Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2014 Sep;88(17):9927–9933. doi: 10.1128/JVI.00552-14

Interactions between E6, FAK, and GIT1 at Paxillin LD4 Are Necessary for Transformation by Bovine Papillomavirus 1 E6

Nicole Brimer 1, Ramon Wade 1,*, Scott Vande Pol 1,
Editor: M J Imperiale
PMCID: PMC4136348  PMID: 24942580

ABSTRACT

Bovine papillomavirus 1 E6 interacts with two similar proteins that regulate cell attachment and cell migration called paxillin (PXN) and HIC-5 (also known as HIC5, ARA55, HIC-5, TSC-5, and TGFB1I1). Despite the similarity between HIC-5 and paxillin, paxillin is required for E6 to transform mouse embryo fibroblasts while HIC-5 is not. Using mutants of paxillin, we found that dynamic competitive interactions between E6, focal adhesion kinase, and the GIT1 ARF-GAP protein for binding to paxillin are required but not sufficient for transformation by E6. Using mutants of paxillin and chimeric proteins between HIC-5 and paxillin, we demonstrate that a critical difference between HIC-5 and paxillin is within the LIM domains of paxillin that do not directly interact with E6. Mutational analysis indicates that at least six distinct domains of paxillin are required for E6 transformation.

IMPORTANCE Papillomaviruses cause epitheliomas in vertebrates through the actions of virus-encoded oncoproteins. Despite the immense diversity of papillomavirus types, our understanding of the mechanisms by which the virus-encoded E6 oncoproteins contribute to cell transformation is restricted to human papillomavirus types that are associated with cancer. Bovine papillomavirus 1 (BPV-1) E6 has served as a model system for studies of E6 structure and function. This study examines the mechanisms by which BPV-1 E6 association with the cellular focal adhesion adapter protein paxillin contributes to cell transformation and extends our knowledge of the diverse mechanisms by which papillomaviruses transform host cells.

INTRODUCTION

Papillomavirus E6 oncoproteins interact with cellular proteins by binding to an acidic 10-amino-acid amphipathic alpha-helical peptide displayed on the target protein, abbreviated as LXXLL here. E6 from bovine papillomavirus 1 (BPV-1) binds to LXXLL motifs found on the cellular adapter proteins paxillin (PXN) and HIC-5 (the product of the TGFB1I1 gene) (1, 2), the clathrin adapter AP1 (3), and the Notch transcriptional coactivator MAML1 (4, 5). The crystal structure of BPV-1 E6 in complex with a paxillin LXXLL motif has recently been solved (6). In BPV-1 E6-transformed cells, E6 is in a complex with both paxillin and MAML1 (4, 7), and paxillin-null mouse embryo fibroblasts (MEFs) are not transformed by E6 unless reconstituted with paxillin (7). While alpha genus anogenital human papillomavirus (HPV) E6 proteins primarily bind to an LXXLL motif on the ubiquitin ligase E6AP (810), a recent proteomic study that purified HPV E6 oncoproteins stably expressed in keratinocytes found primarily MAML1 peptides, but also paxillin peptides, associated with E6 oncoproteins from HPV-45, -17, and -92 (11).

Paxillin is essential for development in mice and Drosophila, with the null phenotype in mice resembling null phenotypes for essential components of integrin signaling (12, 13). Paxillin localizes to focal adhesions and associates with focal adhesion proteins that are implicated in the regulation of cell attachment, spreading, and migration, including FAK, GIT1, PAK, Src, and Crk (reviewed in reference 14 and illustrated in Fig. 1). FAK is the integrin-associated tyrosine kinase that autophosphorylates and initiates integrin-mediated signaling when cells attach to matrix (reviewed in reference 15). Paxillin is an essential component for the tyrosine phosphorylation of FAK, augmenting FAK's tyrosine phosphorylation when cells attach to matrix, and is essential for maintaining FAK tyrosine phosphorylation when cells are detached from matrix (16). As such, paxillin and FAK together initiate a cascade of signaling that results in FAK tyrosine phosphorylation and then the recruitment of Src family nonreceptor tyrosine kinases and Ras and Rho family G proteins. GIT1 and FAK compete to bind paxillin at LD4, and GIT1 is associated with Rac1 and thereby with the activation of PAK (17). Paxillin regulates focal adhesion turnover, as cells that have had paxillin deleted or that express paxillin mutants have delayed focal adhesion turnover and cell migration (18, 19), and paxillin has been shown to modulate the activities of proteins, including the Rho family of small GTP-binding proteins that are involved in regulating actin dynamics (reviewed in reference 20).

FIG 1.

