing of the PCR product, which was necessary for species identification using HRMA. As we described in our previous study (11), each of the mucormycete species produces a unique curve shape, and PCR products melt at defined temperatures. Representative results of mucormycete-positive and -negative BAL samples are presented in Fig. 1.

FIG 1.

Representative results for HRMA: melting curves of 5 mucormycete isolates (A and C) and positive/negative BAL samples (B and D).

In vitro standardization.

The sensitivity of PCR/HRMA and individual RQ PCR assays was tested on serially diluted genomic DNA isolated from mucormycete cultures. The last dilution detected using both PCR/HRMA and RQ PCR contained 1 fg of genomic DNA (<1 genome). The linear dynamic range of the RQ PCR assays was initially assessed using a dilution series of genomic DNA of all species. The assays were shown to be linear over the entire range of 1 ng/μl to 1 fg/μl.

Testing clinical samples.

In this study, we analyzed 99 BAL samples from 86 patients using PCR/HRMA. Ninety BAL samples were negative; 9 samples were positive (Table 3). None of the samples presented inhibition, and negative controls were never amplified. Species detected using PCR/HRMA were Rhizopus spp. (6 samples), Rhizomucor pusillus (2 samples), and Lichtheimia corymbifera (1 sample). This is in agreement with previously published data, because Rhizopus spp. are considered to be the most frequent causes of IM.

TABLE 3.

Summary of cases with positive PCR/HRMA

Patient no.	Date (day-mo-yr)	Underlying diseasea	Therapyb	Results of PCR/HRMA	Species detected by PCR/HRMA	Results of RQ PCRc	CTd	Clinical diagnosise
1	29-3-2011	AML	Induction/reinduction	Weakly positive	Rhizopus spp.	Negative	NA	Bacterial pneumonia
2	28-3-2012	MM	Autologous HSCT	Weakly positive	Rhizopus spp.	Negative	NA	Possible IFD
3	23-6-2009	HL	CHT	Weakly positive	Lichtheimia corymbifera	Positive	38.2	Bacterial pneumonia
4	30-4-2012	NHL	No therapy	Weakly positive	Rhizopus spp.	Negative	NA	Bacterial pneumonia
5	19-3-2009	AML	Consolidation	Weakly positive	Rhizomucor pusillus	Negative	NA	Possible IFD
6	20-2-2009	ALL	Induction/reinduction	Positive	Rhizopus spp.	Positive	24.9	Proven mucormycosis
7	5-1-2009	HCL	Other	Weakly positive	Rhizopus spp.	Negative	NA	Pulmonary fibrosis
8	7-10-2009	NHL	CHT	Weakly positive	Rhizopus spp.	Positive	34.1	PCP
9	25-4-2012	HCL	CHT	Positive	Rhizomucor pusillus	Positive	31.6	Proven mucormycosis

^aAML, acute myeloid leukemia; MM, multiple myeloma; HL, Hodgkin's lymphoma; NHL, non-Hodgkin's lymphoma; ALL, acute lymphoblastic leukemia; HCL, hairy cell leukemia.

^bHSCT, hematopoietic stem cell transplantation; CHT, chemotherapy.

^cRQ PCR, real-time quantitative PCR.

^dC_T, cycle threshold; NA, not applicable.

^eIFD, invasive fungal disease; PCP, Pneumocystis pneumonia.

Two BAL samples (belonging to two patients with proven IM) were clearly positive (the melting curve was a copy of the one from the positive control, and all parallel reactions were positive). The other 7 samples were marked as weakly positive (the melting curve was present but diverted slightly from the positive control, and/or amplification was not present in all parallel reactions from the same sample).

Retrospective analysis of medical records was performed, and these cases were not classified as IM, but 2 were classified as possible invasive fungal disease (IFD) according to the European Organization for Research and Treatment of Cancer/Mycoses Study Group [EORTC/MSG] criteria (13), 4 as other infections (3 as bacterial pneumonia and 1 as Pneumocystis pneumonia [PCP]), and 1 as a noninfectious process. Most cases of false positivity of the PCR/HRMA test were thus associated with other ongoing infections. Patients with possible IFD did not respond to the initial treatment with antibiotics; therefore, antimycotic drugs (1 patient treated with micafungin [Mycamine] and 1 with amphotericin B) were empirically added, and the patients recovered. The patients classified as having bacterial pneumonia received only antibiotic therapy according to culture findings and recovered. PCP pneumonia was treated successfully with high-dose trimethoprim-sulfamethoxazole.

