Abstract
The dissemination of prostate cancer to bone is a common, incurable aspect of advanced disease. Prevention and treatment of this terminal phase of prostate cancer requires improved molecular understanding of the process as well as markers indicative of molecular progression. Through biochemical analyses and loss-of-function in vivo studies we demonstrate that the cell adhesion molecule ALCAM is actively shed from metastatic prostate cancer cells by the sheddase ADAM17 in response to TGFβ. Not only is this post-translational modification of ALCAM a marker of prostate cancer progression, the molecule is also required for effective metastasis to bone. Biochemical analysis of prostate cancer cell lines reveal that ALCAM expression and shedding is elevated in response to TGFβ signaling. Both in vitro and in vivo shedding is mediated by ADAM17. Longitudinal analysis of circulating ALCAM in tumor-bearing mice revealed that shedding of tumor, but not host-derived ALCAM is elevated during growth of the cancer. Gene-specific knockdown of ALCAM in bone-metastatic PC3 cells greatly diminished both skeletal dissemination and tumor growth in bone. The reduced growth of ALCAM knockdown cells corresponded to an increase in apoptosis (Caspase-3) and decreased proliferation (Ki-67). Together these data demonstrate that the ALCAM is both a functional regulator as well as marker of prostate cancer progression.
Keywords: skeletal metastasis, bone, prostate cancer, tumor markers and detection of metastasis, molecular diagnosis and prognosis
INTRODUCTION
Morbidity and mortality among prostate cancer patients is frequently a result of metastatic dissemination to bone. To date there is no curative treatment for skeletal metastasis and survival from the time of diagnosis is merely 3–5 years (1). Moreover, skeletal events are associated with high morbidity in the form of in bone loss, fractures, and pain (2). Even for patients with organ-confined disease, the risk of disease progression drives the rigor of clinical intervention. Patients have been shown to do well on a regimen of active surveillance, which avoids the morbidity associated with surgery. However, without a better understanding of the mechanisms that drive progression and biomarkers to predict the risk of progression, many patients and physicians are not comfortable pursuing this option, and instead opt for more invasive “definitive” interventions. Thus, clinical intervention would greatly benefit from further understanding of the molecular mechanisms that drive skeletal metastasis as well as molecular indicators that identify patients at risk of disease progression. Since cell motility is an important contributor to metastasis, the activation state of migratory mechanisms could be suitable for both therapeutic intervention as well as a biomarker of metastatic behavior.
Tumor cell metastasis to distant sites, including bone, is a multi-step process. Cancer cells must first detach from the primary tumor site and migrate locally to invade blood vessels. Thereafter, tumor cells intravasate into the bloodstream and are attracted to preferred sites of metastasis through site-specific cellular and microenvironmental interactions (3,4). Activated Leucocyte Cell Adhesion Molecule (ALCAM) is a cell adhesion molecule that engages in homotypic and heterotypic cell adhesion in a calcium-independent manner (5). It has been implicated in a number of adhesive and migratory behaviors including axonal guidance, leukocyte homing and cancer metastasis. ALCAM can be proteolytically cleaved at the cell surface by ADAM17 causing the ectodomain to be shed. This shedding can be induced by ionomycin, PMA, and epidermal growth factors (6). Proteolytic cleavage/shedding of cell surface proteins is a common regulatory mechanism which can alter the function and localization of transmembrane proteins such as cell adhesion molecules, growth factors and growth factor receptors. This regulation can weaken cell adhesion and destabilize adherens junctions as in the case of E-cadherin, through the loss of homotypic cell adhesion molecular interactions (7). The soluble shed ectodomain can act as a soluble antagonist, thereby competing for membrane-bound receptors or cell adhesion molecules. While these processes are important in development, they have also been associated with tumorigenesis. Functionally, expression of the truncated, trans-membrane fragment of ALCAM in BLM melanoma cells results in increased lung metastasis in vivo, while overexpression of a soluble extracellular ligand-binding fragment diminished metastases (for review see (8) and (9). Previous studies from our lab and others have investigated the clinical relevance of ALCAM expression and shedding in a variety of human malignancies, including colorectal, breast, ovarian, thyroid and prostate cancer (10–16). However its molecular contribution to disease progression remains unclear.
Elevated ALCAM expression in aggressive prostate cancer (17) together with its putative role in cell adhesion/migration (8,18) suggested that ALCAM is a molecular participant in prostate cancer metastasis to bone. Based on our own work in colorectal cancer (10) and concomitant work in breast (19) as well as ovarian cancer (11), we hypothesized that ectodomain shedding of ALCAM is likely to correspond with prostate cancer progression. Furthermore, considering the dominant role of TGFβ in driving skeletal metastasis of prostate cancer (20,21) we postulated that this cytokine could influence ALCAM expression and/or shedding. The present study investigates ALCAM expression and shedding during prostate cancer progression, evaluates the influence of TGFβ stimulation and determines the contribution of ALCAM to skeletal metastasis in a series of orthotopic, and experimental metastasis models.
MATERIALS AND METHODS
Reagents, cell culture
Full-length purified recombinant porcine TGFβ was obtained from R&D (Minneapolis, MN). Antibodies against ALCAM were obtained from R&D Systems (Clone 105902). The following tumor cell lines were obtained from American Type Culture Collection (Manassas, VA) and maintained according to the American Type Culture Collection’s recommendations: DU145, LNCaP, PC3 (prostate metastasis). PC3-luciferase (PC3-luc) cells (Simon Hayward, Vanderbilt) were cultured in RPMI/10%FBS.
SDS-PAGE and immunoblotting
Cells (2.5 × 105) were plated in 6-well dishes. After 24 h, cells were serum starved in Opti-MEM for 16 h and then treated in the presence or absence of indicated growth factors or inhibitors, for 48 h. After that, the cells were lysed in TNE Lysis Buffer (20 mM Tris-Cl [pH 7.4], 0.5 mM EDTA, 1% Triton X-100, 150 mM NaCl, protease inhibitor cocktail (Sigma), 1 mM phenylmethylsulfonyl fluoride). Total protein in the lysates was quantified using BCA assay (BioRad). Conditioned media samples were concentrated with microcon centrifugal filters (Millipore) following manufacturers protocol, which were eluted directly in 5X sample buffer for Western blot analysis. Protein loading for conditioned-medium samples for Western blot analysis was adjusted according to the total protein in cell lysates. Conditioned media and total protein was subjected to SDS-PAGE and electrophoretic transfer to polyvinylidene difluoride membranes (Immobilon P, Millipore, Inc., Bedford, MA). Immunodetection was done by conventional chemiluminescence
Quantitative PCR
The mRNA samples were prepared from tumor cells lysed in TRI Reagent (Ambion) and purified using phenol extraction, followed by real-time polymerase chain reaction (RT-PCR). The following qPCR primers were used ALCAM, TCAAGGTGTTCAAGCAACCA (forward) and CTGAAATGCAGTCACCCAAC (reverse); ADAM17, ATGTTTCACGTTTGCAGTCTCCA (forward) and CATGTATCTGTAGAAGCGATGATCTG (reverse); and glyceraldehyde-3-phosphate dehydrogenase, ATCTTCTTTTGCGTCGCCAG (forward) and TTCCCCATGGTGTCTGAGC (reverse).