FIG 1

Diagram of wild-type and mutant paxillin molecules used in this study. (A) Locations of five LD motifs (peptide motifs with the consensus sequence LXXLLXXL) and four zinc finger LIM domains. Y-31 and Y-118 are tyrosine phosphorylation sites. (B) Chimeric molecules between paxillin and HIC-5. The PXN–HIC-5 chimera joined aa 1 to 316 of paxillin to aa 219 to 461 of HIC-5. The HIC-5–PXN chimera joined aa 1 to 216 of HIC-5 to aa 315 to 559 of paxillin. PXN plus LD4 of HIC-5 contains a single amino acid change in PXN (E269R) to create the LD4 motif of HIC-5. The HIC-5 plus LD4 PXN chimera has a single amino acid change in the HIC-5 sequence (R160E) to create the LD4 motif of paxillin.

Paxillin is expressed in several splice isoforms in different cell types, but two predominant forms at 46 and 68 kDa are observed in Western blots. The 46-kDa form arises from internal translation initiation at methionine 133 and predominates when cells are confluent, with the 68-kDa form predominating at subconfluency (21). Paxillin contains 5 copies of an LXXLL-containing peptide motif termed LD1 through LD5 (consensus, LXXLLXXL) that serve as binding sites for cellular proteins; LD1 interacts with acropaxin and ILK (22, 23), LD2 interacts with focal adhesion kinase (FAK) and vinculin, and LD4 interacts with GIT1 and FAK (17). LD3 and LD4 can interact with the carboxy-terminal intracellular domain of integrin alpha-4 subunits in leukocytes, thereby recruiting paxillin to the integrin receptor complex (24), and LD3 has also been reported to interact with merlin (25). LD5 interaction partners remain uncharacterized, although LD5 is functionally required to support FAK tyrosine phosphorylation in embryonic stem (ES) cells (26). LD motifs 1, 2, and 4 also bind the E6 oncoprotein, as LD motifs may overlap LXXLL motifs that bind E6 (2, 6, 27). The carboxy terminus of paxillin contains 4 LIM domains: LIM domains 2 (LIM2) and 3 localize paxillin to focal adhesions (26, 28), and LIM1, -2, and -3 support the tyrosine phosphorylation of FAK in ES cells (26). LIM4 interacts with the tyrosine phosphatase PTP-PEST (16, 29).

HIC-5 is a paxillin family member that is structurally quite similar to paxillin but is differentially expressed in response to transforming growth factor beta (TGF-β) signaling (30). HIC-5 has been proposed to have diverse activities: a transcriptional coactivator activity for Sp1 (31) and steroid receptors (32), Smad coactivator activity (33), and tumor suppressor activity (34). However, HIC-5-null mice have grossly normal development but defects in platelet aggregation and vascular injury responses (35, 36). Another difference between HIC-5 and paxillin is that paxillin supports the tyrosine phosphorylation of FAK in cells detached from matrix and HIC-5 does not (21).

The regulation of cell spreading and migration by paxillin has obscured other roles paxillin might play in cell physiology. We have recently demonstrated that paxillin and the E6 binding LXXLL motifs of paxillin are required for transformation by BPV-1 E6, while the closely related protein HIC-5 did not support transformation by E6 (7). It has been proposed that BPV-1 E6 transforms through competition between E6 and cellular factors for interaction at the LXXLL sites that bind to E6 (termed LD motifs in paxillin and HIC-5) (27). In the current study, we demonstrate that neither simple competitive binding between BPV-1 E6 and cellular factors for interaction at paxillin LD motifs nor recruitment of a novel function by E6 to paxillin LD4 explain transformation by E6. Our data indicate that dynamic interactions between E6 and cellular factors binding to paxillin at LD4 are required for transformation by E6.

MATERIALS AND METHODS

Cells and cell culture.

Immortalized paxillin-null mouse embryo fibroblasts were a gift of James Casanova (University of Virginia) and were originally supplied by Sheila Thomas (12). Assays for anchorage-independent cell growth were performed as previously described (37).

Plasmids.

