Skip to main content
Standards in Genomic Sciences logoLink to Standards in Genomic Sciences
. 2013 Dec 31;9(3):956–959. doi: 10.4056/sigs.4618288

Non-contiguous finished genome sequence and description of Halopiger goleamassiliensis sp. nov.

Hassani Imene Ikram 1, Robert Catherine 2, Michelle Caroline 2, Raoult Didier 2, Hacène Hocine 1,*, Desnues Christelle 2,*
PMCID: PMC4149028  PMID: 25197441

Abstract

Halopiger goleamassiliensis strain IIH3T sp. nov. is a novel, extremely halophilic archaeon within the genus Halopiger. This strain was isolated from an evaporitic sediment in El Golea Lake, Ghardaïa region (Algeria). The type strain is strain IIH3T. H. goleamassiliensis is moderately thermophilic, neutrophilic, non-motile and coccus-shaped. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 3,906,923 bp long genome contains 3,854 protein-encoding genes and 49 RNA genes (1 gene is 16S rRNA, 1 gene is 23S rRNA, 3 genes are 5S rRNA, and 44 are tRNA genes).

Keywords: Halopiger goleamassiliensis, Draft genome, Euryarchaeota, Extreme halophile, thermotolerant

Introduction

Halopiger goleamassiliensis sp. nov. strain IIH3T (=KC 430940 =CSUR P3036 = DSM on-going deposit) is the type strain of H .goleamassiliensis sp. nov. This organism is a Gram-negative, extremely halophilic, moderately thermophilic and strictly aerobic archaeon. It was isolated from evaporitic sediment in El Golea Lake, Ghardaïa region (Algeria) as part of a project studying archaeal diversity in hypersaline Lakes of Algeria.

The number of genera and species belonging to Halobacteria (Archaea, Euryarchaeota) has increased recently due to studies of several different hypersaline environments (thalassohaline and athalassohaline) combined with the use of different isolation media and culture conditions [1]. At the time of writing, the family Halobacteriaceae, the single family described within the order Halobacteriales, accommodated 40 recognized genera [2]. The genus Halopiger was proposed by Gutiérrez et al. (2007) [3] and contains only three species, Halopiger xanaduensis isolated from the Shangmatala Lake (China) [3], Halopiger aswanensis isolated from a hypersaline soil in Aswan (Egypt) [4] and Halopiger salifodinae recently isolated from a salt mine in Kuche county, Xinjiang province, China [5]. So far, this genus is composed of strictly aerobic, Gram-negative, polymorphic and pigmented strains. We have recently used [6-18] a polyphasic approach for prokaryotic classification [19] that includes genomic data [20,21], MALDI-TOF spectra [22,23] and major phenotypic characteristics.

Using this approach, we report here a summary classification and a set of features for Halopiger goleamassiliensis sp.nov. strain IIH3T together with the description of the complete genomic sequencing and annotation. These characteristics support the circumscription of the H. goleamassiliensis species.

Classification and features

H. goleamassiliensis was isolated from an evaporitic sediment of the hypersaline Lake El Golea in Ghardaïa region of Algeria. The sediment sample (1g) was enriched in a liquid SG medium [24] containing ampicillin (100 μg/mL) at 55°C on a rotary shaking platform (150 rpm) for 7 to 15 days. Serial dilutions of enrichment cultures were plated on SG agar plates and incubated aerobically at 55°C. After 2 to 6 weeks of incubation, representative colonies were picked and maintained in the SG medium at 55°C. Strain IIH3T (Table 1) was isolated in 2012 by cultivation in aerobic conditions at 55°C and stored at –80 ºC with 25% (v/v) glycerol.

Table 1. Classification and general features of Halopiger goleamassiliensis according to the MIGS recommendations [25].

MIGS ID       Property      Term      Evidence code a
     Domain Archaea      TAS [26]
     Phylum Euryarchaeota      TAS [27]
     Class Halobacteria      TAS [28,29]
      Current classification      Order Halobacteriales      TAS [30-32]
     Family Halobacteriaceae      TAS [33,34]
     Genus Halopiger      TAS [3]
     Species Halopiger goleamassiliensis      IDA
     Type strain IIH3T      IDA
      Gram stain      Negative      IDA
      Cell shape      Coccus      IDA
      Motility      Non-motile      IDA
      Sporulation      None      IDA
      Temperature range      Thermophile, between 40°C and 60°C      IDA
      Optimum temperature      55°C      IDA
MIGS-6.3       Salinity      Halophile, 22.5%-25% (optimum)      IDA
MIGS-22       Oxygen requirement      Aerobic      IDA
      Carbon source      Sugar or amino acids      IDA
      Energy metabolism      Heterotrophic      IDA
MIGS-6       Habitat      Salt Lake sediment      IDA
MIGS-15       Biotopic relationship      Free living      IDA
MIGS-14       Pathogenicity      Non-pathogenic      NAS
      Biosafety level      1      NAS
      Isolation      Sediment of El Golea Lake      IDA
MIGS-4       Geographic location      Algeria      IDA
MIGS-5       Isolation time      2012      IDA
MIGS-4.1       Latitude      30-34 N      IDA
MIGS-4.2       Longitude      002-52 E      IDA
MIGS-4.3       Depth      Surface      IDA
MIGS-4.4       Altitude      397      IDA

a) Evidence codes – IDA: Inferred from Direct Assay; TAS: Traceable Author Statement (i.e., a direct report exists in the literature); NAS: Non-traceable Author Statement (i.e., not directly observed for the living, isolated sample, but based on a generally accepted property for the species, or anecdotal evidence). These evidence codes are from the Gene Ontology project [35]. If the evidence is IDA, then the property was directly observed for a live isolate by one of the authors or an expert mentioned in the acknowledgements.