ShRNA Knockdown
To establish cell lines in which ALCAM expression is stably knocked down cells were transduced with ALCAM-specifc Mission shRNA (Sigma) lentivirus. Following transduction, cells were selected in 10μg/ml of puromycin. Transduced cells were flow sorted for ALCAM expression and ALCAM knock-down cells were cultured and maintained on 5μg/ml of puromycin.
Migration Assay
Two-dimensional gap closure assays (formerly known as scratch assays) were conducted using magnetically attachable stencils attached to culture plates (22). In short, 250,000 cells were seeded in 6-well plates and allowed to recover overnight to form a confluent monolayer. Stencils were removed with tweezers, after which cells were rinsed with PBS to remove detached cells. Culture medium was re-added and closure of the gap was measured at 8 and 16 hours. Gap closure was quantified using TScratch (National Institutes of Health, Bethesda, MD, USA).
Histological analysis of mouse tissue
Tumor-bearing tissue and bones were fixed in 10% formalin. Bone specimens were decalcified in 20% EDTA pH 7.4 for 3–4 days at room temperature. Decalcified bone and tissue were dehydrated and embedded in paraffin. Tumor burden was confirmed in 5μm serial sections stained with H&E. Osteoclast were visualized using a standard Tartrate Resistant Acid Phosphatase (TRAP) protocol. All immunohistochemistry and immunofluorescence on tumor sections involved antigen retrieval using a standard pH 6.0 citrate buffer followed by blocking via incubation with 20% Aquablock (East Coast Bio). Immunofluorescence data was obtained using primary antibodies for ALCAM (1:1000; Leica Biosystems; Clone, MOG/07), Ki67 (1:500; Fisher, Clone SP6), Cleaved caspase-3 (1:200; CellSignaling, D175), and collagen I (1:1000; Sigma C2206) by incubation overnight at 4°C. Corresponding Alexa Fluor® secondary antibodies were used (1:1000; Invitrogen). Fluorescent imaging was completed on a Olympus BX61WI upright fluorescent microscope using Volocity Imaging Software.
ELISA of mouse serum and plasma
Blood was obtained via the saphenous vein; samples were collected in either the presence of EDTA as an anticoagulant or a serum separator tube (Fisher Scientific cat#1491559 and 1491553 respectively) and were centrifuged at 1,500 rpm, 4°C to remove cells. Plasma and serum samples were stored at −80°C until analyzed. Samples were analyzed for soluble mouse and human ALCAM using the R&D Systems DuoSet following manufacturers instructions. Briefly, ELISA plates coated with capture antibody were incubated overnight with 100 μL of sera diluted 1:50. Capture ALCAM was detected with biotinylated antibody and peroxidase-conjugated avidin followed by colorimetric detection at 450 nm.
Mouse models of prostate cancer and in vivo quantitation of tumor growth
All experimental protocols were approved by the Vanderbilt University Institutional Animal Care and Use Committee. Orthotopic prostate xenografts were performed according to Li et. al (23). Briefly, 5×104 PC3-luc cells were suspended in 30 μl of neutralized type I collagen and allowed to polymerize for 16 hrs at 37°C before implantation into the prostate of 10 week old C.B-17/IcrHsd-Prkdc scid male mice (Harlan). Tumor growth was monitored weekly by bioluminescent detection of luciferase expressing cells. For the xenograft model, subconfluent PC3-luc cells were trypsinized, washed twice in PBS to remove serum, and then resuspended in HBSS at a concentration of 1 × 107 cells/mL. One hundred μl containing 1 × 106 PC3 cells in a 50/50 mix of PBS and growth factor-reduced Matrigel (BD Biosciences) were injected subcutaneously into the right flank of 7-week-old nude male mice (Harlan Laboratories; athymic Foxn1 nu/nu). Tumor growth was monitored weekly by caliper measurements, and tumor volume was calculated based on the following formula: (length × length × width)/6. PC3-luciferase shControl (Vector) or PC3-luciferase shALCAM (KD2 or KD3) tumor cells (1×105) in a 10 μl volume of sterile phosphate buffered saline (PBS) were injected into the tibia of anesthetized 6-week-old nude male mice (Harlan Laboratories) Skeletal metastasis was performed as previously described by Park et. al. (24) and visualized in as in (25). Briefly, 1 × 105 PC-3-luc cells were injected into the left heart ventricle of male nude mice (Harlan Laboratories). Skeletal metastases were monitored by bioluminescent detection of luciferase expressing cells and formation of bone lesion by X-ray. Whole animal luminescent imaging was performed with the IVIS™ system (Caliper Life Sciences, Hopkinton, MA). Luciferin (150 mg/kg in sterile PBS, Biosynth International, Itasca, IL) was delivered via intra-peritoneal injection 10 minutes prior imaging. Living Image™ software (Caliper Life Sciences) was used to quantify the luminescence intensity. Blood was obtained via the saphenous vein and collected in either the presence of EDTA as an anticoagulant or a serum separator tube (Fisher Scientific). Plasma and serum samples were stored at −80°C until analyzed.
Micro computed tomography (μCT) analysis
For gross analysis of trabecular bone volume, formalin fixed tibiae were scanned at an isotropic voxel size of 12 μm using a microCT40 (SCANCO Medical, Bruttisellen, Switzerland). The tissue volume (TV) was derived from generating a contour around the metaphyseal trabecular bone that excluded the cortices. The area of measurement began at least 0.2 mm below the growth plate and was extended by 0.12 mm. The bone volume (BV) included all bone tissue that had a material density greater than 438.7 mgHA/cm3.
Radiographic Analysis
Beginning 1 week after tumor cell inoculation, tumor-bearing animals were subjected to radiographic imaging. Radiographic images (Faxitron X-ray Corp, Lincolnshire, IL, USA) were obtained using an energy of 35 kV and an exposure time of 8 seconds. Osteolytic lesions were quantified bilaterally in the tibia, fibula, femora, humeri, and pelvis at the endpoint using x-ray images. Lesion area and lesion numbers were evaluated using image analysis software (Metamorph, Molecular Devices, Inc.). Data presented are the average of lesion area and lesion numbers per mouse in each group.
Statistical Analyses
Expression analysis was performed on datasets GDS1439 and GSE10645 available through the Gene Expression Omnibus (references (26)and (27) respectively). Expression data for selected genes from GDS1439 was clustered in software Cluster 3.0 and visualized with software TreeView. For survival analysis the patient population of GSE10645 (n=596) was dichotomized across upper and lower quartile of ALCAM expression. Statistics were completed using either R, SPSS or GraphPad Prism. For all standard bar and box plots the results were reported as mean and SEM unless stated otherwise in the legend. Comparisons were performed using unpaired two-sided Student’s t test, nonparametric Mann-Whitney test, or one-way ANOVA. R2 and P values were reported from linear regression analysis of mouse data. All statistical tests were considered significant when pitalic>0.05 where * denotes pbold> 0.05, ** denotes p< 0.01 and *** denotes p< 0.001.
RESULTS
ALCAM gene expression is elevated in advanced prostate cancer and correlates with poor patient outcome
Changes in ALCAM expression have been linked to patient outcome for several malignancies. In prostate cancer the correlation of ALCAM expression with patient outcome is sometimes conflicting. Minner et. al. (15) conclude that reduced ALCAM expression correlates to poor patient outcome while the opposite was suggested by Kristiansen et. al. (17). We evaluated several publicly available microarray datasets to determine the relationship between ALCAM mRNA levels, patient diagnosis and outcome (Fig. 1). ALCAM expression appears to be elevated in an experimental model of Epithelial-Mesenchymal Transition performed by the Weinberg laboratory ((28) GSE9691, Suppl. Fig. 1). Indeed, a comparison of benign, localized and metastatic prostate cancer revealed that the level of ALCAM mRNA increased in metastatic disease (Fig. 1A, GDS1439) and coincided with molecular evidence of a pro-migratory phenotype based on the decreased expression of E-cadherin and p120 with concurrently elevated expression of N-cadherin (Fig. 1B). These observations were supported by survival analysis for a cohort of 596 prostate cancer patients (GSE10645) which revealed that high levels of ALCAM mRNA corresponded with poor patient outcome. (Fig. 1C). Immunohistological staining of prostate cancer tissue microarrays available through the Human Protein Atlas (29) revealed that ALCAM staining is clearly evident in both normal, low grade and medium grade disease but is frequently absent from the tumor cell surface in high grade disease (proteinatlas.org, Fig. 1D).
Figure 1. ALCAM is overexpressed in metastatic prostate cancer and correlates with patient survival.
(A) ALCAM expression levels were analyzed in publicly available dataset (GDS1439, n=19) of prostate cancer. Heat map (A) and corresponding relative expression (B) of ADAM17 (i) ALCAM (ii) N-cadherin (iii), p120 (iv) and E-cadherin (v) indicated by arrows. (C) Correlation of ALCAM expression to overall survival in a publicly available dataset (GSE10645) composed of 596 prostate cancer patients. Kaplan-Meier survival curves represent the upper and lower quartile ALCAM expression. (D) Representative images from immunohistochemical staining of ALCAM membranous and cytoplasmic expression in benign to metastatic prostate cancer. Images obtained through The Human Protein Atlas.
TGFβ induces ALCAM expression and shedding
Because ALCAM is associated with disease progression we set out to determine its contribution to the skeletal metastasis of prostate cancer. Moreover, since bone metastasis is driven in large part by TGFβ (2,20,21) we investigated the ability of this cytokine to promote ALCAM shedding in vitro. ALCAM is proteolytically shed from PC3 cells (Suppl. Fig. 2). Absence of the cytoplasmic tail in the conditioned medium confirms that the ectodomain is shed (Suppl. Fig. 2A). Moreover, ALCAM is absent from PC3-derived exosomes ensuring that the ectodomain is shed and not released with cell-derived microparticles (Suppl. Fig. 2B). Selected cytokines thought to be involved in metastasis to bone, including TGFβ, were tested for their ability to alter ALCAM shedding (Fig. 2A). ALCAM shed into the conditioned media is detected by ELISA and normalized to the amount of cellular ALCAM detected in the lysate. Of the 8 agents tested, only TGFβ was able to promote ALCAM shedding. To further explore the response to exogenous stimulation with TGFβ, ALCAM expression in PC3 cells was compared to ALCAM expression in LNCaP cells which are unable to respond to the cytokine because they lack TGFβ receptor type I (30)(Fig. 2B and C). Quantitative RT-PCR analysis for ALCAM demonstrates that TGFβ was also able to induce ALCAM gene transcription in PC3 but not LNCaP cells (Fig. 2B). The absence of any significant increase in lysate ALCAM further supports cytokine-induced ALCAM shedding (FIg. 2C). Conversely, LNCaP did not respond to TGFβ even though these cells express abundant ALCAM (Fig. 2C). TGFβ-induced expression in PC3 cells could be abrogated with the small molecule inhibitor SB431542 (Fig. 2D, 10μm; Sigma) while TGFβ-induced ALCAM mRNA and protein expression could be restored in LNCaP cells when the cells were transfected with dominant-active TGFβ receptor type I (Fig. 2E&F).
Figure 2. Expression and shedding of ALCAM is increased in response to TGFβ.
(A)ELISA analysis of ALCAM shedding in concentrated conditioned media of PC3 cells treated with indicated exogenous cytokines. TGFβ, p<0.001 (B) Expression of ALCAM by RT-PCR fold change relative to GAPDH, glyceraldehyde 3-phosphate dehydrogenase in PC3 or LNCaP cells treated with or without 10ng/ml of TGFβ for 48 hrs (C) Western blot analysis of shed ALCAM in the conditioned media and intact ALCAM in the cell lysate in LNCaP and PC3 cells. D) Western blot detection of ALCAM and Phospho-smad2 expression in PC3 cells treated with 10ng/ml TGFβ for 48 hrs. in the presence or absence of 10μM SB431542, a TGFβ receptor tyrosine kinase inhibitor. (E) RT-PCR and F) Western blot analysis of ALCAM expression in LNCaP cells transfected with vector control or T204D, dominant active TGFβ type I receptor; *p<0.05, **p<0.01.
ALCAM shedding in vivo correlates with tumor progression
Published clinical studies have demonstrated that circulating levels of ALCAM are frequently elevated in cancer patients (19,31,32). These studies suggest that ALCAM is shed by the tumor. Indeed, experimental models of ovarian cancers indicate elevated shedding of ALCAM specifically from the tumor (11). To determine if tumor-derived ALCAM is the source of elevated circulating ALCAM in prostate cancer we used species-specific antibodies to monitor circulating levels of both host (mouse) ALCAM and tumor (human) ALCAM longitudinally during orthotopic and subcutaneous growth of PC3 cells (Fig. 3). To determine that tumor-derived ALCAM could act as a stable biomarker of cancer in vivo we determined the half-life of human ALCAM in the circulation of its mouse host (Suppl. Fig. 3). Circulating ALCAM exhibits a 17hr half-life which is sufficient for monitoring its release from an endogenous tumor burden.
Figure 3. ALCAM shedding correlates with tumor burden.
Circulating ALCAM levels were monitored longitudinally in mice bearing subcutaneously (S.Q.) or orthotopically implanted PC3 cells. (A) Schematic representation of in vivo strategy for S.Q. and orthotopic tumor models. B and C) Circulating levels of soluble host and tumor-derived ALCAM detectable in mice bearing subcutaneous injected PC3 cells (B) or PC3 cells orthotopically implanted into the prostate (C). Levels of ALCAM are shown as a function of time (top) or tumor burden at the time of experiment completion (bottom). Each point reflects mean of duplicate measurements ± SD. Each line and corresponding R2 represents a best fit linear regression analysis.
Circulating levels of ALCAM were subsequently monitored on a weekly basis (Fig. 3A) in SCID mice bearing subcutanous (Fig. 3B, n=5) or orthotopic xenografts of PC3 (Fig. 3C, n=8). Animals were bled on a pre-determined schedule via saphenous vein puncture. Circulating ALCAM levels were detected by ELISA and a comparison to pre-grafting baseline levels allowed for the detection of any increase in host (mouse) ALCAM and the appearance of tumor (human) ALCAM in response to an increasing tumor burden. Tumor-derived ALCAM levels showed significant weekly increases in the serum of tumor-bearing mice (Fig. 3B,C, and Suppl. Fig. 4A; P < 0.0001). Regression analysis showed a direct linear relationship between circulating levels of tumor-derived ALCAM and tumor burden for subcutaneous xenografts (Fig. 3B; tumor-derived R2 = 0.707, p<0.0001, n = 4) and orthotopic xenografts (Fig. 3C; tumor-derived R2 = 0.7066, p<0.0001, n = 4). In contrast to tumor-derived ALCAM, changes in host-derived ALCAM did not correspond to tumor burden (Fig. 3B; host-derived R2 = 0.03671, n = 4 animals; Fig. 3C; host-derived R2 = 0.01358, n = 4 animals).
A significantly greater amount of circulating ALCAM was observed in mice bearing PC3 versus mice bearing LNCaP tumors (Suppl. Fig. 4B) supporting the relationship between malignancy and ALCAM shedding seen in vitro (Fig. 2C). Moreover, shedding increased for tumor cells selected from skeletal metastases (Suppl. Fig. 4F). Shedding is likely to be universally present in solid tumors as it has been reported for colon cancer (10), ovarian cancer (11) and is easily detected in models of breast and prostate cancer (Suppl. Fig. 4C–E).
ALCAM shedding is mediated by ADAM17 in vitro and in vivo
Since ALCAM is a proteolytic target of ADAM17 we hypothesized that ADAM17 was responsible for TGFβ-induced cleavage of ALCAM. This hypothesis was supported by published work demonstrating that TGFβ can increase ADAM17 activity by phosphorylation of the protease (33,34). Indeed, knockdown of ADAM17 using small interfering RNA (siRNA) transfection resulted in a loss of TGFβ-induced ALCAM shedding (Fig. 4A). Similar results were obtained using an ADAM17-specific inhibitor (Fig. 4B, Compound-32, BMS,(35)). These studies were extended to orthotopic models to confirm that ADAM17 was also the primary protease responsible for ALCAM shedding in vivo (Fig. 4C). In vivo dosing and efficacy for Compound-32 was confirmed using serum TNF-alpha (Suppl. Fig. 5, n=6) which demonstrated that 50% inhibition of ADAM17 could be achieved for the duration of the ALCAM serum half-life (Suppl. Fig. 3; 17hr) without signs of distress or toxicity. Mice were treated twice-daily for 3 days with 20mg/kg of the ADAM17 inhibitor (Compound-32 or vehicle DMSO control). Pre-surgery, weekly, pre- and post-treatment saphenous vein bleeds were collected. We found that inhibition of ADAM17 resulted in a significant decrease in serum levels of shed ALCAM approximating the 50% inhibition we achieved with our dosing studies (Suppl. Fig. 5). Taken together these data suggest that ALCAM cell surface shedding is mediated by ADAM17 and promoted by TGFβ.
Figure 4. Ectodomain shedding of ALCAM is mediated by ADAM17 in vitro and in vivo.

(A) Western blot analysis of shed ALCAM in the conditioned media and ADAM17 in the total cell lysate of PC3 transiently transfected with either scrambled siRNA or siRNA targeting ADAM17. (B) Western blot analysis of shed ALCAM in PC3 cells treated with an ADAM17-specific inhibitor (Compound-32, BMS), broad-spectrum MMP inhibitor (GM6001), or diluent control. (C)Serum levels of tumor-derived ALCAM in 10wk old SCID mice bearing PC3-luc tumors and treated with DMSO diluent or Compound-32 for three days, p=0.0005
Knockdown of ALCAM in PC3 cells inhibits TGFβ-induced migration and in vivo dissemination to bone
Given TGFβ is a central driver of tumor cell motility and metastasis, we sought to determine the effects of exogenous TGFβ on prostate cancer cells in vitro. To test whether ALCAM is functionally involved in tumor cell migration and metastasis, we knocked down expression in PC3-Luc cells using viral delivery of short hairpin RNA (shRNA). Three separate stable ALCAM knockdowns were produced (ALCAM KD 1, 2 and 3). Transduced cells were selected with puromycin and subsequently subjected to flow-sorting to isolate the highest knockdown population (Fig. 5A). We pre-treated PC3-luc-ALCAMKD1 cells and PC3-luc-ALCAMshControl cells with 10μg/ml TGFβ1 for 16hrs in serum-free conditions, followed by initiation of MAtS assay (Fig. 5B). The analysis revealed a loss TGFβ-induced migration in PC3-luc-ALCAMKD1 cells (Fig 5B). Similar observations were made in ALCAMKD2 and ALCAMKD3 PC3 cells as well as in MDA-MB-231 and A549 cells which represent breast and lung cancer respectively (Suppl. Fig. 6). Interestingly, the reduction in ALCAM expression led to a slight but statistically insignificant increase in spontaneous migration, possibly due to a loss of ALCAM-ALCAM homotypic interaction on adjacent cells.
Figure 5. Tumor-derived ALCAM mediates TGFβ-induced migration and skeletal metastasis but not primary tumor growth in the prostate.
(A) Western blot analysis of lysates from parental PC3-luc and PC3-luc shRNA ALCAM (KD1) knockdown cells. (B)Quantitative analysis of tumor cell migration in parental PC3 cells and PC3 cells with shRNA-mediated knockdown of ALCAM treated with or without 10ng/ml TGFβ. C) Whole animal luciferase imaging of mice bearing orthotopic PC3-luc parental tumors or PC3-luc ALCAM knockdown tumors 6-weeks post surgery. (D) Primary tumor weights of orthotopic PC3-luc parental tumors (n=8) and PC3-luc ALCAM knockdown tumors (n=8) (E) Representative whole-animal luciferase imaging and matching x-rays 8 weeks post-intracardiac injection of PC3-luc parental (shControl) or PC3-luc ALCAM knockdown (shALCAM, KD1). (F) Average number of bone lesions in mice from PC3-luc (1.42 ± 0.26; n=31) or PC3-luc shRNA ALCAM (KD1) knockdown cells (0.16 ± 0.07; n=25). ***p<0.0001.
Given the critical importance of cancer cell migration in malignant tumor expansion and metastasis, we subsequently evaluated the contribution of ALCAM to primary tumor growth and bone metastasis. Primary tumor growth was accomplished using an orthotopic model based on implantation of tumor cells into the anterior prostate of SCID mice (Fig. 5C, n=8 for PC3-luc-Control and PC3-luc-ALCAMKD1). Skeletal metastasis was accomplished by intracardiac injection of tumor cells in nude mice (Fig. 5D, n=31 for PC3-luc-Control and n=25 for PC3-luc-ALCAMKD1). Bioluminescent imaging was used to monitor tumor burden for both models at weekly intervals. Interestingly, reduced ALCAM expression did not limit tumor growth within the prostate (Fig. 5C). Whole body and ex vivo bioluminescent imaging of the orthotopic model upon experiment completion confirmed that both the PC3-luc-Control and PC3-luc-ALCAMKD1 exhibited similar tumor burden based on luciferase activity (Fig. 5C), and comparable tumor size based on weight (Fig. 5D). Local invasion and mesenteric dissemination is common in this model (36) and was not altered by reduced ALCAM expression.
In contrast to the orthotopic model, a reduction in ALCAM resulted in a significant decrease in skeletal metastasis (Fig. 5E). Both incidence and metastatic burden were reduced. Approximately 75% of mice injected with PC3-luc-Control tumor cells developed bone metastasis while only 17% of the mice injected with PC3-luc-ALCAMKD1 cells developed bone lesion. In addition, mice that did develop skeletal metastases formed by PC3-luc-ALCAMKD1, the number of lesions per mouse was greatly reduced (0.2 events versus 1.4 events, Fig. 5F). The orthotopic and intracardiac experiments were repeated with PC3-luc-ALCAMKD3 and similar results obtained.
Knockdown of ALCAM in PC3 cells diminishes tumor growth in bone
To determine the biologic importance of tumor-derived ALCAM in prostate tumor growth in the bone, PC3-luc-Control (n=8), PC3-luc-ALCAMKD2 (n=8) and PC3-luc-ALCAMKD3 (n=8) were injected into the tibia of nude mice. Following intratibial injection, luminescent and X-ray imaging was used to monitor tumor burden over time (Fig. 6A). Quantitation of the bioluminescent signal showed a markedly lower growth rate for the ALCAM KD cells (Fig 6B). At completion of the experiment 100% of control mice exhibited lesion compared to an 80% incidence in limbs bearing PC3-luc-ALCAMKD3 tumor cells (Fig. 6C). To confirm that ALCAM expression was not regained by ALCAMKD in vivo, immunofluorescent staining was performed on intratibial tumors (Fig. 6D).
Figure 6. Tumor-derived ALCAM impacts metastatic growth but not incidence after intratibial injection.
(A) Representative whole animal luciferase and x-ray imaging of mice post-intratibial injection of PC3-luc parental tumors (vector, n=8), and PC3-luc ALCAM knockdown tumor cells (KD2, n=8 & KD3, n=8). (B) Bioluminescent curve of intratibial tumor development in mice bearing PC3-luc vector, PC3-luc KD2 and KD3 tumors. (Two-way ANOVA with Bonferroni post-test). (C) Tumor incidence and average lesion area in the tibias of mice bearing PC3-luc vector, PC3-luc KD2 and KD3 tumors. Data represent the mean ± SEM (n=8/group);**p<0.01; ***p<0.0001. (D) Collagen I and ALCAM immunofluorescence of tumor cells within the tibias of mice bearing PC3-luc vector or PC3-luc KD2 or KD3 tumors.
ALCAM expression contributes to tumor cell survival and proliferation in the bone microenvironment
The reduced tumor burden after intratibial injection suggested a diminished capacity to grow in the bone. Detailed imaging of the osteolytic lesions by microCT (Fig. 7A) further confirmed decreased lesion area and increased bone volume in the bones containing ALCAM KD cells (Fig. 7B and C). Histological visualization of bone tumors generated by control and ALCAM KD cells resulted in reduced bone tumor size upon ALCAM knockdown (Fig. 7D), however, both control and ALCAM KD tumors were osteolytic as evidenced by positive staining for the osteoclast marker, tartrate-resistant alkaline phosphatase (Suppl. Fig. 7).
Figure 7. Tumor-derived ALCAM impacts tumor survival and proliferation in the bone microenvironment of intratibial bone tumor model.
A) Representative three dimensional reconstitutions of microCT images from mice injected with PC3-luc-vector, PC3-luc-KD1 and PC3-luc-KD2 tumor cells B) Boxplots of average BV/TV (bone volume/total volume) by group for the PC3-luc-vector, PC3-luc-KD2 and PC3-luc-KD3 tumor bearing mice. Data represents quartiles with dots indicating outliers (1.5x upper or lower quartile; n=16 tibias/group) *p<0.05, **p<0.01, (One-way ANOVA p=0.0047. Post-hoc Mann-Whitney) C) A boxplot representing the lesion area calculated from end-point x-ray images from the same experiment shows dramatic decrease in the lesion area in the KD2 and KD3 tumor lesions compared to vector control (One-way ANOVA p=0.0003. Post-hoc Mann-Whitney **p<0.01, ***p<0.0001. n=8/group). Lesionareas were measured using arbitrary pixel unit. D) Representative H&E stains of osteolytic bone lesions in the hind leg of mice. Outlines indicate the osteolytic tumor lesion within the bone. E) Representative immunofluorescent staining of cleaved caspase-3 positive cells (red) in tibias of PC3-luc-vector, PC3-luc-KD2 and PC3-luc-KD3 tumor-bearing mice. F) Representative immunofluorescent staining of Ki67 proliferating cells (red) in tibias of PC3-luc-vector, PC3-luc-KD2 and PC3-luc-KD3 tumor-bearing mice. Data are mean ± SEM (n=8/group); *p<0.05, **p<0.01, ***p<0.005 (One-way ANOVA; Mann-Whitney test). G) Apoptosis in the tumor-bone microenvironment as a function of total cell number was assessed by staining for cleaved caspase-3 in PC3-luc-vector, PC3-luc-KD2 and PC3-luc-KD3 tumor bearing tibias of mice 4 weeks post-injection. H) Proliferation in the tumor-bone microenvironment as a function of total cell number was assessed by staining for Ki67 in PC3-luc-vector, PC3-luc-KD2 and PC3-luc-KD3 tumor bearing tibias of mice 4 weeks post-injection.
To assess changes in survival and proliferation, bone tumors were stained for cleaved caspase-3 (Fig. 7E, apoptosis) and Ki67 (Fig. 7F, proliferation) respectively. Compared to the control tumors, the bone tumors created by both ALCAM KD cells exhibited elevated levels of cleaved caspase-3 suggesting that these cells are experiencing a reduced ability to survive (Fig. 7G). In addition, bone tumors from PC3-luc-ALCAMKD3 had significantly lower Ki67 staining indicating that reduced ALCAM expression diminished the ability of PC3 cells to proliferate (Fig. 7H). These observations indicate that ALCAM contributes to both proliferation and survival.
DISCUSSION
The data presented here reveals for the first time that ALCAM plays a important role in prostate cancer establishment in the bone microenvironment. ALCAM mRNA is elevated in malignant disease yet by immunohistochemistry it is frequently absent from the tumor cell surface in advanced disease (Fig. 1D and (15–17)). We have demonstrated recently that in colorectal cancer ectodomain shedding is responsible for the apparent loss of ALCAM detection (10). This shedding is likely to be the cause for conflicting results reported across several malignancies (37). Indeed the protease responsible for shedding of ALCAM ectodomain (ADAM17) is elevated in advanced prostate cancer (Fig. 1B and (38)). This data implies that, while ALCAM gene transcription is elevated in prostate cancer, ectodomain shedding depletes the cell surface of intact protein in advanced disease. Regression analysis showed a direct linear relationship between circulating levels of (human) tumor-derived ALCAM and tumor burden in animals with subcutaneous xenografts (Fig. 3B) and orthotopic xenografts (Fig. 3C). In contrast, the host-derived ALCAM did not correspond to tumor burden (Fig. 3B&C), demonstrating that elevations in circulating ALCAM are tumor-specific. Consistent with this observation, host-derived ALCAM does not increase, but rather decreases slightly, in immunocompetent mice challenged with Lipopolysaccharide (LPS, a model of acute inflammation)or full-thickness skin punch (a model for wound-healing, Suppl. Fig. 8A&B, respectively). These data suggest that tumor-derived ALCAM is a marker specific of tumor burden and that host ALCAM is not significantly shed in response to the tumor burden.
Suppression of ALCAM expression using gene-specific shRNAs prevented TGFβ-induced migration in vitro (Fig. 5B) and inhibited metastasis as well as tumor growth in bone in vivo (Fig. 5–7). These observations demonstrate that ALCAM is not only a marker of cancer progression but also a significant regulator of tumor cell migration and metastasis to bone. Within the metastatic cascade there are many sequential steps that can contribute to the overall success of any single metastatic lesion. Evaluation of the primary tumor within the prostate did not reveal any deficiency in growth or local invasion. Conversely, experimental metastasis by intracardiac injection resulted in nearly 10-fold reduction of skeletal metastasis (Fig. 5). This reduced metastatic incidence suggests that ALCAM is required for dissemination to the bone. Further examination of tumor growth after intratibial injection (Fig. 6) revealed a significant inhibition in tumor growth without affecting the tumor incidence. The reduced metastatic incidence from circulating tumor cells (intracardiac injection) together with the reduced growth of the metastatic burden in the bone (intratibial injection) without further impact on incidence indicates that ALCAM contributes to metastatic dissemination as well as growth in the metastatic sites. It remains to be determined if these two biological contributions are controlled by distinct molecular mechanisms.
Previous work has shown that both soluble ALCAM-Fc and blocking ALCAM antibodies are able to decrease in vitro transendothelial migration of THP1 monocytes (39). Although we could not test the role of ALCAM in extravasation directly, it is possible that the requirement for transendothelial migration extends to metastatic tumor cells. The reduced metastatic incidence after intracardiac injections indeed supports that hypothesis (Fig. 5). The lesions that did arise from circulating PC3-luc-ALCAMKD cells were smaller than those generated from PC3-luc-Control cells suggesting an additional contribution from ALCAM to metastatic growth. Indeed, metastatic lesions generated after intratibial injection of PC3-luc-ALCAMKD cells did not significantly impact tumor incidence (Fig. 6C) but did dramatically reduce expansion of the metastatic tumor burden (Fig. 7F).
Intratibial tumors generated by PC3-luc-ALCAMKD did not re-express ALCAM (Fig. 5D) allowing us to further investigate any molecular disparities between metastatic lesions that expressed ALCAM and those that did not. The abundant presence of osteoclast activity by TRAP staining (Suppl. Fig. 7) in metastatic lesions of PC3-luc-ALCAMKD suggests that there is no deficiency in osteolysis. Nevertheless, these lesions remain significantly remained smaller than those created by PC3-luc-Control suggesting that there was not a lag in tumor growth but rather a persistent reduced ability to proliferate or, conversely, a decreased ability to survive. A review of the literature reveals one study which suggested that the loss of ALCAM may be associated with a pro-apoptotic behavior in breast cancer cells (40). Although we did not observe reduced proliferation in vitro (Suppl. Fig 9), in vivo metastatic lesions created by PC3-luc-ALCAMKD did exhibit reduced proliferation and increased apoptosis. Intriguingly, PC3-luc-ALCAMKD2, which retains more ALCAM expression than PC3-luc-ALCAMKD3 (Fig. 6A), did not exhibit reduced proliferation suggesting that the threshold of ALCAM expression that influences cell survival is different from the threshold influencing cell proliferation.
Together these observations suggest a dual adhesive and signaling function of ALCAM whereby the intracellular signaling function of ALCAM functions to serve a protective role in apoptosis, and the extracellular adhesive function is required for extravasation and subsequent colonization at a secondary site. While we have convincing data that ALCAM expression is important in the osteotropism and survival of tumor cells in the bone, (Figure 5 & 7, respectively) further work is necessary to fully elucidate the mechanisms involved.
Conclusion
Here we have presented evidence that ALCAM not only serves as a longitudinal marker of tumor burden, but also contributes functionally to skeletal metastasis. Clinically, this may be of particular importance for prostate cancer where metastasis to bone is a frequent aspect of end-stage disease. Monitoring ALCAM status may provide an indicator of metastatic potential and the ability to monitor metastatic burden. The relevance of ALCAM in the bone microenvironment is coupled with our data showing ALCAM expression and shedding is driven by TGFβ, a known contributor of the vicious cycle in bone metastasis (2,41,42). Further elucidation of the mechanism by which ALCAM supports metastatic dissemination to bone can provide novel means of promoting cytotoxic therapy in patients with skeletal metastases.
Supplementary Material
Acknowledgments
We thank Drs. Carlos Arteaga (Vanderbilt University, USA) and Guido Swart (Radboud University, The Netherlands) for scientific insight and direction. This work was primarily supported by US Public Health Services grants CA120711-01 and CA143081-01 to AZ. AH was supported in part by T32 HL007751 and P50 CA098131. TDP was supported by CA136228 from the National Institutes of Health. JAS was supported by a VA Career Development Award.
Footnotes
Disclosure of Potential Conflicts of Interest
The authors have no potential conflicts of interest to disclose.
COMPETING INTERESTS
The authors have no competing interests.
References
- 1.Pound CR, Partin AW, Eisenberger MA, Chan DW, Pearson JD, Walsh PC. Natural history of progression after PSA elevation following radical prostatectomy. JAMA. 1999;281:1591–7. doi: 10.1001/jama.281.17.1591. [DOI] [PubMed] [Google Scholar]
- 2.Mundy GR. Metastasis to bone: causes, consequences and therapeutic opportunities. Nat Rev Cancer. 2002;2:584–93. doi: 10.1038/nrc867. [DOI] [PubMed] [Google Scholar]
- 3.Jin J-K, Dayyani F, Gallick GE. Steps in prostate cancer progression that lead to bone metastasis. Int J Cancer. 2011;128:2545–61. doi: 10.1002/ijc.26024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Palmer TD, Ashby WJ, Lewis JD, Zijlstra A. Targeting tumor cell motility to prevent metastasis. Adv Drug Deliv Rev. 2011;63:568–81. doi: 10.1016/j.addr.2011.04.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.van Kempen LC, Nelissen JM, Degen WG, Torensma R, Weidle UH, Bloemers HP, et al. Molecular basis for the homophilic activated leukocyte cell adhesion molecule (ALCAM)-ALCAM interaction. J Biol Chem. 2001;276:25783–90. doi: 10.1074/jbc.M011272200. [DOI] [PubMed] [Google Scholar]
- 6.Rosso O, Piazza T, Bongarzone I, Rossello A, Mezzanzanica D, Canevari S, et al. The ALCAM shedding by the metalloprotease ADAM17/TACE is involved in motility of ovarian carcinoma cells. Mol Cancer Res. 2007;5:1246–53. doi: 10.1158/1541-7786.MCR-07-0060. [DOI] [PubMed] [Google Scholar]
- 7.Pokutta S, Weis WI. Structure and mechanism of cadherins and catenins in cell-cell contacts. Annu Rev Cell Dev Biol. 2007;23:237–61. doi: 10.1146/annurev.cellbio.22.010305.104241. [DOI] [PubMed] [Google Scholar]
- 8.van Kempen LCLT, Meier F, Egeblad M, Kersten-Niessen MJF, Garbe C, Weidle UH, et al. Truncation of activated leukocyte cell adhesion molecule: a gateway to melanoma metastasis. J Invest Dermatol. 2004;122:1293–301. doi: 10.1111/j.0022-202X.2004.22531.x. [DOI] [PubMed] [Google Scholar]
- 9.Hansen AG, Swart GW, Zijlstra A. ALCAM. UCSD-Nature Molecule Pages. 2011 doi: 10.1038/mp.a004126.01. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hansen AG, Freeman TJ, Arnold SA, Starchenko A, jones-paris CR, Gilger MA, et al. Elevated ALCAM Shedding in Colorectal Cancer Correlates with Poor Patient Outcome. Cancer Research. 2013;73:2955–64. doi: 10.1158/0008-5472.CAN-12-2052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Carbotti G, Orengo AM, Mezzanzanica D, Bagnoli M, Brizzolara A, Emionite L, et al. Activated leukocyte cell adhesion molecule soluble form: a potential biomarker of epithelial ovarian cancer is increased in type II tumors. Int J Cancer. 2012;132:2597–605. doi: 10.1002/ijc.27948. [DOI] [PubMed] [Google Scholar]
- 12.King JA, Ofori-Acquah SF, Stevens T, Al-Mehdi A-B, Fodstad O, Jiang WG. Activated leukocyte cell adhesion molecule in breast cancer: prognostic indicator. Breast Cancer Res. 2004;6:R478–87. doi: 10.1186/bcr815. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Mezzanzanica D, Fabbi M, Bagnoli M, Staurengo S, Losa M, Balladore E, et al. Subcellular Localization of Activated Leukocyte Cell Adhesion Molecule Is a Molecular Predictor of Survival in Ovarian Carcinoma Patients. Clin Cancer Res. 2008;14:1726–33. doi: 10.1158/1078-0432.CCR-07-0428. [DOI] [PubMed] [Google Scholar]
- 14.Miccichè F, Da Riva L, Fabbi M, Pilotti S, Mondellini P, Ferrini S, et al. Activated leukocyte cell adhesion molecule expression and shedding in thyroid tumors. PLoS ONE. 2011;6:e17141. doi: 10.1371/journal.pone.0017141. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Minner S, Kraetzig F, Tachezy M, Kilic E, Graefen M, Wilczak W, et al. Low activated leukocyte cell adhesion molecule expression is associated with advanced tumor stage and early prostate-specific antigen relapse in prostate cancer. Hum Pathol. 2011;42:1946–52. doi: 10.1016/j.humpath.2011.02.017. [DOI] [PubMed] [Google Scholar]
- 16.Kristiansen G, Pilarsky C, Wissmann C, Stephan C, Weissbach L, Loy V, et al. ALCAM/CD166 is up-regulated in low-grade prostate cancer and progressively lost in high-grade lesions. Prostate. 2003;54:34–43. doi: 10.1002/pros.10161. [DOI] [PubMed] [Google Scholar]
- 17.Kristiansen G, Pilarsky C, Wissmann C, Kaiser S, Bruemmendorf T, Roepcke S, et al. Expression profiling of microdissected matched prostate cancer samples reveals CD166/MEMD and CD24 as new prognostic markers for patient survival. J Pathol. 2005;205:359–76. doi: 10.1002/path.1676. [DOI] [PubMed] [Google Scholar]
- 18.Lunter PC, van Kilsdonk JWJ, van Beek H, Cornelissen IMHA, Bergers M, Willems PHGM, et al. Activated leukocyte cell adhesion molecule (ALCAM/CD166/MEMD), a novel actor in invasive growth, controls matrix metalloproteinase activity. Cancer Research. 2005;65:8801–8. doi: 10.1158/0008-5472.CAN-05-0378. [DOI] [PubMed] [Google Scholar]
- 19.Witzel I, Schröder C, Müller V, Zander H, Tachezy M, Ihnen M, et al. Detection of activated leukocyte cell adhesion molecule in the serum of breast cancer patients and implications for prognosis. Oncology. 2012;82:305–12. doi: 10.1159/000337222. [DOI] [PubMed] [Google Scholar]
- 20.Hu Z, Gupta J, Zhang Z, Gerseny H, Berg A, Chen Y-J, et al. Systemic delivery of oncolytic adenoviruses targeting transforming growth factor-β inhibits established bone metastasis in a prostate cancer mouse model. Hum Gene Ther. 2012;23:871–82. doi: 10.1089/hum.2012.040. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Wilding G, Zugmeier G, Knabbe C, Flanders K, Gelmann E. Differential effects of transforming growth factor beta on human prostate cancer cells in vitro. Mol Cell Endocrinol. 1989;62:79–87. doi: 10.1016/0303-7207(89)90115-9. [DOI] [PubMed] [Google Scholar]
- 22.Ashby WJ, Wikswo JP, Zijlstra A. Magnetically attachable stencils and the non-destructive analysis of the contribution made by the underlying matrix to cell migration. Biomaterials. 2012;33:8189–203. doi: 10.1016/j.biomaterials.2012.07.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Li H, Jiang M, Honorio S, Patrawala L, Jeter CR, Calhoun-Davis T, et al. Methodologies in assaying prostate cancer stem cells. Methods Mol Biol. 2009;568:85–138. doi: 10.1007/978-1-59745-280-9_7. [DOI] [PubMed] [Google Scholar]
- 24.Park SI, Kim S-J, McCauley LK, Gallick GE. Pre-clinical mouse models of human prostate cancer and their utility in drug discovery. Curr Protoc Pharmacol. 2010;Chapter 14(Unit14.15) doi: 10.1002/0471141755.ph1415s51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Campbell JP, merkel AR, Masood-Campbell SK, Elefteriou F, Sterling JA. Models of bone metastasis. J Vis Exp. 2012:e4260. doi: 10.3791/4260. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Varambally S, Yu J, Laxman B, Rhodes DR, Mehra R, Tomlins SA, et al. Integrative genomic and proteomic analysis of prostate cancer reveals signatures of metastatic progression. Cancer Cell. 2005;8:393–406. doi: 10.1016/j.ccr.2005.10.001. [DOI] [PubMed] [Google Scholar]
- 27.Nakagawa T, Kollmeyer TM, Morlan BW, Anderson SK, Bergstralh EJ, Davis BJ, et al. A Tissue Biomarker Panel Predicting Systemic Progression after PSA Recurrence Post-Definitive Prostate Cancer Therapy. PLoS ONE Public Library of Science. 2008;3:e2318. doi: 10.1371/journal.pone.0002318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Onder TT, Gupta PB, Mani SA, Yang J, Lander ES, Weinberg RA. Loss of E-cadherin promotes metastasis via multiple downstream transcriptional pathways. Cancer Research. 2008;68:3645–54. doi: 10.1158/0008-5472.CAN-07-2938. [DOI] [PubMed] [Google Scholar]
- 29.Uhlen M, Oksvold P, Fagerberg L, Lundberg E, Jonasson K, Forsberg M, et al. Towards a knowledge-based Human Protein Atlas. Nat Biotechnol Nature Publishing Group. 2010;28:1248–50. doi: 10.1038/nbt1210-1248. [DOI] [PubMed] [Google Scholar]
- 30.Kim IY, Ahn HJ, Zelner DJ, Shaw JW, Sensibar JA, Kim JH, et al. Genetic change in transforming growth factor beta (TGF-beta) receptor type I gene correlates with insensitivity to TGF-beta 1 in human prostate cancer cells. Cancer Research. 1996;56:44–8. [PubMed] [Google Scholar]
- 31.Tachezy M, Zander H, Gebauer F, Marx A, Kaifi JT, Izbicki JR, et al. Activated leukocyte cell adhesion molecule (CD166)-Its prognostic power for colorectal cancer patients. J Surg Res. 2012 doi: 10.1016/j.jss.2012.02.013. [DOI] [PubMed] [Google Scholar]
- 32.Tachezy M, Effenberger K, Zander H, Minner S, Gebauer F, Vashist YK, et al. ALCAM (CD166) expression and serum levels are markers for poor survival of esophageal cancer patients. Int J Cancer. 2012;131:396–405. doi: 10.1002/ijc.26377. [DOI] [PubMed] [Google Scholar]
- 33.Wang SE, Xiang B, Guix M, Olivares MG, Parker J, Chung CH, et al. Transforming growth factor beta engages TACE and ErbB3 to activate phosphatidylinositol-3 kinase/Akt in ErbB2-overexpressing breast cancer and desensitizes cells to trastuzumab. Mol Cell Biol. 2008;28:5605–20. doi: 10.1128/MCB.00787-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Soond SM, Everson B, Riches DWH, Murphy G. ERK-mediated phosphorylation of Thr735 in TNFalpha-converting enzyme and its potential role in TACE protein trafficking. J Cell Sci. 2005;118:2371–80. doi: 10.1242/jcs.02357. [DOI] [PubMed] [Google Scholar]
- 35.Ott GR, Asakawa N, Lu Z, Anand R, Liu R-Q, Covington MB, et al. Potent, exceptionally selective, orally bioavailable inhibitors of TNF-alpha Converting Enzyme (TACE): novel 2-substituted-1H-benzo[d]imidazol-1-yl)methyl)benzamide P1′ substituents. Bioorganic & Medicinal Chemistry Letters. 2008;18:1577–82. doi: 10.1016/j.bmcl.2008.01.075. [DOI] [PubMed] [Google Scholar]
- 36.Wang Y, Xue H, Cutz J-C, Bayani J, Mawji NR, Chen WG, et al. An orthotopic metastatic prostate cancer model in SCID mice via grafting of a transplantable human prostate tumor line. Lab Invest. 2005;85:1392–404. doi: 10.1038/labinvest.3700335. [DOI] [PubMed] [Google Scholar]
- 37.Ofori-Acquah SF, King JA. Activated leukocyte cell adhesion molecule: a new paradox in cancer. Translational research: the journal of laboratory and clinical medicine. 2008;151:122–8. doi: 10.1016/j.trsl.2007.09.006. [DOI] [PubMed] [Google Scholar]
- 38.Karan D, Lin FC, Bryan M, Ringel J, Moniaux N, Lin M-F, et al. Expression of ADAMs (a disintegrin and metalloproteases) and TIMP-3 (tissue inhibitor of metalloproteinase-3) in human prostatic adenocarcinomas. Int J Oncol. 2003;23:1365–71. [PubMed] [Google Scholar]
- 39.Masedunskas A, King JA, Tan F, Cochran R, Stevens T, Sviridov D, et al. Activated leukocyte cell adhesion molecule is a component of the endothelial junction involved in transendothelial monocyte migration. FEBS Lett. 2006;580:2637–45. doi: 10.1016/j.febslet.2006.04.013. [DOI] [PubMed] [Google Scholar]
- 40.Jezierska A, Matysiak W, Motyl T. ALCAM/CD166 protects breast cancer cells against apoptosis and autophagy. Med Sci Monit. 2006;12:BR263–73. [PubMed] [Google Scholar]
- 41.Bussard KM, Gay CV, Mastro AM. The bone microenvironment in metastasis; what is special about bone? Cancer Metastasis Rev. 2008;27:41–55. doi: 10.1007/s10555-007-9109-4. [DOI] [PubMed] [Google Scholar]
- 42.Buijs JT, Que I, Löwik CWGM, Papapoulos SE, van der Pluijm G. Inhibition of bone resorption and growth of breast cancer in the bone microenvironment. Bone. 2009;44:380–6. doi: 10.1016/j.bone.2008.10.047. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.