Glutathione-S transferase (GST) fusions to BPV-1 E6 and paxillin and paxillin mutants have been described previously (2). Paxillin LD4 point mutants were generated using the QuikChange site-directed mutagenesis system (Stratagene). All mutants were fully sequenced. The PXN–HIC-5 chimera joined amino acids (aa) 1 to 316 of paxillin to aa 219 to 461 of HIC-5. The HIC-5–PXN chimera joined aa 1 to 216 of HIC-5 to aa 315 to 559 of paxillin. Stable expression of E6, paxillin, HIC-5, and mutants was performed by sequential retroviral transduction, each with independent drug selection for resistance to puromycin, blasticidin, or hygromycin. Short hairpin RNAs (shRNAs) to murine FAK and GIT1 were commercially obtained (Open Biosource) and expressed from the pLKO vector. Anti-FAK shRNAs for shRNAs 1 to 6 were as follows: RHS3979-9593335, CCGGTGTGTCAGAGACAGATGACTACTCGAGTAGTCATCTGTCTCTGACACATTTTT; RHS3979-9593336, CCGGTGAGGAAGACACATACACCATCTCGAGATGGTGTATGTGTCTTCCTCATTTTT; RHS3979-98488716, CCGGGCCTTAACAATGCGTCAGTTTCTCGAGAAACTGACGCATTGTTAAGGCTTTTTG; RHS3979-9593332, CCGGGCAGAGATCATCGATGAGGAACTCGAGTTCCTCATCGATGATCTCTGCTTTTT; RHS3979-9593333, CCGGGTTGCCATCAATACCAAAGTTCTCGAGAACTTTGGTATTGATGGCAACTTTTT; and RHS3979-9593334, CCGGGACAGATGACTATGCAGAGATCTCGAGATCTCTGCATAGTCATCTGTCTTTT. shRNAs 1 to 5 for murine GIT1 were as follows: RMM3981-98068362, CCGGGCTAGTTGAGTGCCAGTATGACTCGAGTCATACTGGCACTCAACTAGCTTTTTG; RMM3981-98068370, CCGGCGAAAGCCTGATCACAAGAATCTCGAGATTCTTGTGATCAGGCTTTCGTTTTTG; RMM3981-98068378, CCGGGCTTTGTACCCTGTTCAGAAACTCGAGTTTCTGAACAGGGTACAAAGCTTTTTG; RMM3981-98068437, CCGGCCTACTTGTATCCCTGTCCTACTCGAGTAGGACAGGGATACAAGTAGGTTTTTG; and RMM3981-98068444, CCGGGCAAAGGGAGATCCACAAATTCTCGAGAATTTGTGGATCTCCCTTTGCTTTTTG. The pLKO.1 puro scramble shRNA lentiviral expression plasmid is Addgene plasmid 1864; the sequence of the hairpin is CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG. Overexpression of native E6 for in vitro binding assays was performed with the vaccinia virus T7 expression system (38).

Affinity purification and Western blotting.

A total of 107 cells per sample were lysed in NP-40 lysis buffer on ice (150 mM NaCl, 50 mM Tris, pH 7.5, 50 mM NaF, 5 mM sodium pyrophosphate, 1% NP-40, 0.01% phenylmethylsulfonyl fluoride [PMSF], 1 mM sodium vanadate, and 1 μg/ml leupeptin/aprotinin), clarified by centrifugation, equalized for protein content, and immune precipitated with the indicated antibodies or isolated on beads coated with immobilized GST fusion proteins, and then the washed beads were analyzed by Western blotting using peroxidase-coupled secondary antibodies and chemiluminescent detection (Millipore HRP luminol reagent) and digital image capture (Alpha-Innotech Fluorchem HD2 instrument).

Antibodies and reagents.

Mouse monoclonal antibodies to FAK (clones A2 from Upstate and 77 from Transduction Laboratories) and HIC-5 (Transduction Laboratories) and Flag, tubulin, and anti-phosphotyrosine clones 4G10 (Sigma), GIT1 (NeuroMab), and GFP (Chemicon) were obtained commercially. Rabbit antibody to phosphorylated tyrosine 397 of FAK was from BioSource International. Rabbit polyclonal anti-paxillin (26) and anti-E6 were described previously (7).

RESULTS

Individual LD motifs of paxillin, as well as all four LIM domains, are required for transformation by E6.

E6 binds to the individual LD motifs 1, 2, and 4, and it does not bind to LD3 or LD5 (7). We had previously shown that the combined mutation of all the E6 binding sites of paxillin, deletion of all the LIM domains, or deletion of the individual LIM1 and LIM4 domains of paxillin ablated transformation by E6 (7). To more fully define the features of paxillin required for transformation by E6, additional mutations in paxillin were made, and chimeras between HIC-5 and paxillin were constructed as illustrated in Fig. 1. Paxillin-null MEFs were first transduced with paxillin or paxillin mutants and then transduced with either empty vector or wild-type E6. Expression of both paxillin mutants and E6 was demonstrated by Western blotting (Fig. 2 and 3). Examination of Fig. 2 and 4 shows that reconstitution of paxillin-minus cells with paxillin increased E6 expression levels, possibly because E6 was stabilized by association with LXXLL binding partners, just as we and the Banks laboratory have shown for HPV-16 E6 (39). Deletion of the individual LD motifs LD4 and LD5 in full-length paxillin ablated transformation by E6, while deletion of the individual LD motifs LD1, -2, and -3 had little effect (Fig. 2A). Because paxillin is expressed in both a full-length 68-kDa form and an internally translated 46-kDa form beginning at amino acid 134 (21), we also determined the requirement for LD motifs in the 46-kDa form of paxillin. Surprisingly, while LD2 was not required in the context of full-length 68-kDa paxillin, both LD2 and LD4 mutation in 46-kDa paxillin ablated transformation by E6 (Fig. 2B). This indicates that functions in the first 133 amino acids of 68-kDa paxillin can complement the requirement for LD2 in 46-kDa paxillin. All of the LIM deletion mutants of paxillin were defective for transformation by E6 (Fig. 3).

FIG 2.

