Abstract
Objectives:
The aim was to evaluate the relationship of the K-primer variant of the transforming growth factor-alpha (TGF-α) gene and C677T variant of the methylenetetrahydrofolate reductase (MTHFR) gene with nonsyndromic cleft lip and palate (CL/P) in the Indian population.
Setting and Sample Population:
The study group consisted of DNA samples of 25 subjects with nonsyndromic CL with or without cleft palate and 25 unrelated controls, already existing in the Department of Orthodontics, D.A.P.M.R.V. Dental College, Bengaluru, Karnataka, India.
Materials and Methods:
The DNA samples were divided into two categories: Group A which included the 25 subjects with nonsyndromic CL/P; and Group B, which consisted of the 25 unrelated controls. The polymerase chain reaction (PCR) test was done for amplification of the region of interest from the DNA samples. Restriction digestion was then performed on the amplified product using the restriction enzyme HinfI, separately for each of the variants. The digested PCR products were separated into channels on a 1.5% agarose gel containing ethidium bromide in an electrophoretic chamber. A U.V. transilluminator was used to see the specific bands of base pairs of the digested PCR products.
Results:
In Group A, the TGF-α gene variant was present in 16 subjects (P = 0.001) and MTHFR gene variant was present in 8 subjects (P = 0.185). A combination of both gene variants were present in seven subjects, which was an interesting finding. In Group B, four subjects tested positive for the TGF-α and MTHFR gene variants.
Conclusions:
The TGF-α gene variant and a combination of TGF-α + MTHFR gene variants significantly contribute to the development of nonsyndromic CL/P and can be considered as genetic markers for Indian population. The MTHFR gene variant, though a minor risk factor, cannot be considered as a genetic marker.
Keywords: Methylenetetrahydrofolate reductase, nonsyndromic cleft lip and palate, transforming growth factor-alpha
Introduction
Orofacial clefts, particularly nonsyndromic cleft lip (CL) with or without palate are the most common craniofacial deformities affecting 1 in every 700-1000 births worldwide, with significant medical, psychological, economic, and social ramifications.[1,2,3]
The etiology of orofacial clefts is multifactorial and involves a complex interplay of genetic and environmental factors. The key to the determination of the etiology of malocclusion, and its treatability lies in the ability to differentiate the effect of genes and environment on the craniofacial skeleton in a particular individual.[4]
Various efforts have been made to understand the etiology of CL and palate (CL/P) so as to predict its occurrence and to prevent it from occurring in the future. Recently, using a combination of epidemiology, careful phenotyping, genome-wide association studies and analysis of animal models, several distinct genetic and environmental risk factors have been identified and confirmed for nonsyndromic CL/P. These findings have advanced our understanding of developmental biology and created new opportunities for clinical research.[5] Several candidate genes like the transforming growth factor-alpha (TGF-α), methylenetetrahydrofolate reductase (MTHFR), VAX, BMP4, MSX1, TGF-β3, RARA, IRF6, BCL3 etc., have been identified in studies conducted on populations of diverse ethnic backgrounds, with conflicting results.
Transforming growth factor-alpha is located on human chromosome 2p13. During craniofacial development, it is expressed in the medial edge of epithelium of fusing palatal shelves and promotes synthesis of extracellular matrix and mesenchymal cell migration into the palate.[6]
Methylenetetrahydrofolate reductase gene is located on human chromosome 1p36 and it plays a key role in folate metabolism. Deficiency of nutritional folic acid during embryonic development has been proposed as a candidate environmental factor in the etiology of CL/P. It has also been hypothesized that genetic variants in the enzymes controlling folate metabolism might play a role in the susceptibility of oral clefts.[7,8,9,10]
This study was undertaken to evaluate the association of TGF-α K-primer variant and MTHFR C677T variants with nonsyndromic CL/P in the Indian population.
Materials and Methods
Patients and DNA samples
The study group consisted of DNA samples of 25 subjects with nonsyndromic CL/P and 25 unrelated controls, already existing in the Department of Orthodontics, D.A.P.M.R.V. Dental College, Bengaluru, Karnataka, India. The CL/P phenotype spectrum included unilateral or bilateral CL with or without cleft palate.
Inclusion criteria
The presence of nonsyndromic CL with or without cleft palate on clinical examination.
Exclusion criteria
Cleft lip and palate associated with any:
History of developmental disabilities, including learning disabilities and attention deficits, hearing impairment or abnormalities, which may be the first indication of an underlying syndromic genetic disorder
Family history of orofacial clefts and related conditions, including any additional major associated anomalies (e.g. cardiac defects and eye and brain anomalies)
History of maternal illnesses
Medications (e.g. anticonvulsants and retinoic acid derivatives) during pregnancy
Tobacco use, smoking during pregnancy
Ethanol intake during pregnancy.