All PCR/HRMA-positive samples were retested using real-time PCR specific to the species identified; 2/2 (100%) samples from patients with proven IM were positive, and only 2/7 (29%) samples from patients without proven IM were also positive with RQ PCR.

Results for basic statistical parameters were calculated and are presented in Table 4. The two methods showed excellent sensitivity, specificity, and negative predictive value. The combination of PCR/HRMA with species-specific RQ PCR raised the specificity to 98%.

TABLE 4.

Sensitivity, specificity, PPV, and NPV of the tests using various parameters^a

Measure	% (95% CIb) of samples PCR/HRMA positive only	% (95% CI) of samples PCR/HRMA and RQ PCR positive
Sensitivity	100 (19.29–100.00)	100 (19.29–100)
Specificity	93 (85.69–97.04)	98 (92.73–99.69)
PPV	22 (3.47–59.94)	50 (8.30–91.7)
NPV	100 (95.94–100)	100 (96.15–100)
Positive likelihood ratio	13.86 (6.79–28.29)	48.5 (12.3–191.16)
Negative likelihood ratio	0 (NA)	0 (NA)

^aPPV, positive predictive value; NPV, negative predictive value.

^bCI, confidence interval; NA, not applicable.

DISCUSSION

The differential diagnosis of fungal pulmonary infections remains challenging, although the early initiation of effective treatment clearly impacts patient outcomes (14). Millon et al. (15) recently published a strategy based on monitoring the mucormycete DNA in serum samples from patients with histopathologically proven IM. Testing serum samples is very convenient, but due to the low amount of circulating fungal DNA, the positivity of serum samples can be expected only in advanced stages of the disease.

In this study, we evaluated the use of PCR/HRMA to screen BAL samples in which higher loads of the pathogen might be expected. In general, the use of PCR/HRMA was significantly simpler, and the diagnostic results were obtained faster than with the original protocol that consisted of nested PCR and sequencing. We can obtain the results in about 5 h from sample receipt at the laboratory, including the time necessary for DNA isolation.

Our PCR/HRMA showed an excellent NPV (100%). Therefore, a negative test result can virtually rule out an IM diagnosis, and empirically used amphotericin B therapy might be switched to less toxic drugs.

Overall, only 9/99 (9%) BAL samples in our study were PCR/HRMA positive, making it a very useful screening test for testing these nonsterile clinical samples. If patients were treated for IM based on PCR/HRMA positivity, in 4 patients (proven IM or possible IFD), the treatment would be correct, and in only 5/99 (5%) patients (without IFD) would it lead to possible overtreatment. Taking into consideration the lack of a specific diagnostic method and the risk of rapid progression and high mortality due to IM, preemptive treatment based on our results is more than clinically acceptable.

Moreover, the quantification of fungal load with species-specific RQ PCRs is supposed to distinguish contamination or colonization of the airways from an ongoing infection. In this study, RQ PCR increased the specificity and positive predictive value. The discrepancy between PCR/HRMA and RQ PCR results giving low positive samples can be explained by the very low amount of fungal DNA present at the detection limits of both assays, which could be identified with a higher probability with a seminested PCR/HRMA than with a single-round RQ PCR. Moreover, in low positive samples, the primers used in this study coamplify human DNA (present in excess), and this causes distortion of the melting curve (proved by sequencing; data not shown). We suppose that after testing a larger cohort of patients with more IM cases, we will be able to set a threshold (threshold cycle [C_T] value) coupled with IM, which would further increase the positive predictive value.

The main limitation of our study is the low prevalence of the disease (<2.5%) in our cohort; however, this is the limitation of all single-center studies focusing on differential diagnosis of pulmonary infections in hematological malignancy patients. The utility of the methods to diagnose IM should be tested on a larger panel of clinical samples or probably more likely on an animal model of IM.

In conclusion, we suggest that PCR/HRMA is a fast and reliable tool for routine screening of BAL samples for the differential diagnosis of pulmonary infiltrates in immunocompromised patients. Specific real-time PCR assays might be used to confirm positive results, to quantify the fungal load, or to monitor the response to therapy in patients with proven or probable IM.