FIG 2

Role of paxillin LD motifs in transformation by E6. (A) Expression of paxillin LD deletion mutants in paxillin-null MEFS and transformation by BPV-1 E6. Retrovirus-transduced paxillin-null MEFs were drug selected with puromycin and then retransduced with retrovirus encoding E6 (hygromycin selected), as indicated by the plus signs below the corresponding lanes. The black bars connect paired probes of the same blot. Transformation by anchorage-independent colony formation was performed as described in Materials and Methods, with normalized results from 5 independent experiments (Exp) shown below each corresponding lane. WT, wild type; WB, Western blot; nd, not done. (B) Roles of LD2 and LD4 motifs in the context of 46-kDa paxillin in transformation by E6. The indicated paxillin mutants were introduced by retroviral transduction and then transduced with empty retroviral vector or E6 retrovirus. Transformation was assayed by anchorage-independent colony formation and is shown normalized to wild-type paxillin. Three independent experiments are shown.

FIG 3.

FIG 3

Minimal fragment of paxillin required to support transformation by E6. The fragments of paxillin illustrated in Fig. 1 were retrovirally introduced into paxillin-null MEFs and tested for transformation as described in the legend to Fig. 2.

FIG 4.

FIG 4

Expression of paxillin–HIC-5 chimeras in paxillin-null MEFs and transformation by E6. Western blots and transformation assays were performed as described in the legend to Fig. 2. The results shown in panels A and B are from independently transduced and selected cell lines. The HIC-5 plus LD4 PXN and HIC-5–PXN chimeras comigrate with HIC-5. The difference in E6 transformation between the PXN–HIC-5 chimera and the HIC-5–PXN chimera was statistically significant at a P value of <0.03 by Student's t test.

The complexity of these observations prompted us to further define a minimal paxillin molecule for transformation by E6. The deletion mutants illustrated in Fig. 1A were expressed and tested for transformation when coexpressed with E6; E6 transformation required a minimal fragment of paxillin beginning at the end of LD3 and extending to the carboxy terminus (amino acids 225 to 559) (Fig. 3). This paxillin fragment contains a single E6 binding site at LD4, LD5, and all 4 LIM domains. Although not shown in Fig. 2 and 3, in no case was transformation observed when paxillin or any of the paxillin mutants used in this study were expressed without E6 (N. Brimer and S. Vande Pol, unpublished data).

The fact that paxillin aa 225 to 559 has a single E6 binding site at LD4 suggested that interactions at LD4 are critical for transformation by E6. Comparison of the LD4 motifs of HIC-5 and paxillin reveals a single amino acid change, raising the possibility that this difference in LD4 could explain the loss of transformation by E6 in the presence of HIC-5 compared to paxillin. A point mutation in paxillin (E269R) (PXN + LD4 HIC-5 in Fig. 1 and 4) creates the HIC-5 LD4 in paxillin, and a point mutation in HIC-5 (R160E) (HIC-5 + LD4 PXN in Fig. 1 and 4) creates the paxillin LD4 motif in the context of full-length HIC-5. E6 transformed cells with PXN plus LD4 HIC-5 but did not transform cells expressing HIC-5 plus LD4 PXN (Fig. 4), indicating that the difference in LD4 motifs between paxillin and HIC-5 is not fully responsible for their difference in supporting E6 transformation. E6 bound in vitro somewhat better to PXN LD4 than to HIC-5 LD4 (Fig. 5).

FIG 5.

FIG 5

Binding of GIT1, FAK, and E6 to paxillin LD4 or LD4 mutants correlated with transformation. (A) The sequence of paxillin LD4 is shown at the top. GST fusions to paxillin amino acids 226 to 301 encompassing the LD4 motif, or mutants of LD4 in the same paxillin fragment, were prepared and purified from bacterial expression and used as an affinity matrix for binding to MEF lysate. Bound proteins were eluted with SDS-PAGE sample buffer, resolved by SDS-PAGE, and analyzed by Western blotting with membranes first probed with anti-GIT1 (top) and then reprobed with anti-FAK (middle) and then anti-E6. Ponceau red staining of the membrane revealed GST fusions. E6 was expressed in MEFs by vaccinia virus expression. The vertical black lines indicate where irrelevant samples on the gel were excised. (B) Expression of paxillin LD4 mutants and transformation by E6. Experiments were performed as described in the legend to Fig. 2.