They were categorized into two groups:
Group A:
DNA samples of 25 subjects with nonsyndromic CL/P
Group B: DNA samples of 25 unrelated controls.
Materials used in the present study
The following reagents were used to carry out the polymerase chain reaction (PCR) test and digestion with restriction enzyme Hinf1:
Taq polymerase (0.5 U/L μl): The enzyme which selectively amplifies the target DNA
-
PCR reaction buffer (2.5 μl): This buffer consists of:
- Tris. HCl and KCl: To maintain the pH of the PCR reaction buffer
- MgCl2: It contributes Mg+2 which acts as a cofactor for Taq polymerase to function and carry out the polymerization reaction.
Deoxynucleoside triphosphates (2.5 μl): It is used to supply the necessary nucleotides (A, T, C, G) for the reaction to occur
Distilled water: To make up for the volume so that the reaction is carried out
Agarose gel: It is a polymer which has minute pores and enables separation of DNA fragments based on the size
Ethidium bromide: It is a fluorescent dye which binds to the DNA and illuminates with U.V. transilluminator on gel documentation
Restriction enzyme Hinf1 (1 μl): It is an enzyme that cuts double-stranded or single stranded DNA at specific recognition nucleotide sequences known as restriction sites. It was added to the PCR amplified DNA for its digestion.
Genotype analysis
Genotyping of the subjects was based on PCR amplification of the DNA fragments. The primer sequence for each of the gene variants and the conditions of the PCR are mentioned below:
Gene variant primer sequence PCR conditions product size (bp).
K-primer GAGACGGACTCCTGTTCACCTAGG 94°C, 1 min 345.
C677T CAAAGGCCACCCCGAAGC 94°C, 1 min 246.
For restriction fragment length polymorphism analysis of the variants, the Hinfl restriction enzyme was used.
After digestion with the restriction enzyme, the DNA fragments were analyzed by electrophoresis using 2.5% agarose gels. A U.V. transilluminator was used to see the specific bands of base pairs of the digested PCR products.
Statistical analysis
The Chi-square test was carried out and P < 0.05 were considered to indicate statistical significance. The statistical software namely SPSS 11.0 (SPSS Inc.) and Systat 8.0 (Systat Software Inc.) were used for the analysis of the data and Microsoft word and Excel have been used to generate tables.
Results
Transforming growth factor-alpha K-primer variant
The size of the amplified PCR product was 345 bp [Figure 1]. After digestion with the HinfI enzyme, the amplified product was completely digested with one restriction site and two specific bands of 67 bp and 278 bp [Figure 2] in 16 subjects from Group A (P = 0.001) and four subjects from Group B, indicating the presence of variant.
Figure 1.

The amplified polymerase chain reaction product of the K-primer variant (345 bp)
Figure 2.

Polymerase chain reaction products for the K-primer variant after digestion with HinfI enzyme
Methylenetetrahydrofolate reductase C677T variant
An amplified product of 246 bp was obtained after PCR [Figure 3]. Digestion of the amplified product with HinfI enzyme resulted in one restriction site and two specific bands of 175 bp and 71 bp [Figure 4] in only eight subjects from Group A (P = 0.185) and four subjects from Group B. This indicated the presence of variant.
Figure 3.

The amplified polymerase chain reaction product of the C677T variant (246 bp)
Figure 4.

Polymerase chain reaction products for the C677T variant after digestion with HinfI enzyme
Interestingly, it was observed that few subjects showed the presence of more than one gene variant. A combination of TGF-α + MTHFR was found in seven subjects (P = 0.004).
Discussion
Identification of the genes involved in the development of the human craniofacial region can serve as a first step towards developing a better understanding of the diagnosis, prevention and treatment of developmental anomalies of this region.
The identification of genetic risk factors of nonsyndromic CL/P has been the subject of intensive research and numerous candidate genes such as TGF-β3, RARA, IRF6, BCL3, TGF-α, and MTHFR have been identified in studies conducted on populations of diverse ethnic backgrounds. In a study done by Singh et al.[11] in the Indian population, the TGF-β3 gene was found to be associated with nonsyndromic CL/P. However, the role of TGF-α and MTHFR genes in causing nonsyndromic CL/P in the Indian population has not been previously studied.
Therefore in this study, the presence of the TGF-α and MTHFR gene variants was assessed in a sample of 50 subjects.
In Group A, 16 out of 25 subjects, tested positive for the presence of TGF-α variant which was statistically strongly significant [Table 1]. This indicates that the TGF-α gene variant contributes to the occurrence of nonsyndromic CL/P in our population. This is in accordance with studies done by Ardinger et al. in a Caucasian population,[12] Holder et al. in a British population,[13] Jara et al. in a South American population,[14] Tanabe et al. in a Japanese population,[15] Lu et al. in the Chinese population[16] and Letra et al. in the Brazilian population.[17] However, this is contrary to a study done by Lidral et al. in the Philipines[18] and Hecht et al. in Rochester,[19] which may be due to genetic differences in that population.
Table 1.
The presence of TGF-α, MTHFR and a combination of TGF-α+MTHFR gene variants, in groups A and B

The MTHFR gene variant did not show any significant association with nonsyndromic CL/P cases, since only 8 out of 25 subjects, tested positive for the presence of variant [Table 1]. The results of this study indicate that MTHFR could be a minor risk factor but does not significantly contribute to orofacial clefting in the Indian population. This is in accordance with studies done by Brandalize et al. in a Brazilian population,[20] van Rooij et al. in The Netherlands,[21] Reutter et al. in a Central European population,[22] and Grunert et al. in a German population.[23] This is contrary to the results of the studies done by Jagomägi et al. in Estonia,[24] Jugessur et al. in Norway,[25] Shotelersuk et al. in Thailand[26] and Pezzetti et al. in Italy[27] which can be attributed to genetic differences in these populations.
It was observed that seven subjects in Group A showed the presence of both the gene variants, that is, TGF-α + MTHFR and none of the subjects in Group B. The correlation of TGF-α + MTHFR gene variants with nonsyndromic CL/P was found to be significant (P = 0.004) [Table 1]. This was an interesting observation as it throws light on the polygenetic nature of CL/P.
In Group B (controls), eight subjects showed the presence of the gene variants – four tested positive for TGF-α and four for the MTHFR gene variant [Table 1]. Whether this attributes to the pleotrophic nature of the TGF-α and MTHFR gene variants is a matter of further study.
Of 25 subjects with nonsyndromic CL/P, eight subjects did not show the presence of either of the gene variants. This suggests the possibility of the involvement of other candidate genes such as MSX1, TGF-β, IRF6, BCL3, RARA, etc., which have been established as factors contributing to the development of orofacial clefts in diverse populations.
The findings of this study suggest that the TGF-α gene variant and a combination of TGF-α + MTHFR gene variants significantly contribute to the development of nonsyndromic CL/P and can be considered as genetic markers for the Indian population. The MTHFR gene variant, though a minor risk factor, cannot be considered as a genetic marker.
Although genetic screens for various diseases currently exist, future progress in identifying the functions of genes in facial development and the mutations that affect these characteristics and functions could change orthodontic practice. In the near future, with rapid advances in the science of gene manipulation, the correction or alteration of genetic defects at the molecular level, remains a distinct possibility. Gene manipulation can be employed to control the expression of any gene in several orthodontically relevant issues. This will be critical to the development of clinically relevant tools.[28]
Further studies targeting a larger sample size and a number of genes are required for a better insight and understanding of the complex genetics of nonsyndromic CL/P. It is clear that there is no single major genetic risk factor for the development of orofacial clefts; and the development of the orofacial clefts in an individual depends on the interaction of several genes with environmental factors. Identifying specific genetic polymorphisms that influence orofacial cleft phenotypes will shed light on the molecular pathways involved in these complex disorders and provide a better understanding of the pathophysiology of orofacial clefts.
A major challenge is not only a complete cataloguing of all the genes but also identification of their polygenetic nature to have a thorough understanding of craniofacial development.
Conclusions
The results of this study indicated that there is a strong association between the presence of TGF-α gene variant and a combination of both TGF-α + MTHFR gene variants with the incidence of nonsyndromic CL/P in the Indian population and can be considered as genetic markers for the same.
The MTHFR gene variant however, did not show any significant correlation with nonsyndromic CL/P and cannot be considered a genetic marker for the Indian population.
Acknowledgments
We wish to thank Mr. Sandeep and Mrs. Prashanthi at Genohelix, Bengaluru for their valuable technical guidance and support. We are also grateful to Mr. Thejasvi for his help with the statistical analysis required for this study. Last but not the least, the faculty at the Department of Orthodontics, D.A.P.M.R.V. Dental College for providing useful insights and extending support throughout the course of the study.
Footnotes
Source of Support: Nil
Conflict of Interest: None declared.
References
- 1.Rajion ZA, Alwi Z. Genetics of cleft lip and palate: A review. Malays J Med Sci. 2007;14:4–9. [PMC free article] [PubMed] [Google Scholar]
- 2.Murray JC. Gene/environment causes of cleft lip and/or palate. Clin Genet. 2002;61:248–56. doi: 10.1034/j.1399-0004.2002.610402.x. [DOI] [PubMed] [Google Scholar]
- 3.Lidral AC, Romitti PA, Basart AM, Doetschman T, Leysens NJ, Daack-Hirsch S, et al. Association of MSX1 and TGFB3 with nonsyndromic clefting in humans. Am J Hum Genet. 1998;63:557–68. doi: 10.1086/301956. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Mossey PA. The heritability of malocclusion: Part 1 – Genetics, principles and terminology. Br J Orthod. 1999;26:103–13. doi: 10.1093/ortho/26.2.103. [DOI] [PubMed] [Google Scholar]
- 5.Dixon MJ, Marazita ML, Beaty TH, Murray JC. Cleft lip and palate: Understanding genetic and environmental influences. Nat Rev Genet. 2011;12:167–78. doi: 10.1038/nrg2933. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Park JY, Yoo HW, Kim Y. Genetic analysis of TGFA, MTHFR and IRF6 in Korean patients affected by nonsyndromic cleft lip with or without cleft palate. Genomic Inform. 2007;5:56–60. [Google Scholar]
- 7.Gaspar DA, Matioli SR, de Cássia Pavanello R, Araújo BC, Alonso N, Wyszynski D, et al. Maternal MTHFR interacts with the offspring's BCL3 genotypes, but not with TGFA, in increasing risk to nonsyndromic cleft lip with or without cleft palate. Eur J Hum Genet. 2004;12:521–6. doi: 10.1038/sj.ejhg.5201187. [DOI] [PubMed] [Google Scholar]
- 8.Khoury MJ, Gomez-Farias M, Mulinare J. Does maternal cigarette smoking during pregnancy cause cleft lip and palate in offspring? Am J Dis Child. 1989;143:333–7. doi: 10.1001/archpedi.1989.02150150091023. [DOI] [PubMed] [Google Scholar]
- 9.Shaw GM, Lammer EJ, Wasserman CR, O’Malley CD, Tolarova MM. Risks of orofacial clefts in children born to women using multivitamins containing folic acid periconceptionally. Lancet. 1995;346:393–6. doi: 10.1016/s0140-6736(95)92778-6. [DOI] [PubMed] [Google Scholar]
- 10.Czeizel AE, Tóth M, Rockenbauer M. Population-based case control study of folic acid supplementation during pregnancy. Teratology. 1996;53:345–51. doi: 10.1002/(SICI)1096-9926(199606)53:6<345::AID-TERA5>3.0.CO;2-Z. [DOI] [PubMed] [Google Scholar]
- 11.Singh VP, Mysore D, Amarnath BC, Dharma RM, Prashanth CS, Shetty A. Association of TGFB3 rS2300607 (IVSI+5321) gene variant with non syndromic cleft lip/palate in South Indian patients. Am J Biomed Sci. 2011;3:236–40. [Google Scholar]
- 12.Ardinger HH, Buetow KH, Bell GI, Bardach J, VanDemark DR, Murray JC. Association of genetic variation of the transforming growth factor-alpha gene with cleft lip and palate. Am J Hum Genet. 1989;45:348–53. [PMC free article] [PubMed] [Google Scholar]
- 13.Holder SE, Vintiner GM, Farren B, Malcolm S, Winter RM. Confirmation of an association between RFLPs at the transforming growth factor-alpha locus and non-syndromic cleft lip and palate. J Med Genet. 1992;29:390–2. doi: 10.1136/jmg.29.6.390. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Jara L, Blanco R, Chiffelle I, Palomino H, Carreño H. Evidence for an association between RFLPs at the transforming growth factor alpha (locus) and nonsyndromic cleft lip/palate in a South American population. Am J Hum Genet. 1995;56:339–41. [PMC free article] [PubMed] [Google Scholar]
- 15.Tanabe A, Taketani S, Endo-Ichikawa Y, Tokunaga R, Ogawa Y, Hiramoto M. Analysis of the candidate genes responsible for non-syndromic cleft lip and palate in Japanese people. Clin Sci (Lond) 2000;99:105–11. [PubMed] [Google Scholar]
- 16.Lu Y, Liu Q, Xu W, Li Z, Jiang M, Li X, et al. TGFA and IRF6 contribute to the risk of nonsyndromic cleft lip with or without cleft palate in northeast China. PLoS One. 2013;8:e70754. doi: 10.1371/journal.pone.0070754. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Letra A, Fakhouri W, Fonseca RF, Menezes R, Kempa I, Prasad JL, et al. Interaction between IRF6 and TGFA genes contribute to the risk of nonsyndromic cleft lip/palate. PLoS One. 2012;7:e45441. doi: 10.1371/journal.pone.0045441. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Lidral AC, Murray JC, Buetow KH, Basart AM, Schearer H, Shiang R, et al. Studies of the candidate genes TGFB2, MSX1, TGFA, and TGFB3 in the etiology of cleft lip and palate in the Philippines. Cleft Palate Craniofac J. 1997;34:1–6. doi: 10.1597/1545-1569_1997_034_0001_sotcgt_2.3.co_2. [DOI] [PubMed] [Google Scholar]
- 19.Hecht JT, Wang YP, Blanton SH, Michels VV, Daiger SP. Cleft lip and palate: No evidence of linkage to transforming growth factor alpha. Am J Hum Genet. 1991;49:682–6. [PMC free article] [PubMed] [Google Scholar]
- 20.Brandalize AP, Bandinelli E, Borba JB, Félix TM, Roisenberg I, Schüler-Faccini L. Polymorphisms in genes MTHFR, MTR and MTRR are not risk factors for cleft lip/palate in South Brazil. Braz J Med Biol Res. 2007;40:787–91. doi: 10.1590/s0100-879x2006005000112. [DOI] [PubMed] [Google Scholar]
- 21.van Rooij IA, Vermeij-Keers C, Kluijtmans LA, Ocké MC, Zielhuis GA, Goorhuis-Brouwer SM, et al. Does the interaction between maternal folate intake and the methylenetetrahydrofolate reductase polymorphisms affect the risk of cleft lip with or without cleft palate? Am J Epidemiol. 2003;157:583–91. doi: 10.1093/aje/kwg005. [DOI] [PubMed] [Google Scholar]
- 22.Reutter H, Birnbaum S, Lacava AD, Mende M, Henschke H, Bergé S, et al. Family-based association study of the MTHFR polymorphism C677T in patients with nonsyndromic cleft lip and palate from Central Europe. Cleft Palate Craniofac J. 2008;45:267–71. doi: 10.1597/06-174. [DOI] [PubMed] [Google Scholar]
- 23.Grunert RR, Braune A, Schnackenberg E, Schloot W, Krause HR. Genetic differences in enzymes of folic acid metabolism in patients with lip-jaw-palate clefts and their relatives. Mund Kiefer Gesichtschir. 2002;6:131–3. doi: 10.1007/s10006-001-0361-4. [DOI] [PubMed] [Google Scholar]
- 24.Jagomägi T, Nikopensius T, Krjutskov K, Tammekivi V, Viltrop T, Saag M, et al. MTHFR and MSX1 contribute to the risk of nonsyndromic cleft lip/palate. Eur J Oral Sci. 2010;118:213–20. doi: 10.1111/j.1600-0722.2010.00729.x. [DOI] [PubMed] [Google Scholar]
- 25.Jugessur A, Wilcox AJ, Lie RT, Murray JC, Taylor JA, Ulvik A, et al. Exploring the effects of methylenetetrahydrofolate reductase gene variants C677T and A1298C on the risk of orofacial clefts in 261 Norwegian case-parent triads. Am J Epidemiol. 2003;157:1083–91. doi: 10.1093/aje/kwg097. [DOI] [PubMed] [Google Scholar]
- 26.Shotelersuk V, Ittiwut C, Siriwan P, Angspatt A. Maternal 677CT/1298AC genotype of the MTHFR gene as a risk factor for cleft lip. J Med Genet. 2003;40:e64. doi: 10.1136/jmg.40.5.e64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Pezzetti F, Martinelli M, Scapoli L, Carinci F, Palmieri A, Marchesini J, et al. Maternal MTHFR variant forms increase the risk in offspring of isolated nonsyndromic cleft lip with or without cleft palate. Hum Mutat. 2004;24:104–5. doi: 10.1002/humu.9257. [DOI] [PubMed] [Google Scholar]
- 28.Havens B, Wadhwa S, Nanda R. Orthodontics in the year 2047: Genetically driven treatment plans. J Clin Orthod. 2007;41:549–56. [PubMed] [Google Scholar]