Genomic DNA was extracted and purified using the Genomic DNA purification kit (MACHEREY-NAGEL) Hoerd, France. The 16S rRNA gene was amplified by PCR using the primers 21AF: TTCCGGTTGATCCTGCCGGA and RP2: ACGGCTACCTTGTTACGACTT. A total of 1,444 bases were identified. The sequence was compared with available sequences in GenBank using a BLAST search [36]. The strain exhibited 96% nucleotide sequence similarities with Halopiger xanaduensis [3]. These values were lower than the 98.7% 16S rRNA gene sequence threshold recommended by Stackebrandt and Ebers to delineate a new species without carrying out DNA-DNA hybridization [37]. A phylogenetic tree (Figure 1) was constructed using the neighbor-joining method with the MEGA 5 program package [38] after multiple alignments of the data using MUSCLE [39]. Evolutionary distances were calculated using the Tamura-Nei model [40].

Figure 1.

Figure 1

Neighbor-joining phylogenetic tree based on 16S rRNA gene sequence comparisons, showing the position of strain IIH3T and other related haloarchaeal species. GenBank accession numbers are indicated in parentheses. Sequences were aligned using MUSCLE, and phylogenetic inferences obtained using the MEGA software. Numbers at the nodes are from a bootstrap analysis done using 1,000 replicates to generate a majority consensus tree. Methanospirillum hungatei was used as outgroup.

Phenotypic characterization was carried out according to the recommended minimal standards for the description of new taxa in the order Halobacteriales [41]. Table 2 summarizes the differential phenotypic characteristics of H. goleamassiliensis sp. nov. IIH3T, H. xanaduensis SH-6T, H. aswanensis 56T and H. salifodinae KCY076B2T. Different growth temperatures (30, 37, 40, 50, 55, 60°C), pH values (5, 6, 7, 7.5, 8, 8.5, 9, 10, 11, 12) and NaCl concentrations (0, 10, 12, 15, 20, 22.5, 25, 30% W/V) were tested on strain IIH3T. Cell growth was observed between 40°C and 60°C (optimum at 55°C), between 15% and 30% NaCl (optimum at 22.5-25 % NaCl) and at 7 to 11 pH values (optimum at pH 8).

Table 2. Differential phenotypic characteristics between strain IIH3T and related species.

Characteristic       H. goleamassiliensis      H. xanaduensis      H. aswanensis     H. salifodinae
Cell morphology       coccus      pleomorphic      pleomorphic     pleomorphic rods
Cell diameter (µm)       0.8-1.5      0.5-1.0×3.0-13.0      1.25-6.50×0.6–0.9     ND
Pigmentation       salmon      red      pink     cream
Oxygen requirement       strictly aerobic      strictly aerobic      strictly aerobic     strictly aerobic
Gram stain       negative      negative      negative     negative
NaCl range (%,w/v)       15-30      15-30      10- 30     11-31
NaCl optimum (%,w/v)       22.5-25      25      22.5-25     17-20
Temperature range (°C)       40-60      28-45      40-50     25-50
Temperature optimum (°C)       55      37      40     37-45
pH range       7-11      6 -11      6-9.2     6-8
pH optimum       8-8.5      7.5-8      7.5     7.0
Motility       non-motile      non-motile      motile     non-motile
Catalase       +      +      +     +
hydrolysis of
Starch       -      -      +     -
Tween 80       +      +      +     -
Casein       -      -      -     ND
Gelatin       +      +      -     -
Lipids from egg yolk       +      ND      -     ND
utilization of
D-Glucose       +      +      +     +
Galactose       +      +      ND     -
D-Xylose       +      +      +     -
Lactose       +      -      -     -
Fructose       -      -      +     -
Starch       -      -      +     +
Mannose       +      -      ND     +
D-Ribose       +      -      ND     -
Sucrose       -      ND      +     ND
Rhamnose       +      ND      ND     -
Mannitol       -      -      ND     ND
Citrate       -      -      ND     -
L-Arginine       -      -      -     -
Indole production       -      -      +     -
Urease       -      +      -     -
H2S production       -      -      +     +

Strains: H. goleamassiliensis sp. nov. IIH3T; H. xanaduensis SH-6T; 3, H. aswanensis; H. salifodinae KCY076B2T.

+: Positive result, -: Negative result, ND: Not Determined

Under optimal growth conditions on SG agar medium and after incubation for 15-20 days at 55°C, colonies were salmon pigmented, circular with a diameter of 1-2 mm. Cell morphology and motility were examined by using light microscopy and phase-contrast microscopy. Gram staining was performed using samples fixed with acetic acid, as described by Dussault in 1955 [42]. Cells are Gram-negative, cocci (Figure 2) measuring 0.8-1.5 μm in diameter (Figure 3). Motility and spores or capsules were not observed.