One model has proposed that E6 transforms through competitive displacement of cellular factors that bind the LD motifs of paxillin (27). Since neither deletion of the individual LD motifs nor deletion of all the E6 binding LD motifs (LD1, -2, and -4) results in cellular transformation by the mutant paxillin in the absence of E6 (Fig. 2) (7; N. Brimer, unpublished data), this suggests that a simple competitive-displacement model mediated by E6 binding to LD motifs is unlikely. E6 could also transform through first binding to an LD motif and then recruiting a novel function to paxillin. This would be analogous to HPV-16 E6 binding to the LXXLL peptide of E6AP and then undergoing a conformational change that then recruits p53 to E6 (40). To test this hypothesis, mutations were constructed in the LD4 motif of paxillin with the aim of identifying an LD4 mutant that would bind to E6 but not to the cellular proteins FAK and GIT1, which normally bind to paxillin LD4. The LD4 mutants were tested in the context of a GST-LD4 fusion protein for in vitro binding to FAK, GIT1, and E6. Mutation of the first leucine of the LD4 LDELMASL sequence ablated the binding of GIT1, FAK, and E6, while mutation of the terminal leucine of LD4 ablated binding of GIT1 and FAK but retained binding of E6 (Fig. 5). Both leucine mutations incorporated into full-length 68-kDa paxillin resulted in the loss of transformation by E6 when introduced into paxillin-null MEFs, indicating that E6 does not transform through the displacement of FAK and GIT1 and the recruitment of a novel factor to paxillin LD4 (Fig. 5).

It is possible that even though E6 binds to LD4 to transform MEFs, GIT1 and or FAK also plays a role in transformation by E6. To address this possibility, GIT1 and FAK expression was suppressed through the introduction of stably expressed shRNA. There was a trend in which those cell lines with the greatest repression of either FAK or GIT1 expression were also more repressed for E6 transformation, suggesting that both FAK and GIT1 might play a role in transformation by E6 (Fig. 6). Thus, the loss of GIT1 and FAK interaction at LD4 with the PXN L274A mutation (Fig. 5B) correlates with decreased transformation by E6 in cells where FAK and GIT1 are suppressed by shRNA expression (Fig. 6).

FIG 6.

FIG 6

Effects of reduced FAK and GIT1 expression upon transformation by E6. Paxillin and shRNAs to GIT1 or FAK and E6 were sequentially transduced and selected by hygromycin, puromycin, and blasticidin, respectively. The selected cells were tested for anchorage-independent colony formation. The vertical black lines indicate where irrelevant samples on the gel were excised. The expression results are normalized to tubulin expression. (A) Suppression of GIT1 expression and transformation by E6. (B) Suppression of FAK expression and transformation by E6.

Finally, we examined E6 transformation in cells that express the chimeras of HIC-5 and PXN that are illustrated in Fig. 1B. We previously showed that these chimeras are stably expressed, localize to focal adhesions, and modulate cell spreading (21). Paxillin-null MEFs express HIC-5 constitutively, and yet, HIC-5 fails to support E6 transformation in the absence of PXN. We introduced either the amino-terminal or carboxy-terminal domain of paxillin as a chimera with HIC-5 into paxillin-null MEFs and then introduced E6 and tested for transformation. Both domains of paxillin were able to augment transformation compared to full-length HIC-5, but the amino-terminal domain of paxillin was significantly more active in this assay than the LIM domains (Fig. 4). These results demonstrate that both the amino terminus and the LIM domains of paxillin differ from the corresponding domains of HIC-5 and that both domains contribute to transformation by E6.

DISCUSSION

The essential role of paxillin, but not the closely related HIC-5 protein, in transformation by E6 prompted us to explore the differences between HIC-5 and paxillin that allow transformation in cells expressing E6. We found that all the LIM domains of paxillin are required, as are LD4 and LD5, but that the further requirement for LD motifs is context dependent. LD2, which binds FAK, is required in the context of 46-kDa paxillin but not in 68-kDa paxillin or when further deletions are made that remove amino acids from LD2 through LD3. Thus, both sequences in paxillin from amino acids 1 to 132 and sequences from 153 to 225 alter the phenotype of LD2 mutations. The 225-to-559 fragment that supports E6 transformation (albeit at a reduced level) contains LD5, a single E6 binding site at LD4, and all 4 LIM domains. Further deletion of LD4 or LIM4 from the 225-to-559 fragment ablated transformation. In experiments not shown here, in-frame deletion of LD5 from the 225-to-559 fragment also ablated transformation by E6 (Brimer and Vande Pol, unpublished). This demonstrates that six domains of paxillin (LD4, LD5, and all 4 LIM domains) are required for transformation by E6.

We have recently shown that the same 225-to-559 paxillin fragment supports the tyrosine phosphorylation of FAK in cells detached from matrix (21). FAK becomes tyrosine phosphorylated on Y397 in paxillin-null cells in response to cell attachment to immobilized matrix, and Y397 phosphorylation is lost upon cell detachment. However, in paxillin-expressing cells, residual Y397 phosphorylation remains in detached cells, and the 225-to-559 paxillin fragment supports this activity while HIC-5 does not. This same 225-to-559 fragment of paxillin also augmented transformation by G12V–K-Ras (21). This suggests that one role of paxillin in supporting E6 transformation could be supporting the tyrosine phosphorylation of FAK in detached cells. Concordant with this hypothesis is the sensitivity of E6 transformation to the knockdown of FAK expression. Discordant with this is the finding that the HIC-5–PXN chimera, which supports attachment-independent FAK Y397 phosphorylation and transformation by G12V–K-RAS, only modestly supports transformation by E6 (21) (Fig. 4), which was more strongly supported by the PXN–HIC-5 chimera, which does not support attachment-independent phosphorylation of FAK (21). Thus, while attachment-independent FAK Y397 phosphorylation may contribute to E6 transformation, it is not a sufficient activity.

It is possible that E6 could act like the high-risk HPV-16 E6 and that upon E6 binding to the LXXLL LD4 motif of paxillin, it would act as an adapter protein to recruit another cellular protein, the E6-paxillin complex, just as HPV-16 E6 recruits p53 to the E6–E6AP protein complex. The LD4 L274A mutation eliminates that simple model, because the mutant still binds to E6 and does not bind to either FAK or GIT1 but is defective for supporting E6 transformation. It is still possible that E6 recruits a novel activity to paxillin by binding LD4, but transformation also requires, in addition, the normal competition between FAK and GIT1 for binding to LD4. Because the L274A mutation ablates the binding of FAK and GIT1 to LD4, such a possibility cannot be determined from our experiments. Despite extensive mutagenesis and binding experiments, we were unsuccessful at identifying mutants of LD4 that clearly discriminated between the binding of FAK and GIT1 at LD4. Thus, further mutation of LD4 is unlikely to further illuminate the mechanism of transformation by E6. shRNA experiments, however, implicated both FAK and GIT1 in transformation by E6, as knockdown of each reduced transformation by E6.

There are several questions that arise from these observations. LD5 is essential for augmentation of FAK tyrosine phosphorylation upon cell attachment or in detached cells, yet unlike LD2 and LD4, LD5 has no detectable interaction with FAK (21, 41). We have not as yet been successful in identifying specific LD5 binding proteins through affinity purification, nor have LD5-interacting proteins been described elsewhere. It is also unclear why the paxillin LIM domains were more active in supporting transformation by either K-Ras or E6 than the LIM domains of HIC-5. Our own affinity purification experiments with PXN and HIC-5 have not yet identified candidate proteins to explain this difference. However, as noted above, the PXN LIM domains supported attachment-independent tyrosine phosphorylation of FAK, while the HIC-5 LIM domains did not (21). Differences between the HIC-5- and paxillin-associated factors that could explain the difference in supporting the attachment-independent tyrosine phosphorylation of FAK would likely be important, not just in E6 transformation, but in other aspects of cancer biology.

ACKNOWLEDGMENT

This work was supported by NIH CA134737 and CA120352 to S.V.P.