Figure 2.

Figure 2

Gram staining of Halopiger goleamassiliensis strain IIH3T.

Figure 3.

Figure 3

Transmission electron microscopy of H. goleamassiliensis strain IIH3T, using a Morgani 268D (Philips) at an operating voltage of 60kV. The scale bar represents 1µm.

All the following biochemical and nutritional tests were realized in duplicate. Strain IIH3T was found to be oxidase- and catalase- positive. The strain is extremely halophilic and cell lysis is observed in distilled water. It is a strictly aerobic organism and anaerobic growth does not occur even in the presence of KNO3 or arginine. Neither magnesium nor amino acids are required for growth. Tween 80, gelatin, and lipids from egg yolk are hydrolysed, whereas urea, starch, casein, and phosphatase are not. Production of indole and methyl red, Voges–Proskauer and Simmons' citrate tests are negative. H2S is not produced from cysteine.

Utilization of carbohydrates and other compounds as sole carbon sources and acid production from these compounds were determined as described by Oren [41]. Several sugars and amino acids can serve as sole carbon and energy sources (Table 2).

Antibiotic sensitivity tests were determined on SG medium agar plates with antibiotic discs. Strain IIH3T is susceptible to bacitracin (10 μg), novobiocin (30 μg), streptomycin (10 μg) and sulfamethoxazole (25 μg), but resistant to ampicillin (10 μg), cephalothin (30 μg), chloramphenicol (30 μg), erythromycin (15 μg), gentamicin (10 μg), kanamycin (30 μg), nalidixic acid (30 μg), penicillin G (10 μg), rifampicin (30 μg), tetracycline (30 μg), and vancomycin (30 μg).

Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS is considered a reliable and rapid identification method for extremophilic prokaryotes [22,23] and it is used in the present study to characterize the strain IIH3T as previously described [6-18]. A pipette tip was used to pick one isolated archaeal colony from a culture agar plate, and to spread it as a thin film on a MTP 384 MALDI-TOF tar-get plate (Bruker Daltonics, Leipzig, Germany). The colonies from strain IIH3T and from other species of archaea were spotted in triplicate. After air-drying, 1.5 μl of matrix solution (a saturated solution of α-cyano-4-hydroxycinnaminic acid [CHCA] in 50% aqueous acetonitrile containing 2.5% trifluoroacetic acid) per spot was applied and allowed to dry for five minutes.

Mass spectrometric measurements were performed with a Microflex spectrometer (Bruker). Spectra were recorded in the positive linear mode for the mass range of 2000 to 20,000 DA. The acceleration voltage was 20 kV. The time of acquisition was between 30 seconds and 1 minute per spot. Spectra were collected as a sum of 240 shots across a spot. Preprocessing and identification steps were performed using the manufacturer’s parameters. The IIH3T spectrum (Figure 4) was imported into the MALDI BioTyper software (version 2.0, Bruker) and analyzed by standard pattern matching (with default parameter settings) against the spectra of Haloferax mediterranei, Natrinema gari, Natrinema pallidum, Haloterrigena thermotolerans, Haloterrigena. sp, Halogeometricum. sp, Haloarcua. sp and Halopiger. sp used as reference data in the BioTyper database (Figure 5).

Figure 4.

Figure 4

Reference mass spectrum from H. goleamassiliensis strain IIH3T. Spectra from 12 individual colonies were compared and a reference spectrum was generated.

Figure 5.

Figure 5

Gel view comparing the H. goleamassiliensis strain IIH3T spectrum with those of other archaea. The Gel View displays the raw spectra of all loaded spectrum files arranged in a pseudo-gel like look. The x-axis records the m/z value. The left y-axis displays the running spectrum number originating from subsequent spectra loading. The peak intensity is expressed by the gray scale intensity. The scale shown on the right y-axis links the color to the peak intensity in arbitrary units.

A score enabled the identification, or not, from the tested species: a score > 2.3 with a validly published species enabled the identification at the species level, a score > 1.7 but < 2 enabled the identification at the genus level; and a score < 1.7 did not enable any identification. For strain IIH3T, none of the obtained scores was > 1, thus suggesting that our isolate was not a member of a known species. We added the spectrum from strain IIH3T to our database for future reference. Figure 5 shows the MALDI-TOF MS spectrum differences between H. goleamassiliensis and other archaea.

Genome sequencing information

Genome project history

The organism was selected for sequencing on the basis of its phylogenetic position and 16S rRNA similarity to other members of the genus Halopiger, and as part of a study of archaeal diversity in hypersaline lakes of Algeria. It is the second genome of a Halopiger species and the first sequenced genome of H. goleamassiliensis sp. nov. The EMBL accession number is CBMB010000001-CBMB010000011 and it consists of 3 scaffolds (HG315690-HG315692). A summary of the project information (PRJEB1780) and its association with MIGS version 2.0 recommendations [27] is shown in the Table 3.

Table 3. Project information.

MIGS ID      Property      Term
MIGS-31      Finishing quality      High-quality draft
MIGS-28      Libraries used      Paired-end 5 kb library
MIGS-29      Sequencing platforms      454 GS FLX Titanium
MIGS-31.2      Fold coverage      21.6×
MIGS-30      Assemblers      Newbler version 2.5.3
MIGS-32      Gene calling method      Prodigal
     EMBL ID      CBMB010000001-
     CBMB010000011
     EMBL Date of Release      June 18, 2018
     Project relevance      Study of the archaeal diversity in hypersaline lakes of Algeria

Growth conditions and DNA isolation

H. goleamassiliensis sp.nov. strain IIH3T (= CSUR P3036 =DSM on-going deposit) was grown in SG medium at 55°C in aerobic condition. DNA was isolated and purified using the Genomic DNA purification kit, NucleoSpin Tissue procedure (MACHEREY-NAGEL) following the standard protocol as recommended by the manufacturer. The quality of the DNA was checked on an agarose gel (0.8%) stained with SYBR safe. The yield and the concentration were measured by the Quant-it Picogreen Kit (Invitrogen) on the Genios Tecan Fluorometer at 33.1 ng/µL.

Genome sequencing and assembly

A 5 kb paired-end sequencing strategy (Roche, Meylan, France) was used. This project was loaded on a 1/4 region on PTP Picotiterplate (Roche). Three µg of DNA was mechanically fragmented on the Covaris device (KBioScience-LGC Genomics, Teddington, UK) using miniTUBE-Red 5Kb. The DNA fragmentation was visualized through an Agilent 2100 BioAnalyzer on a DNA labchip 7500 with an optimal size of 4.7 kb. The library was constructed according to the 454 GS FLX Titanium paired end-protocol. After PCR amplification through 17 cycles followed by double size selection, the single stranded paired-end library was then loaded on a DNA labchip RNA pico 6000 on the BioAnalyzer. The pattern showed an optimum at 480 bp and the concentration was quantified on a Genios Tecan fluorometer at 642 pg/µL. The concentration equivalence of the library was calculated at 108 molecules/µL. The library was stored at -20°C until further use, and amplified in 2 emPCR reactions at 0.25 cpb, in 2 emPCR at 0.5 cpb and in 2 emPCR at 1 cpb with the GS Titanium SV emPCR Kit (Lib-L) v2 (Roche). The yield of the 3 types of paired-end emPCR reactions was 3.68%, 8.05% and 10.69% respectively, in the quality range of 5 to 20% expected from the Roche procedure. These emPCR were pooled. Both libraries were loaded onto GS Titanium PicoTiterPlates (PTP Kit 70×75, Roche) and pyrosequenced with the GS Titanium Sequencing Kit XLR70 (Roche). The run was performed overnight and then analyzed on the cluster through the gsRunBrowser and Newbler assembler (Roche).

A total of 271,702 filter-passed wells were obtained and generated 84.39 Mb with an average length of 325 bp. The passed filter sequences were assembled using Newbler with 90% identity and 40 bp overlap. The final assembly contained 12 contigs (11 large contigs >1500 bp) arranged in 3 scaffolds and generated a genome size of 3.9 Mb, which corresponds to a coverage of 21.6× genome equivalent.

Genome annotation

Open Reading Frames (ORFs) were predicted using prodigal with default parameters [43]. ORFs spanning a sequencing gap region were excluded. Assessment of protein function was obtained by comparing the predicted protein sequences with sequences in the GenBank [44] and the Clusters of Orthologous Groups (COG) databases using BLASTP. RNAmmer [45] and tRNAscan-SE 1.21 [46] were used for identifying the rRNAs and tRNAs, respectively. SignalP [47] and TMHMM [48] were used to predict signal peptides and transmembrane helices, respectively. For alignment lengths greater than 80 amino acids, ORFans were identified if their BLASTP E-value was lower than 1e-03. An E-value of 1e-05 was used if alignment lengths were smaller than 80 amino acids. DNA Plotter [49] was used for visualization of genomic features and Artemis [50] was used for data management. The mean level of nucleotide sequence similarity was estimated at the genome level between H. goleamassiliensis and 5 other members of the Halobacteriaceae family (Table 6), by BLASTN comparison of orthologous ORFs in pairwise genomes. Orthologous proteins were detected using the Proteinortho software using the following parameters: e-value 1e-05, 30% identity, 50% coverage and 50% of algebraic connectivity [51].

Table 6. Orthologous gene comparison and average nucleotide identity of H. goleamassiliensis with other compared genomes (upper right, numbers of orthologous genes; lower left, mean nucleotide identities of orthologous genes). Bold numbers indicate the numbers of genes or each genome.

Species (accession number)     H. goleamassiliensis     N. pharaonis     H.
    turkmenica
    N. magadii      H. jeotgali     H. xanaduensis
Halopiger goleamassiliensis (PRJEB1780)     3854     1415     2036     1859      1542     2103
Natronomonas pharaonis (NC_007426)     67.60     2659     1393     1321      1254     1381
Haloterrigena turkmenica (NC_013743)     78.21     67.81     3739     1765      1559     2057
Natrialba magadii
(NC_013922)
    76.27     66.85     76.83     3559      1442     1828
Halalkalicoccus jeotgali (NC_014297)     68.70     67.76     68.97     67.55      3035     1589
Halopiger xanaduensis (NC_015666)     78.62     67.52     79.73     76.98      68.83     3588

Genome properties

The genome is 3,906,923 bp long and displays a G+C content of 66.06%. (Table 4, Figure 6) It is composed of 12 contigs (11 large contigs >1,500 bp) arranged into 3 scaffolds. Of the 3,903 predicted genes, 3,854 were protein-coding genes (COG), and 49 were RNAs (1 gene is 16S rRNA, 1 gene is 23S rRNA, 3 genes are 5S rRNA, and 44 are tRNA genes). A total of 2,359 genes (61.21%) were assigned a putative function (by COG or by NR BLAST) and 188 genes were identified as ORFans (4.88%). The remaining genes were annotated as hypothetical proteins (1059 genes = 27.48%). The distribution of genes into COG functional categories is presented in Table 4. The properties and the statistics of the genome are summarized in Tables 4 and 5.

Table 4. Nucleotide content and gene count levels of the genome.

Attribute     Value      % of totala
Genome size (bp)     3,906,923      100
DNA G+C content (bp)     2,581,064      66.06
DNA coding region (bp)     3,359,291      85.98
Total genes     3,903      100
RNA genes     49      1.26
Protein-coding genes     3,854      98.74
Genes with function prediction     2,359      61.21
Genes assigned to COGs     2,446      63.47
Genes with peptide signals     320      8.30
Genes with transmembrane helices     906      23.51

a The total is based on either the size of the genome in base pairs or the total number of protein coding genes in the annotated genome.

Figure 6.

Figure 6

Graphical circular map of the H. goleamassiliensis IIH3T genome. From the outside in: The first circle indicates the scaffolds, the next two circles show open reading frames oriented in the forward and reverse (colored by COG categories) directions, respectively. The fourth circle displays the rRNA gene operon (red) and tRNA genes (green). The fifth circle shows the G+C% content plot. The inner-most circle shows the GC skew, purple and olive indicating negative and positive values, respectively.

Table 5. Number of genes associated with the 25 general COG functional categories.

Code      Value     % agea     Description
J      166     4.31     Translation
A      1     0.003     RNA processing and modification
K      157     4.07     Transcription
L      113     2.93     Replication, recombination and repair
B      3     0.08     Chromatin structure and dynamics
D      18     0.47     Cell cycle control, mitosis and meiosis
Y      0     0     Nuclear structure
V      46     1.19     Defense mechanisms
T      128     3.32     Signal transduction mechanisms
M      74     1.92     Cell wall/membrane biogenesis
N      51     1.32     Cell motility
Z      0     0     Cytoskeleton
W      0     0     Extracellular structures
U      27     0.70     Intracellular trafficking and secretion
O      114     2.96     Post-translational modification, protein turnover, chaperones
C      168     4.36     Energy production and conversion
G      122     3.17     Carbohydrate transport and metabolism
E      266     6.90     Amino acid transport and metabolism
F      70     1.82     Nucleotide transport and metabolism
H      131     3.40     Coenzyme transport and metabolism
I      107     2.78     Lipid transport and metabolism
P      176     4.57     Inorganic ion transport and metabolism
Q      82     2.13     Secondary metabolites biosynthesis, transport and catabolism
R      510     13.23     General function prediction only
S      248     6.43     Function unknown
-      1408     36.53     Not in COGs

a The total is based on the total number of protein coding genes in the annotated genome.

Comparison with other genomes of archaea

Currently, only one genome from Halopiger species is available. Here, we compared the genome of H. goleamassiliensis strain IIH3T with those of H. xanaduensis strain SH-6, Halalkalicoccus jeotgali strain B3, Natronomonas pharaonis strain DSM 2160, Haloterrigena turkmenica strain DSM 5511 and Natrialba magadii strain ATCC 43099. The genome of H. goleamassiliensis (3.90 Mb) is larger than that of Halalkalicoccus jeotgali and Natronomonas pharaonis (3.69 and 2.75 Mb, respectively) but of a smaller size than H. xanaduensis, Natrialba magadii and Haloterrigena turkmenica (4.35, 4.44 and 5.44 Mb respectively). The GC% content of H. goleamassiliensis (66.06%) is higher than that of H. xanaduensis (65.2%), Haloterrigena turkmenica (64.26%), Natronomonas pharaonis (63.1%), Halalkalicoccus jeotgali (62.5%) and Natrialba magadii (61.1%). H. goleamassiliensis has more predicted protein-coding genes (3,854) than Haloterrigena turkmenica, H. xanaduensisNatrialba magadii, Halalkalicoccus jeotgali and Natronomonas pharaonis (3,739, 3,588, 3,559, 3,035 and 2,659 respectively). In addition, H. goleamasiliensis shared a mean genomic sequence similarity of 67.60, 78.21, 76.27, 68.70 and 78.62% with Natronomonas pharaonis, Haloterrigena turkmenica, Natrialba magadii, Halalkalicoccus jeotgali and Halopiger xanaduensis respectively (Table 6).

Conclusion

On the basis of phenotypic, phylogenetic and genomic analyses, we formally propose the creation of Halopiger goleamassiliensis sp. nov. that contains the strain IIH3T. This archaeal strain has been found in Algeria.

Description of Halopiger goleamassiliensis sp. nov.

Halopiger goleamassiliensis (go.le’a. ma. si. li. en’sis. L. gen. masc. n. goleamassiliensis from the combination of El Golea, the Algerian region where the strain was isolated, and massiliensis, of Massilia, the Latin name of Marseille where the strain was sequenced). It has been isolated from an evaporitic sediment in El Golea Lake, Algeria.

Colonies were smooth, salmon-pigmented and small with 1 to 2 mm in diameter under optimal growth conditions. Strain is strictly aerobic, extremely halophilic and moderately thermophilic archaeon. Growth occurs at NaCl concentrations of 15-30%, at pH values in the range 7-11, and within the temperature range 40-60 °C. Optimal NaCl concentration, pH and temperature for growth are 22.5-25%, 8.0 and 55 °C, respectively. Magnesium is not required for growth. Cells are coccus-shaped (0.8-1.5 µm), Gram-negative, non-motile and lyse in distilled water. Cells are positive for catalase, oxidase and lysine decarboxylase production and negative for urease, arginine dihydrolase, ornithine decarboxylase, tryptophanase, phosphatase, β-galactosidase, D-mannitol, sacharose, starch, dextrose, and D-fructose fermentation. The following substrates are utilized as single carbon and energy sources for growth: pyruvate, D-glucose, D-mannose, D-ribose, D-xylose, maltose, sucrose, lactose, casamino acids, bacto-peptone, bacto-tryptone, and yeast extract. Tween 80, gelatin, and lipids from egg yolk are hydrolysed, whereas urea, starch, and casein are not. Methyl red, Voges–Proskauer, Simmons' citrate tests, and H2S production are negative.

Cells are susceptible to bacitracin, novobiocin, streptomycin, and sulfamethoxazole but resistant to ampicillin, cephalothin, chloramphenicol, erythromycin, gentamicin, kanamycin, nalidixic acid, penicillin G, rifampicin, tetracycline, and vancomycin.

The G+C content of the DNA is 66.06%. The 16S rRNA and genome sequences are deposited in GenBank and EMBL under accession numbers KC430940 and CBMB010000001-CBMB010000011, respectively. The type strain IIH3T (=CSUR P3036 = DSM on-going deposit) was isolated from an evaporitic sediment in El Golea Lake, Algeria.

Acknowledgements

The authors thank the entire team of Christelle Desnues and more particularly Dr. Nikolay Popgeorgiev for his help with TEM and Sarah Temmam for her help with tree construction. The authors acknowledge the Xegen Company (www.xegen.fr) for automating the genomic annotation process.

References

  • 1.Ma Y, Galinski EA, Grant WD, Oren A, Ventosa A. Halophiles 2010: life in saline environments. Appl Environ Microbiol 2010; 76:6971-6981 10.1128/AEM.01868-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Euzéby JP. List of prokaryotic names with standing in nomenclature LPSN. 2011; Available at:http://www.bacterio.cict.fr/classifgenerafamilies.html#Halobacteriaceae Accessed 23 June 2013.
  • 3.Gutiérrez MC, Castillo AM, Kamekura M, Xue Y, Ma Y, Cowan DA, Jones BE, Grant WD, Ventosa A. Halopiger xanaduensis gen. nov., sp. nov., an extremely halophilic archaeon isolated from saline Lake Shangmatala in Inner Mongolia, China. Int J Syst Evol Microbiol 2007; 57:1402-1407 10.1099/ijs.0.65001-0 [DOI] [PubMed] [Google Scholar]
  • 4.Hezayen FF, Gutiérrez MC, Steinbüchel A, Tindall BJ, Rehm BH. Halopiger aswanensis sp. nov., a polymer-producing and extremely halophilic archaeon isolated from hypersaline soil. Int J Syst Evol Microbiol 2010; 60:633-637 10.1099/ijs.0.013078-0 [DOI] [PubMed] [Google Scholar]
  • 5.Zhang WY, Jr, Meng Y, Zhu XF, Wu M. Halopiger salifodinae sp. nov., an extremely halophilic archaeon isolated from a salt mine. Int J Syst Evol Microbiol. 2013 doi: 10.1099/ijs.0.050971-0. [DOI] [PubMed] [Google Scholar]
  • 6.Lagier JC, El Karkouri K, Nguyen TT, Armougom F, Raoult D, Fournier PE. Non-contiguous finished genome sequence and description of Anaerococcus senegalensis sp. nov. Stand Genomic Sci 2012; 6:116-125 10.4056/sigs.2415480 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Lagier JC, Gimenez G, Robert C, Raoult D, Fournier PE. Non-contiguous finished genome sequence and description of Herbaspirillum massiliense sp. nov. Stand Genomic Sci 2012; 7:200-209 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Hugon P, Mishra AK, Lagier JC, Nguyen TT, Couderc C, Raoult D, Fournier PE. Non contiguous finished genome sequence and description of Brevibacillus massiliensis sp. nov. Stand Genomic Sci 2013; 8:1-14 10.4056/sigs.3466975 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Hugon P, Mishra AK, Robert C, Raoult D, Fournier PE. Non-contiguous finished genome sequence and description of Anaerococcus vaginalis. Stand Genomic Sci 2012; 6:356-365 10.4056/sigs.2716452 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Mishra AK, Hugon P, Robert C, Raoult D, Fournier PE. Non contiguous-finished genome sequence and description of Peptoniphilus grossensis sp. nov. Stand Genomic Sci 2012; 7:320-330 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Kokcha S, Mishra AK, Lagier JC, Million M, Leroy Q, Raoult D, Fournier PE. Non contiguous-finished genome sequence and description of Bacillus timonensis sp. nov. Stand Genomic Sci 2012; 6:346-355 10.4056/sigs.2776064 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Lagier JC, Armougom F, Mishra AK, Nguyen TT, Raoult D, Fournier PE. Non-contiguous finished genome sequence and description of Alistipes timonensis sp. nov. Stand Genomic Sci 2012; 6:315-324 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ramasamy D, Kokcha S, Lagier JC, Nguyen TT, Raoult D, Fournier PE. Genome sequence and description of Aeromicrobium massiliense sp. nov. Stand Genomic Sci 2012; 7:246-257 10.4056/sigs.3306717 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Mishra AK, Lagier JC, Robert C, Raoult D, Fournier PE. Non-contiguous finished genome sequence and description of Clostridium senegalense sp. nov. Stand Genomic Sci 2012; 6:386-395 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Lagier JC, Ramasamy D, Rivet R, Raoult D, Fournier PE. Non contiguous-finished genome sequence and description of Cellulomonas massiliensis sp. nov. Stand Genomic Sci 2012; 7:258-270 10.4056/sigs.3316719 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kokcha S, Ramasamy D, Lagier JC, Robert C, Raoult D, Fournier PE. Non-contiguous finished genome sequence and description of Brevibacterium senegalense sp. nov. Stand Genomic Sci 2012; 7:233-245 10.4056/sigs.3256677 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Mishra AK, Lagier JC, Robert C, Raoult D, Fournier PE. Non contiguous-finished genome sequence and description of Peptoniphilus timonensis sp. nov. Stand Genomic Sci 2012; 7:1-11 10.4056/sigs.2956294 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Mishra AK, Lagier JC, Rivet R, Raoult D, Fournier PE. Non-contiguous finished genome sequence and description of Paenibacillus senegalensis sp. nov. Stand Genomic Sci 2012; 7:70-81 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Tindall BJ, Rosselló-Móra R, Busse HJ, Ludwig W, Kämpfer P. Notes on the characterization of prokaryote strains for taxonomic purposes. Int J Syst Evol Microbiol 2010; 60:249-266 10.1099/ijs.0.016949-0 [DOI] [PubMed] [Google Scholar]
  • 20.Klenk HP, Göker M. En route to a genome-based classification of Archaea and Bacteria. Syst Appl Microbiol 2010; 33:175-182 10.1016/j.syapm.2010.03.003 [DOI] [PubMed] [Google Scholar]
  • 21.Schleifer KH. Classification of Bacteria and Archaea: past, present and future. Syst Appl Microbiol 2009; 32:533-542 10.1016/j.syapm.2009.09.002 [DOI] [PubMed] [Google Scholar]
  • 22.Dridi B, Raoult D, Drancourt M. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry identification of Archaea: towards the universal identification of living organisms. APMIS 2012; 120:85-91 10.1111/j.1600-0463.2011.02833.x [DOI] [PubMed] [Google Scholar]
  • 23.Krader P, Emerson D. Identification of archaea and some extremophilic bacteria using matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. Extremophiles 2004; 8:259-268 10.1007/s00792-004-0382-7 [DOI] [PubMed] [Google Scholar]
  • 24.Ozcan B, Cokmus C, Coleri A, Caliskan M. Characterization of extremely halophilic archaea isolated from saline environment in different parts of Turkey. Mikrobiologiia. 2006; 75(6): 849-856. [PubMed]
  • 25.Field D, Garrity G, Gray T, Morrison N, Selengut J, Sterk P, Tatusova T, Thomson N, Allen MJ, Angiuoli SV, et al. The minimum information about a genome sequence (MIGS) specification. Nat Biotechnol 2008; 26:541-547; http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=18464787&dopt=Abstract 10.1038/nbt1360 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Woese CR, Kandler O, Wheelis ML. Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proc Natl Acad Sci USA 1990; 87:4576-4579 10.1073/pnas.87.12.4576 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Garrity GM, Holt JG. Phylum AII. Euryarchaeota phy. nov. In: Garrity GM, Boone DR, Castenholz RW (eds), Bergey's Manual of Systematic Bacteriology, Second Edition, Volume 1, Springer, New York, 2001, p. 211-355.
  • 28.List Editor Validation List no. 85. Validation of publication of new names and new combinations previously effectively published outside the IJSEM. Int J Syst Evol Microbiol 2002; 52:685-690 10.1099/ijs.0.02358-0 [DOI] [PubMed] [Google Scholar]
  • 29.Grant WD, Kamekura M, McGenity TJ, Ventosa A. Class III. Halobacteria class. nov. In: Garrity GM, Boone DR, Castenholz RW (eds), Bergey's Manual of Systematic Bacteriology, Second Edition, Volume 1, Springer, New York, 2001, p. 294. [Google Scholar]
  • 30.Grant WD, Larsen H. Group III. Extremely halophilic archaeobacteria. Order Halobacteriales ord. nov. In Holt JG (ed), Bergey's Manual of Systematic Bacteriology, Volume 3, Baltimore : Williams & Wilkins, 1989, p. 2216-2228.
  • 31.The nomenclatural types of the orders Acholeplasmatales, Halanaerobiales, Halobacteriales, Methanobacteriales, Methanococcales, Methanomicrobiales, Planctomycetales, Prochlorales, Sulfolobales, Thermococcales, Thermoproteales and Verrucomicrobiales are the genera Acholeplasma, Halanaerobium, Halobacterium, Methanobacterium, Methanococcus, Methanomicrobium, Planctomyces, Prochloron, Sulfolobus, Thermococcus, Thermoproteus and Verrucomicrobium, respectively. Opinion 79. Int J Syst Evol Microbiol 2005; 55:517-518 10.1099/ijs.0.63548-0 [DOI] [PubMed] [Google Scholar]
  • 32.List Editor Validation List no. 31. Validation of the publication of new names and new combinations previously effectively published outside the IJSB. Int J Syst Bacteriol 1989; 39:495-497 10.1099/00207713-39-4-495 [DOI] [Google Scholar]
  • 33.Skerman VBD, McGowan V, Sneath PHA. Approved Lists of Bacterial Names. Int J Syst Bacteriol 1980; 30:225-420 10.1099/00207713-30-1-225 [DOI] [PubMed] [Google Scholar]
  • 34.Gibbons NE. Family V. Halobacteriaceae Fam. nov. In: Buchanan RE, Gibbons NE (eds), Bergey's Manual of Determinative Bacteriology, Eighth Edition, The Williams and Wilkins Co., Baltimore, 1974, p. 269-273. [Google Scholar]
  • 35.Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, et al. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 2000; 25:25-29 10.1038/75556 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997; 25:3389-3402 10.1093/nar/25.17.3389 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Stackebrandt E, Ebers J. Taxonomic parameters revisited: tarnished gold standards. Microbiol Today. 2006; 152-155. [Google Scholar]
  • 38.Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011; 28:2731-2739 10.1093/molbev/msr121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Edgar RC. MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics 2004; 5:113 10.1186/1471-2105-5-113 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Tamura K, Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol 1993; 10:512-526 [DOI] [PubMed] [Google Scholar]
  • 41.Oren A, Ventosa A, Grant WD. Proposed minimal standards for description of new taxa in the order Halobacteriales. Int J Syst Bacteriol 1997; 47:233-238 10.1099/00207713-47-1-233 [DOI] [Google Scholar]
  • 42.Dussault HP. An improved technique for staining red halophilic bacteria. J Bacteriol 1955; 70:484-485 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Hyatt D, Chen GL, Locascio PF, Land ML, Larimer FW, Hauser LJ. Prodigal: prokaryotic gene recognition and translation initiation site identification. BMC Bioinformatics 2010; 11:119 10.1186/1471-2105-11-119 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Benson DA, Karsch-Mizrachi I, Clark K, Lipman DJ, Ostell J, Sayers EW. GenBank. Nucleic Acids Res 2012; 40:D48-53 10.1093/nar/gkr1202 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Lagesen K, Hallin P, Rodland EA, Staerfeldt HH, Rognes T, Ussery DW. RNAmmer: consistent and rapid annotation of ribosomal RNA genes. Nucleic Acids Res 2007; 35:3100-3108 10.1093/nar/gkm160 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Lowe TM, Eddy SR. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 1997; 25:955-964 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Bendtsen JD, Nielsen H, von Hiejne G, Brunak S. Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 2004; 340:783-795 10.1016/j.jmb.2004.05.028 [DOI] [PubMed] [Google Scholar]
  • 48.Krogh A, Larsson B, von Heijne G, Sonnhammer EL. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol 2001; 305:567-580 10.1006/jmbi.2000.4315 [DOI] [PubMed] [Google Scholar]
  • 49.Carver T, Thomson N, Bleasby A, Berriman M, Parkhill J. DNAPlotter: circular and linear interactive genome visualization. Bioinformatics 2009; 25:119-120 10.1093/bioinformatics/btn578 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Rutherford K, Parkhill J, Crook J, Horsnell T, Rice P, Rajandream MA, Barrell B. Artemis: sequence visualization and annotation. Bioinformatics 2000; 16:944-945 10.1093/bioinformatics/16.10.944 [DOI] [PubMed] [Google Scholar]
  • 51.Lechner M, Findeiss S, Steiner L, Marz M, Stadler PF, Prohaska SJ. Proteinortho: detection of (co-)orthologs in large-scale analysis. BMC Bioinformatics 2011; 12:124 10.1186/1471-2105-12-124 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Buchanan RE, Gibbons NE. Family V. Halobacteriaceae fam. nov. In: Bergey's Manual of Systematic Bacteriology. 1974; p. 279. [Google Scholar]

Articles from Standards in Genomic Sciences are provided here courtesy of BMC

RESOURCES