Footnotes

Published ahead of print 18 June 2014

REFERENCES

  • 1.Tong X, Howley PM. 1997. The bovine papillomavirus E6 oncoprotein interacts with paxillin and disrupts the actin cytoskeleton. Proc. Natl. Acad. Sci. U. S. A. 94:4412–4417. 10.1073/pnas.94.9.4412 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Vande Pol SB, Brown MC, Turner CE. 1998. Association of bovine papillomavirus type 1 E6 oncoprotein with the focal adhesion protein paxillin through a conserved protein interaction motif. Oncogene 16:43–52. 10.1038/sj.onc.1201504 [DOI] [PubMed] [Google Scholar]
  • 3.Tong X, Boll W, Kirchhausen T, Howley PM. 1998. Interaction of the bovine papillomavirus E6 protein with the clathrin adaptor complex AP-1. J. Virol. 72:476–482 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Brimer N, Lyons C, Wallberg AE, Vande Pol SB. 2012. Cutaneous papillomavirus E6 oncoproteins associate with MAML1 to repress transactivation and NOTCH signaling. Oncogene 31:4639–4646. 10.1038/onc.2011.589 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Tan MJ, White EA, Sowa ME, Harper JW, Aster JC, Howley PM. 2012. Cutaneous beta-human papillomavirus E6 proteins bind Mastermind-like coactivators and repress Notch signaling. Proc. Natl. Acad. Sci. U. S. A. 109:E1473–E1480. 10.1073/pnas.1205991109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Zanier K, Charbonnier S, Sidi AO, McEwen AG, Ferrario MG, Poussin-Courmontagne P, Cura V, Brimer N, Babah KO, Ansari T, Muller I, Stote RH, Cavarelli J, Vande Pol S, Trave G. 2013. Structural basis for hijacking of cellular LxxLL motifs by papillomavirus E6 oncoproteins. Science 339:694–698. 10.1126/science.1229934 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wade R, Brimer N, Vande Pol S. 2008. Transformation by bovine papillomavirus type 1 E6 requires paxillin. J. Virol. 82:5962–5966. 10.1128/JVI.02747-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Huibregtse JM, Scheffner M, Howley PM. 1993. Localization of the E6-AP regions that direct human papillomavirus E6 binding, association with p53, and ubiquitination of associated proteins. Mol. Cell. Biol. 13:4918–4927 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Chen JJ, Hong Y, Rustamzadeh E, Baleja JD, Androphy EJ. 1998. Identification of an alpha helical motif sufficient for association with papillomavirus E6. J. Biol. Chem. 273:13537–13544. 10.1074/jbc.273.22.13537 [DOI] [PubMed] [Google Scholar]
  • 10.Brimer N, Lyons C, Vande Pol SB. 2007. Association of E6AP (UBE3A) with human papillomavirus type 11 E6 protein. Virology 358:303–310. 10.1016/j.virol.2006.08.038 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.White EA, Kramer RE, Tan MJ, Hayes SD, Harper JW, Howley PM. 2012. Comprehensive analysis of host cellular interactions with human papillomavirus E6 proteins identifies new E6 binding partners and reflects viral diversity. J. Virol. 86:13174–13186. 10.1128/JVI.02172-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hagel M, George EL, Kim A, Tamimi R, Opitz SL, Turner CE, Imamoto A, Thomas SM. 2002. The adaptor protein paxillin is essential for normal development in the mouse and is a critical transducer of fibronectin signaling. Mol. Cell. Biol. 22:901–915. 10.1128/MCB.22.3.901-915.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Chen GC, Turano B, Ruest PJ, Hagel M, Settleman J, Thomas SM. 2005. Regulation of Rho and Rac signaling to the actin cytoskeleton by paxillin during Drosophila development. Mol. Cell. Biol. 25:979–987. 10.1128/MCB.25.3.979-987.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Deakin NO, Turner CE. 2008. Paxillin comes of age. J. Cell Sci. 121:2435–2444. 10.1242/jcs.018044 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Mitra SK, Schlaepfer DD. 2006. Integrin-regulated FAK-Src signaling in normal and cancer cells. Curr. Opin. Cell Biol. 18:516–523. 10.1016/j.ceb.2006.08.011 [DOI] [PubMed] [Google Scholar]
  • 16.Shen Y, Schneider G, Cloutier JF, Veillette A, Schaller MD. 1998. Direct association of protein-tyrosine phosphatase PTP-PEST with paxillin. J. Biol. Chem. 273:6474–6481. 10.1074/jbc.273.11.6474 [DOI] [PubMed] [Google Scholar]
  • 17.Turner CE, Brown MC, Perrotta JA, Riedy MC, Nikolopoulos SN, McDonald AR, Bagrodia S, Thomas S, Leventhal PS. 1999. Paxillin LD4 motif binds PAK and PIX through a novel 95-kD ankyrin repeat, ARF-GAP protein: a role in cytoskeletal remodeling. J. Cell Biol. 145:851–863. 10.1083/jcb.145.4.851 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Webb DJ, Brown CM, Horwitz AF. 2003. Illuminating adhesion complexes in migrating cells: moving toward a bright future. Curr. Opin. Cell Biol. 15:614–620. 10.1016/S0955-0674(03)00105-4 [DOI] [PubMed] [Google Scholar]
  • 19.Webb DJ, Donais K, Whitmore LA, Thomas SM, Turner CE, Parsons JT, Horwitz AF. 2004. FAK-Src signalling through paxillin, ERK and MLCK regulates adhesion disassembly. Nat. Cell Biol. 6:154–161. 10.1038/ncb1094 [DOI] [PubMed] [Google Scholar]
  • 20.Hall A. 2012. Rho family GTPases. Biochem. Soc. Trans. 40:1378–1382. 10.1042/BST20120103 [DOI] [PubMed] [Google Scholar]
  • 21.Wade R, Brimer N, Lyons C, Vande Pol S. 2011. Paxillin enables attachment-independent tyrosine phosphorylation of focal adhesion kinase and transformation by RAS. J. Biol. Chem. 286:37932–37944. 10.1074/jbc.M111.294504 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Nikolopoulos SN, Turner CE. 2000. Actopaxin, a new focal adhesion protein that binds paxillin LD motifs and actin and regulates cell adhesion. J. Cell Biol. 151:1435–1448. 10.1083/jcb.151.7.1435 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Nikolopoulos SN, Turner CE. 2001. Integrin-linked kinase (ILK) binding to paxillin LD1 motif regulates ILK localization to focal adhesions. J. Biol. Chem. 276:23499–23505. 10.1074/jbc.M102163200 [DOI] [PubMed] [Google Scholar]
  • 24.Chua GL, Patra AT, Tan SM, Bhattacharjya S. 2013. NMR structure of integrin alpha4 cytosolic tail and its interactions with paxillin. PLoS One 8:e55184. 10.1371/journal.pone.0055184 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Manetti ME, Geden S, Bott M, Sparrow N, Lambert S, Fernandez-Valle C. 2012. Stability of the tumor suppressor merlin depends on its ability to bind paxillin LD3 and associate with beta1 integrin and actin at the plasma membrane. Biol. Open 1:949–957. 10.1242/bio.20122121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Wade R, Vande Pol S. 2006. Minimal features of paxillin that are required for the tyrosine phosphorylation of focal adhesion kinase. Biochem. J. 393:565–573. 10.1042/BJ20051241 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Tong X, Salgia R, Li JL, Griffin JD, Howley PM. 1997. The bovine papillomavirus E6 protein binds to the LD motif repeats of paxillin and blocks its interaction with vinculin and the focal adhesion kinase. J. Biol. Chem. 272:33373–33376. 10.1074/jbc.272.52.33373 [DOI] [PubMed] [Google Scholar]
  • 28.Brown MC, Perotta JA, Turner CE. 1996. Identification of LIM3 as the principal determinant of paxillin focal adhesion localization and characterization of a novel motif on paxillin directing vinculin and focal adhesion kinase binding. J. Cell. Biol. 135:1109–1123. 10.1083/jcb.135.4.1109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Cote JF, Turner CE, Tremblay ML. 1999. Intact LIM 3 and LIM 4 domains of paxillin are required for the association to a novel polyproline region (Pro 2) of protein-tyrosine phosphatase-PEST. J. Biol. Chem. 274:20550–20560. 10.1074/jbc.274.29.20550 [DOI] [PubMed] [Google Scholar]
  • 30.Shibanuma M, Mashimo J, Kuroki T, Nose K. 1994. Characterization of the TGF beta 1-inducible hic-5 gene that encodes a putative novel zinc finger protein and its possible involvement in cellular senescence. J. Biol. Chem. 269:26767–26774 [PubMed] [Google Scholar]
  • 31.Shibanuma M, Kim-Kaneyama JR, Sato S, Nose K. 2004. A LIM protein, Hic-5, functions as a potential coactivator for Sp1. J. Cell. Biochem. 91:633–645. 10.1002/jcb.10754 [DOI] [PubMed] [Google Scholar]
  • 32.Heitzer MD, DeFranco DB. 2006. Hic-5/ARA55, a LIM domain-containing nuclear receptor coactivator expressed in prostate stromal cells. Cancer Res. 66:7326–7333. 10.1158/0008-5472.CAN-05-2379 [DOI] [PubMed] [Google Scholar]
  • 33.Wang H, Song K, Krebs TL, Yang J, Danielpour D. 2008. Smad7 is inactivated through a direct physical interaction with the LIM protein Hic-5/ARA55. Oncogene 27:6791–6805. 10.1038/onc.2008.291 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Shibanuma M, Mochizuki E, Maniwa R, Mashimo J, Nishiya N, Imai S, Takano T, Oshimura M, Nose K. 1997. Induction of senescence-like phenotypes by forced expression of hic-5, which encodes a novel LIM motif protein, in immortalized human fibroblasts. Mol. Cell. Biol. 17:1224–1235 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Kim-Kaneyama JR, Takeda N, Sasai A, Miyazaki A, Sata M, Hirabayashi T, Shibanuma M, Yamada G, Nose K. 2011. Hic-5 deficiency enhances mechanosensitive apoptosis and modulates vascular remodeling. J. Mol. Cell. Cardiol. 50:77–86. 10.1016/j.yjmcc.2010.09.024 [DOI] [PubMed] [Google Scholar]
  • 36.Kim-Kaneyama JR, Miyauchi A, Lei XF, Arita S, Mino T, Takeda N, Kou K, Eto K, Yoshida T, Miyazaki T, Shioda S, Miyazaki A. 2012. Identification of Hic-5 as a novel regulatory factor for integrin alphaIIbbeta3 activation and platelet aggregation in mice. J. Thromb. Haemost. 10:1867–1874. 10.1111/j.1538-7836.2012.04856.x [DOI] [PubMed] [Google Scholar]
  • 37.Bohl J, Das K, Dasgupta B, Vande Pol SB. 2000. Competitive binding to a charged leucine motif represses transformation by a papillomavirus E6 oncoprotein. Virology 271:163–170. 10.1006/viro.2000.0316 [DOI] [PubMed] [Google Scholar]
  • 38.Elroy-Stein O, Fuerst TR, Moss B. 1989. Cap-independent translation of mRNA conferred by encephalomyocarditis virus 5′ sequence improves the performance of the vaccinia virus/bacteriophage T7 hybrid expression system. Proc. Natl. Acad. Sci. U. S. A. 86:6126–6130. 10.1073/pnas.86.16.6126 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Tomaic V, Pim D, Banks L. 2009. The stability of the human papillomavirus E6 oncoprotein is E6AP dependent. Virology 393:7–10. 10.1016/j.virol.2009.07.029 [DOI] [PubMed] [Google Scholar]
  • 40.Ansari T, Brimer N, Vande Pol SB. 2012. Peptide interactions stabilize and restructure human papillomavirus type 16 E6 to interact with p53. J. Virol. 86:11386–11391. 10.1128/JVI.01236-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Wade R, Bohl J, Vande Pol S. 2002. Paxillin null embryonic stem cells are impaired in cell spreading and tyrosine phosphorylation of focal adhesion kinase. Oncogene 21:96–107. 10.1038/sj.onc.1205013 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES