Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Sep 1.
Published in final edited form as: Mol Microbiol. 2014 Aug 5;93(5):1043–1056. doi: 10.1111/mmi.12716

Prion promoted phosphorylation of heterologous amyloid is coupled with ubiquitin-proteasome system inhibition and toxicity

Zi Yang 1, David E Stone 1, Susan W Liebman 1,2,*
PMCID: PMC4150831  NIHMSID: NIHMS614058  PMID: 25039275

Summary

Many neurodegenerative diseases are associated with conversion of a soluble protein into amyloid deposits, but how this is connected to toxicity remains largely unknown. Here, we explore mechanisms of amyloid associated toxicity using yeast. [PIN+], the prion form of the Q/N-rich Rnq1 protein, was known to enhance aggregation of heterologous proteins, including the overexpressed Q/N-rich amyloid forming domain of Pin4 (Pin4C), and Pin4C aggregates were known to attract chaperones, including Sis1. Here we show that in [PIN+] but not [pin−] cells, overexpression of Pin4C is deadly and linked to hyperphosphorylation of aggregated Pin4C. Furthermore, Pin4C aggregation, hyperphosphorylation and toxicity are simultaneously reversed by Sis1 overexpression. Toxicity may result from proteasome overload because hyperphosphorylated Pin4C aggregation is associated with reduced degradation of a ubiquitin-protein degradation reporter. Finally, hyperphosphorylation of endogenous full-length Pin4 was also facilitated by [PIN+], revealing that a prion can regulate posttranslational modification of another protein.

Keywords: Prion toxicity, amyloid phosphorylation, Ubiquitin-proteasome system impairment

Introduction

Amyloid diseases comprise a large group of neurodegenerative disorders, including Alzheimer’s, Parkinson’s, and Huntington’s diseases. These diseases are all associated with the misfolding and conversion of the “prion domain” of particular proteins into amyloid (Aguzzi & Rajendran, 2009). Amyloid fibrils share a cross-β structure, in which β-sheet strands run perpendicular to the fiber, and accumulate in intracellular inclusions or in extracellular deposits as amyloid plaques. Because of their ubiquitous presence in affected tissues, amyloid fibrils are a hallmark of amyloid disease. Prions are infectious amyloids, and mammalian prion diseases are associated with the accumulation of an insoluble aggregated amyloid form of the PrP protein, PrPsc (Prusiner, 1982).

The prion paradigm has been extended to include protein-based genetic elements found in fungi (Wickner, 1994). The most-studied yeast prion [PSI+] is the self-propagating conformation of a translation termination factor Sup35 (Wickner et al., 1995). [PIN+] (also called [RNQ+]) is the prion form of Rnq1 which is a protein of unknown function with a glutamine (Q)/asparagine (N) rich prion domain (Derkatch et al., 2001, Sondheimer & Lindquist, 2000). [PIN+] promotes overexpressed Sup35, also with a Q/N rich prion domain, to efficiently convert into the [PSI+] prion (Derkatch et al., 2001, Derkatch et al., 1997, Derkatch et al., 2000). Heritable variants of the [PIN+] prion are distinguished by their efficiency in promoting [PSI+] genesis with the efficiency gradually decreasing from very high to high to medium to low [PIN+] (Bradley et al., 2002).

Two yeast prions have been associated with toxicity when the prion protein is overexpressed (Derkatch et al., 1996, Stein & True, 2011). Overexpression of the yeast translation termination factor Sup35 in presence of its prion form [PSI+] leads to the formation of large Sup35 aggregates that bind to and sequester the essential Sup35 binding partner, Sup45 (Dagkesamanskaya & Ter-Avanesyan, 1991, Derkatch et al., 1996, Vishveshwara et al., 2009). Loss of the Sup45 activity is the direct cause of toxicity. Overexpression of Rnq1 in the presence of [PIN+] causes the accumulation of soluble oligomeric Rnq1, presumably the result of non-productive templating (Douglas et al., 2008). Toxicity occurs because these nonamyloid Rnq1 oligomers sequester Spc42, a core spindle pole body (SPB) component, resulting in defective SPB duplication and cell cycle arrest (Treusch & Lindquist, 2012). The toxicity is relieved by overexpression of the Hsp40 chaperone, Sis1, which recruits overexpressed Rnq1 into the nucleus and increases the assembly of benign amyloid (Douglas et al., 2008, Douglas et al., 2009), or by overexpression of Spc42 that counteracts the loss of Spc42 activity (Treusch & Lindquist, 2012).

Expression of polyglutamine (polyQ) tracts of huntingtin exon1 associated with Huntington’s diseases is toxic in yeast, especially when promoted to aggregate by the presence of [PIN+] (Meriin et al., 2002). This toxicity has been linked to sequestration of essential endocytic components such as Sla2 (Meriin AB, 2007) and endoplasmic reticulum associated degradation (ERAD) components (Duennwald & Lindquist, 2008) into polyQ aggregates. A recent study shows that polyQ aggregates interfere with the ubiquitin-proteasome system (UPS) mediated degradation of cytosolic proteins by sequestering the Sis1 chaperone that is required for delivery of misfolded proteins to the nucleus for degradation (Park et al., 2013). Sequestration of Sup35 by polyQ aggregates was also shown to lead to [PSI+]-dependent polyQ toxicity (Gong et al., 2012).

The [Het-s] prion of the filamentous fungus Podospora anserina is toxic in the present of the allelic HET-S non-prion protein (Coustou et al., 1997). In the case of [Het-s]/HET-S cell death, the [Het-s] prion interacts with HET-S protein converting it into a conformation that targets HET-S to the cell periphery, where HET-S oligomerizes into a structure that binds to and destabilizes lipid membranes, causing a loss of membrane integrity (Mathur et al., 2012, Seuring et al., 2013)

Pin4 (Mdt1) is a Q/N-rich 668 protein involved in G2/M phase cell cycle progression in response to DNA damage. In the absence of DNA damage, deletion of Pin4 has no effect on cell growth (Pike et al., 2004). It is constitutively phosphorylated on threonine (T) 305. In this form it contributes to normal mitosis in unperturbed cell cycles. In response to DNA damage a 60-residue supercluster with threonine/serine in its C-terminal 302 to 668 amino acid (aa) region is hyperphosphorylated, leading to a delay of mitosis while DNA damage persists (Pike et al., 2004). We previously demonstrated that the C-terminal 162 to 668 aa region of Pin4, called Pin4C, when overproduced facilitates the de novo aggregation of the Sup35 protein into [PSI+] in the absence of [PIN+], and can also destabilize pre-existing prions including [PSI+] and [PIN+] (Derkatch et al., 2001, Yang et al., 2013).

How conversion of proteins to amyloid causes toxicity in human diseases is largely unknown. One hypothesis to explain cell death in neurodegenerative diseases is similar to the yeast stories described above and proposes that aggregating proteins, in either a toxic soluble oligomer or amyloid form, interact aberrantly with other factors and disturb cellular protein networks due to depletion of essential factors (Nucifora et al., 2001, Wu et al., 2007, Jiang et al., 2006). Amyloid associated toxicity in neurodegenerative diseases have also been shown to be associated with phosphorylation of various amyloidogenic proteins. For example, Alzheimer’s disease and Frontotemporal Lobar Dementia are associated with hyperphosphorylation of aggregated tau (Binder et al., 2005) and TDP-43 (Arai et al., 2006, Neumann et al., 2006) respectively.

Here we show that overexpression of Pin4C is toxic in the presence of [PIN+]. This toxicity is associated with aggregation and hyperphosphorylation of Pin4C, suggesting that [PIN+] drives Pin4C into a toxic hyperphosphorylated species. This is the first demonstration that a prion can affect phosphorylation. Also, our studies reveal that hyperphosphorylated Pin4C aggregates formed in the presence of [PIN+] impair cellular protein quality control. This disruption of the proteostasis network might being a major contributor to cytotoxicity.

Results

Overexpression of the Q/N-rich domain of Pin4 is toxic in [PIN+] cells

We previously showed that overexpression of the C-terminal Q/N-rich domain of Pin4 (called Pin4C) destabilized the pre-existing prions [PSI+] and [URE3] (Yang et al., 2013). Although there is no growth advantage of [psi−] over [PSI+] cells upon overexpression of Pin4C (Yang et al., 2013), we now report that overexpression of Pin4C is severely toxic in [PIN+][psi−] vs. isogenic [pin−][psi−] cells (Fig. 1). Overexpression of Pin4C was the most toxic in high [PIN+] cells, somewhat less toxic in very high [PIN+], and essentially not toxic in medium, low [PIN+] and [pin−] cells (Fig. 1A). We previously showed that overexpression of Pin4C caused a 30% loss of medium and low [PIN+], an 8% loss of very high [PIN+], but had no curing effect on high [PIN+] (Yang et al., 2013). Thus, Pin4C toxicity between [PIN+] variants loosely correlates with [PIN+] loss. The high [PIN+] strain used here is characterized by multiple dots (md) of Rnq1-GFP, while the other [PIN+] variants are all characterized by a single dot (sd) of Rnq1-GFP under the CUP1 promoter per cell (Bradley & Liebman, 2003). Since low and medium [PIN+] had similar effects on overexpressed Pin4C, we focused only on high [PIN+], very high [PIN+], low [PIN+] and [pin−].

Figure 1. Overexpression of Pin4C in [PIN+] cells causes lethality.

Figure 1

Open in a new tab

(A) Overexpression of Pin4C is most toxic to high [PIN+] cells. [PIN+] variants indicated on top were transformed with pHR81GAL1-PIN4C (“+”) or with the empty vector (“−”). Transformants were 10-fold serially diluted (104→102 cells from top to bottom) and spotted on either plasmid selective galactose medium to induce Pin4C overexpression or glucose medium as a growth control. Spots show growth after 5 days. (B) Growth curve during Pin4C overexpression. High [PIN+] cells with pHR81GAL1-PIN4C or the empty vector were grown in liquid plasmid selective synthetic dextrose media to log phase, washed, and transferred to plasmid selective galactose media where Pin4C expression was induced. Upon induction of Pin4C, the OD600nm for each sample was measured at the indicated times. (C) Overexpression of Pin4C in high [PIN+] cells leads to cell death. Samples taken at the indicated times described in (B) were plated on synthetic dextrose plates where Pin4C expression was turned off. Colonies were counted after growth, and the CFU/ml/OD values were calculated. Error bars show standard error of the mean.

Growth inhibition of high [PIN+] cells was observed when Pin4C under the control of the GAL1 promoter was induced in 2% galactose medium for 18 hours (Fig. 1B). To assay for viability, high [PIN+] cells overexpressing Pin4C in 2% galactose medium for different periods of time were plated on dextrose where Pin4C expression was repressed. Cell viability, determined by counting colony-forming units/ml/OD, decreased with increased time of Pin4C overexpression (Fig. 1C). Cells were also assayed with trypan blue, which only stains the plasma membranes of non-viable yeast cells (Kucsera et al., 2000). After overexpression of Pin4C for 18 hours, 35.1% cells were stained by trypan blue compared to 2.4% of cells in a control culture overexpressing the empty vector (Experimental Procedures). This indicates that overexpression of Pin4C causes cell death. HA tagged Pin4C under the control of the GAL1 promoter showed more severe toxicity compared to untagged Pin4C, while DsRed tagged Pin4C showed slightly less toxicity compared to untagged Pin4C (Fig. S1). This could be due to changes in the conformation of the Pin4C aggregate caused by the HA or DsRed tag.

Overexpressed Pin4C does not cause endogenous Rnq1 to accumulate as a soluble species in the presence of [PIN+]

Previous data indicates that overexpressed Rnq1 is non-productively templated by [PIN+] into unassembled SDS-soluble non-amyloid species that are associated with toxicity. This data supports the idea that amyloid formation can serve a protective function (Douglas et al., 2008). To test if Pin4C aggregates predispose Rnq1 to leave the amyloid pathway and convert to toxic oligomers, we compared the sizes and levels of soluble Rnq1 species in non-detergent treated lysates of [PIN+] cells in the presence or absence of excess Pin4C, using gel filtration. We obtained no evidence for a soluble toxic Rnq1 species, because we did not detect any alterations in accumulation of soluble Rnq1 due to overexpression of Pin4C (Fig. 2A).

Figure 2. Rnq1 remains aggregated and co-localizes with Pin4C foci in a peripheral inclusion site in high [PIN+] cells.

Figure 2

Open in a new tab

(A) We did not detect soluble unassembled Rnq1 in high [PIN+] overexpressing Pin4C. Intracellular pools of endogenous Rnq1 in high [PIN+] lysates inducing pHR81GAL1-PIN4C-HA or vector for 16 hr were analyzed by gel filtration. Samples were loaded onto two 15-well gels in order for both top and bottom panels. (B) Rnq1 aggregates coalesce to form large foci in high [PIN+] cells. Representative images of high [PIN+] cells carrying pRS413RNQ1-RNQ1-GFP after inducing pHR81GAL1-PIN4C or vector for 16 hr are shown. (C) Rnq1 aggregates coalesce around large Pin4C-DsRed aggregates only in cells with high [PIN+] but not other [PIN+] variants. Representative DsRed images of [PIN+] variants or [pin−] cells carrying pRS413RNQ1-RNQ1-GFP after inducing pHR81GAL1-PIN4C-DsRED for 16 hr are shown. (D) Large Pin4C aggregates induced in high [PIN+] localize to peripheral insoluble protein deposits. Representative images of Hsp42-GFP [PIN+] cells after inducing pHR81GAL1-PIN4C-DsRED for 16 hr are shown. Fixed cells were permeabilized and stained with DAPI. (E) Hsp42 co-localize with Rnq1 aggregates in high [PIN+] cells. Representative images of Hsp42-GFP [PIN+] cells after inducing pRS416GAL1-RNQ1-RFP for 6 hr are shown.

We also examined the effect of overexpressing Pin4C on the size of Rnq1 aggregates in high [PIN+] cells harboring GFP tagged Rnq1 under its own promoter and Pin4C-DsRed (see Experimental procedures). As expected, [PIN+] cells uniformly displayed numerous small cytosolic foci indicative of [PIN+] aggregates (Fig. 2B: ↑Vec.). Upon Pin4C overexpression for 16 hours, small Rnq1-GFP aggregates coalesced to form large foci co-localizing with large Pin4C-DsRed foci (Fig. 2C).

Pin4C lethality correlates with its aggregation in a peripheral inclusion site

While in the presence of high [PIN+], overexpression of Pin4C-DsRed for 16 hours causes it to form one large focus per cell (Fig. 2C) (Yang et al., 2013). Cells with these large Pin4C aggregates contain SDS-resistant polymers of Pin4C, suggestive of amyloid (Fig. S2A) (Yang et al., 2013). The same overexpression in very high [PIN+] cells caused multiple distinctive cytosolic Pin4C-DsRed foci per cell, and caused a few small puncta per cell in low [PIN+] and [pin−] cells (Fig. 2C). These differences in aggregation, which are correlated with the associated levels of toxicity (Fig. 1A), may reflect different interactions between the different [PIN+] variants and Pin4C, but may also simply reflect the fact that overexpressed Pin4C caused 8% and 30% loss of very high and low [PIN+] respectively, but no loss of high [PIN+] (Yang et al., 2013). Rnq1-GFP also formed multiple distinctive foci per cell with very high [PIN+] and small puncta per cell with low [PIN+] when overexpressing Pin4C-DsRed (Fig. 2C). However, Rnq1-GFP aggregates only partially co-localized with Pin4C-DsRed foci in cells with these [PIN+] variants. As expected, Rnq1-GFP was diffuse throughout the cytoplasm in [pin−] cells. These findings indicate that Rnq1-GFP coalesced to form large foci completely overlapping with large Pin4C-DsRed aggregates in cells with high [PIN+], and with only partial overlap in the other [PIN+] variants.

Consistent with the large Pin4C-DsRed foci seen in high [PIN+] cells, the size distribution of SDS-resistant HA tagged Pin4C polymers in high [PIN+] but not [pin−] cells reproductively shifted to larger complexes upon Pin4C overexpression for 20 hours (Fig. S2A). Also, Pin4C appeared in high molecular weight fractions when non-detergent treated lysates were analyzed by gel-filtration (Fig. S2B). In contrast, we did not detect an accumulation of unassembled SDS-soluble Pin4C in high [PIN+] cells (Fig. S2B).

Yeast aggregating proteins are often spatially sequestered to either juxtanuclear or peripheral sites, and amyloidogenic proteins are preferentially directed to peripheral sites (Kaganovich et al., 2008). It was previously shown that in stressed cells Hsp42 preferentially localizes to peripheral aggregates and is absent from juxtanuclear aggregates (JUNQ) (Specht et al., 2011). Thus, to visualize the peripheral sites, we used the Hsp42-GFP strain from the endogenously GFP-tagged yeast library (Huh et al., 2003). In uninduced [PIN+] cells, Hsp42-GFP formed a single aggregate per cell, with a diffuse GFP background (Fig. 2D). Upon overexpression of Pin4C-DsRed, Hsp42 formed large aggregates that sequestered diffuse Hsp42-GFP from the cytoplasm and co-localized with the large Pin4C-DsRed foci (Fig. 2D). DAPI staining showed that co-localized Hsp42-GFP and Pin4C-DsRed foci were not juxtanuclear inclusions (JUNQ) (Fig. 2D). Rnq1-RFP formed aggregates with a diffuse RFP background in high [PIN+] cells (Fig. 2E), as was expected (Aron et al., 2007), which overlapped with Hsp42-GFP aggregates (Fig. 2E). These observations indicate that the Pin4C aggregate is sequestered in a peripheral inclusion of the cell.

Cytotoxicity caused by overexpressed Pin4C is alleviated by increased levels of Sis1

Since Pin4C aggregation is associated with cell toxicity caused by overexpression of Pin4C, we reasoned that overexpressed Sis1, which prevents aggregation of overexpressed Pin4C (Yang et al., 2013), might ameliorate Pin4C toxicity. Indeed, Sis1 overexpression suppressed Pin4C toxicity in high [PIN+] (Fig. 3A). Also, Rnq1-GFP remained as small distinct foci when Sis1 is coexpressed with or without Pin4C (Fig. 3B), indicating that overexpression of Sis1 did not cure [PIN+], as was also reported previously (Higurashi et al., 2008). Furthermore, the suppression of Pin4C toxicity by excess Sis1 was not accompanied by any changes in the level of SDS-resistant Rnq1 polymers detected on SDD-AGE (Fig. 3C). This is consistent with our finding that we did not detect endogenous Rnq1 accumulated as unassembled soluble toxic species due to overexpression of Pin4C (Fig. 2A). Collectively, the inability of Pin4C to aggregate upon co-overexpression of Sis1 appears to relieve the toxicity.

Figure 3. Sis1 overexpression rescues toxicity caused by overexpressed Pin4C in high [PIN+].

Figure 3

Open in a new tab

(A) Sis1 overexpression protects against toxicity caused by excess Pin4C in high [PIN+]. Serial dilutions are of high [PIN+] cells transformed with pHR81GAL1-PIN4C and pYES3GAL1-SIS1, or with pHR81GAL1-PIN4C and empty vector pYES3GAL1, or with two empty vectors pHR81GAL1 and pYES3GAL1 spotted on plasmid selective galactose medium to induce Pin4C and Sis1 overexpression. (B) Overexpressed Sis1 prevents Rnq1 and Pin4C from forming large aggregates. Representative images of high [PIN+] cells carrying pRS413RNQ1-RNQ1-GFP after inducing overexpression of Pin4C with or without Sis1 induction or after inducing Sis1 but not Pin4C for 16 hr are shown. (C) The level of SDS-resistant Rnq1 polymers remained the same upon co-overexpression of Pin4C and Sis1. (Upper) Lysates of cultures overexpressing Pin4C from pHR81GAL1-PIN4C and/or Sis1 from pYES3GAL1-SIS1 for 12 hr were treated with 2% SDS at room temperature and analyzed for the presence of Rnq1 by SDD-AGE with anti-Rnq1. Two unrelated lanes on the same gel were removed (dashed line) for clarity. (Lower) Boiled lysates have equal levels of total Rnq1 as shown by SDS-PAGE.

In contrast, Pin4C toxicity was not significantly relieved by overexpression of other essential factors that were previously shown to rescue cells from amyloid toxicity (Fig. S3A), including: Sup45 that relieves Sup35 toxicity in [PSI+], Rab GTPases that relieve α-synuclein toxicity and ERAD components that relieve PolyQ toxicity respectively (Vishveshwara et al., 2009, Cooper et al., 2006, Duennwald & Lindquist, 2008). We showed that overexpressed Sup35C only slightly relieved Pin4C toxicity (Fig. S3A), presumably by rescuing levels of functional Sup35 sequestered by Pin4C (data not shown). The core spindle pole body (SPB) component Spc42 was shown as a tiny bright focus per cell upon Pin4C overexpression, which was also observed in cells with the empty vector control (Fig. S3B). The appearance of faint huge Spc42-GFP foci in cells upon overexpression of Pin4C-DsRed was due to leakage of fluorescence of large Pin4C foci into the GFP channel (Fig. S3C), given that such foci were never observed in GFP channel when overexpressing the Pin4C not tagged with DsRed (Fig. S3B). Thus, overexpressed Pin4C-DsRed does not sequester Spc42, which was sequestered into Rnq1 inclusions causing Rnq1 toxicity in [PIN+] (Treusch & Lindquist, 2012).

Overexpressed Pin4C is hyperphosphorylated in response to high [PIN+]

Overexpressed Pin4C-HA monomers appeared as a doublet when whole cells lysates were separated on acrylamide gels. Intriguingly, when obtained from high [PIN+] compared to [pin−] cells, these bands shifted to more slowly migrating forms (Fig. S2C). This is reminiscent of the hyperphosphorylated form of the endogenous full-length Pin4 in response to DNA damage (Pike et al., 2004). It was previously shown that endogenous full-length Pin4 is constitutively phosphorylated on T305, and is hyperphosphorylated on its supercluster with Thr/Ser that leads to a G2/M delay while DNA damage persists.

To investigate if the slowly migrating forms of Pin4C in high [PIN+] cells are due to hyperphosphorylation, we treated immunocaptured HA tagged Pin4C with λ-phosphatase, which releases phosphate groups from phosphorylated Thr/Ser. Strikingly, this shifted the slowly migrating forms of Pin4C to lower bands (Fig. 4A), indicating that highly aggregated Pin4C is indeed hyperphosphorylated in response to high [PIN+]. Immunocaptured Pin4C treated with λ-phosphatase still appeared as a doublet in Western blots, suggesting that overexpressed Pin4C might also undergo post-translational modification other than phosphorylation. Importantly, the hyperphosphorylated forms of overexpressed Pin4C were never found in [pin−] cells; rather, overexpressed Pin4C only appeared as a doublet that was not λ-phosphatase sensitive (Fig. 4A). We also found that overexpressed Pin4C was less hyperphosphorylated in very high [PIN+] than high [PIN+] cells, and was not hyperphosphorylated in low [PIN+] similar to that seen in [pin−] cells (Fig. 4A). This is consistent with our finding of reduced Pin4C aggregation and associated toxicity in the presence of very high [PIN+] and low [PIN+] (Fig. 1A and 2C).

Figure 4. Pin4C toxicity in [PIN+] is accompanied by Pin4C hyperphosphorylation.

Figure 4

Open in a new tab

(A) Overexpressed Pin4C-HA is the most hyperphosphorylated in high [PIN+] among the [PIN+] variants. Lysates of high [PIN+], very high [PIN+], low [PIN+] or [pin−] cells with overexpression of Pin4C-HA from pHR81GAL1-PIN4C-HA for 16 hr were immunocaptured with anti-HA and then incubated with or without λ protein phosphatase followed by SDS-PAGE and Western blotting. *, the lowest band in the “output” was the heavy chain of anti-HA antibody. Samples were run on two gels and aligned by the markers on the right. (B) Overexpressed Sis1 prevents Pin4C-HA hyperphosphorylation. Lysates of high [PIN+] cells with overexpression of Pin4C-HA from pHR81GAL1-PIN4C-HA with or without Sis1 from pYES3GAL1-SIS1 for 16 hr were immunocaptured with anti-HA and then incubated with or without λ protein phosphatase followed by SDS-PAGE and Western blotting. (C) [PIN+] is associated with hyperphosphorylation of endogenous Pin4 in the absence of DNA damage. Lysates of [PIN+] or its cured [pin−] version expressing the Myc-tagged endogenous full-length Pin4 in the presence or absence of 0.1% MMS for 90 min were immunocaptured with anti-HA and then incubated with or without λ protein phosphatase followed by SDS-PAGE and Western blotting. Samples from “Input” and “Output” were run on two gels and aligned by the markers on the right.

Overexpression of Sis1 led to reduced hyperphosphorylation of Pin4C in high [PIN+] cells (Fig. 4B). Most Pin4C co-overexpressed with Sis1 in high [PIN+] cells, appeared as a λ-phosphatase insensitive doublet similar to what is seen in [pin−] in the absence of overexpressed Sis1.

Hyperphosphorylation of endogenous full-length Pin4 is dependent on the presence of [PIN+]

Since overexpressed Pin4C was hyperphosphorylated in [PIN+] but not [pin−] cells, we asked if [PIN+] can trigger hyperphosphorylation of endogenous full-length Pin4. A strain with endogenous Pin4 terminally tagged with Myc was used to detect Pin4 phosphorylation (Pike et al., 2004). It was previously shown that Pin4-Myc was hyperphosphorylated in response to DNA damage (Pike et al., 2004). We found that this Pin4-Myc strain is [PIN+] and that overexpressed Pin4C in this strain forms large aggregates (data not shown). We generated an isogenic [pin−] version of this strain by growing it on guanidine hydrochloride (Derkatch et al., 2000). When we immunocaptured Myc tagged Pin4, we reproducibly found more slowly migrating Pin4 forms in the [PIN+] vs. the isogenic [pin−] strain in the absence of MMS treatment that induces DNA damage (Fig. 4C). The slowly migrating Pin4 forms were completely reversed by λ-phosphatase. In cells treated with MMS, Pin4 shifted to a larger molecular weight (Fig. 4C), which is consistent with the previous finding that Pin4 is hyperphosphorylated in response to DNA damage (Pike et al., 2004). However, we found that there was no difference in Pin4 migrating forms in [PIN+] and [pin−] cells in the presence of MMS treatment, indicating that Pin4 is hyperphosphorylated to the same degree in both [PIN+] and [pin−] in response to DNA damage. In contrast, in unstressed cells without DNA damage, Pin4 is hyperphosphorylated only in response to [PIN+].

Overexpressed Pin4C does not cause G2/M cell cycle arrest

Since Pin4 is hyperphosphorylated in response to DNA damage leading to G2/M cell cycle arrest (Pike et al., 2004) and overexpressed Pin4C is also hyperphosphorylated, we asked if this also triggers G2/M cell cycle arrest. We stained nuclei of cells with and without DNA damage or overexpressing Pin4C with DAPI and looked for cells with medium-sized buds with a single nucleus retained in the mother cell, indicative of defective nuclear distribution induced by G2/M cell cycle arrest. In MMS treated DNA damaged cells, defective nuclear distribution, shown as the appearance of the buds with a single nucleus retained in the mother cell, was observed in around 80% mother-bud pairs with buds of medium size. This was not seen in control cells without MMS treatment or in cells with overexpressed Pin4C (Fig. S4A). Thus, overexpressed Pin4C does not trigger cell cycle arrest.

We further investigated Pin4C aggregation in response to DNA damage. We expressed Pin4C under the GAL1 promoter in 0.2% galactose to lower Pin4C expression to a level where Pin4C only formed multiple small puncta or diffuse fluorescence in more than 80% of cells in the culture (Fig. S4B). A few cells contained big foci compared to most cells that contained big foci if grown in 2% galactose. When we treated cells grown in 0.2% galactose with MMS that induced DNA damage, Pin4C still formed only multiple tiny puncta or diffuse fluorescence (Fig. S4B). Thus, there was no increased Pin4C aggregation in response to DNA damage. This indicates that DNA damage does not induce Pin4C aggregation.

Overexpressed Pin4C impairs degradation of misfolded cytosolic proteins in the presence of [PIN+]

A recent study shows that polyQ aggregates interfere with degradation of cytosolic proteins possibly by sequestering Sis1, which is rate limiting for the UPS protein quality control pathway (Park et al., 2013). Likewise, we previously showed that cytoplasmic Pin4C-DsRed aggregates co-localize with endogenously GFP tagged Sis1 (Yang et al., 2013). Thus we asked if overexpressed Pin4C associated with toxicity, also compromises the cellular protein quality control system. To examine UPS-mediated degradation of misfolded cytosolic proteins we used a previously described reporter called CG* (Park et al., 2013). CG* is a mutant version of the secretory protein carboxypeptidase Y lacking the signal sequence fused to GFP and controlled by the GAL1 promoter. The turnover of CG* was measured after inhibiting new protein synthesis with cycloheximide (CHX). Indeed, degradation of CG* was severely impaired after 16 hours of Pin4C overexpression in the presence of [PIN+], while rapid turnover was preserved upon coexpression with Pin4C in the presence of [pin−] (Fig. 5A). Degradation of CG* was not affected in [PIN+] cells without Pin4C overexpression (Fig. 5A). We also visually examined CG* aggregates upon overexpression of Pin4C. In [PIN+] cells, CG* caused diffuse fluorescence in 1/3 of live cells; the remaining live cells formed large inclusions that co-localized with Pin4C-DsRed large foci and were preserved after the addition of CHX (Fig. 5B and 5C). However, in [pin−] cells with overexpressed Pin4C or in [PIN+] without Pin4C overexpression, CG* was mostly diffuse with occasional tiny foci and its fluorescence disappeared by 90 min in the presence of CHX (Fig. 5B). Therefore, overexpressed Pin4C appears to retard the clearance of misfolded proteins, but only in the presence of [PIN+].

Figure 5. Cytosolic protein quality control is impaired due to overexpressed Pin4C in [PIN+] cells.

Figure 5

Open in a new tab

(A) Overexpressed Pin4C blocked CG* degradation in the presence of high [PIN+]. Lysates of high [PIN+] or [pin−] cells with overexpression of Pin4C from pHR81GAL1-PIN4C or empty vector was coexpressed with CG* from pRS413GAL1-CG* for 16 hr. Cycloheximide (CHX) was then added to inhibit protein synthesis, and cells were collected at the indicated times and levels of degradation of CG* were determined by immunoblotting with anti-GFP. Pgk1 was used as an internal loading control. Samples were run on two gels. (B) CG* formed large foci upon overexpression of Pin4C in high [PIN+] cells. Representative images of high [PIN+] or [pin−] cells after inducing pRS413GAL1-CG* and pHR81GAL1-PIN4C or empty vector for 16 hr followed by CHX incubation for 90 min are shown. Representative images of the same cell samples without CHX incubation in parallel are shown as controls. (C) CG* inclusions formed upon overexpression of Pin4C-DsRed in high [PIN+] cells co-localize with Pin4C-DsRed foci. A representative image of high [PIN+] cells after inducing pRS413GAL1-CG* and pHR81GAL1-PIN4C-DsRed for 16 hr followed by CHX incubation for 90 min is shown.

Discussion

Neurodegenerative diseases comprise a group of neurological disorders characterized by the accumulation of amyloid aggregates. We are just beginning to understand the relationship between these aggregates and toxicity. In some cases toxicity is caused when proteins in their amyloid form aberrantly sequester essential proteins (Vishveshwara et al., 2009, Meriin AB, 2007, Duennwald & Lindquist, 2008, Gong et al., 2012, Cooper et al., 2006). When sequestered proteins are critical proteostasis regulators, aggregation impairs UPS function and disables proteostasis capacity (Park et al., 2013). In other cases the amyloid form appears to protect cells from more toxic soluble oligomeric conformers (Douglas et al., 2008, Glabe, 2006). Possibly these oligomers bind essential proteins better than the large aggregates (Treusch & Lindquist, 2012). It was also shown that oligomers can interact with and destabilize cellular membranes, causing a loss of membrane integrity (Mathur et al., 2012, Seuring et al., 2013). Here, we found that cytotoxicity caused by the co-presence of overexpressed Pin4C and [PIN+] is associated with the formation of aggregated and hyperphosphorylated Pin4C and a compromised proteostasis system.

Previous studies suggest that [PIN+] prion seeds template overexpressed Rnq1 or Huntingtin polyQ tracts to accumulate as toxic SDS-soluble oligomeric species (Douglas et al., 2008, Douglas et al., 2009, Behrends et al., 2006). Since overexpressed Pin4C and high [PIN+] co-localize into large aggregates (Fig. 2C), the high [PIN+] prion could cross-seed the aggregation of the overexpressed Q/N rich Pin4C into a toxic soluble oligomeric species. However, we failed to find any soluble oligomeric Pin4C (Fig. S2B). Likewise, we did not find any oligomeric Rnq1, making it unlikely that overexpressed Pin4C converts the [PIN+] prion or newly synthesized Rnq1 into a toxic oligomeric non-amyloid form (Fig. 2A). Overexpression of Pin4C did not cause a gel filtration detectable change in the size of the Rnq1 aggregates even though it did cause Rnq1-GFP aggregates to coalesce into large fluorescent foci. Apparently the large visible foci in the cell are composed of separate aggregates that did not increase in size.

Intriguingly, the large Pin4C-DsRed foci and increased size of SDS-resistant polymers that formed in high [PIN+] cells were never observed in the non-toxic environment of [pin−] cells (Fig. 2C and S2A). The Pin4C aggregate is sequestered into a peripheral inclusion body that overlaps with the location of the small heat shock protein Hsp42, rather than with juxtanuclear aggregates (JUNQ) (Fig. 2D). Although previous data suggest that the peripheral inclusion site marked by Hsp42 is distinct from the insoluble protein deposit (IPOD) compartment harboring protein aggregates (Specht et al., 2011), it was also shown that Huntingtin PolyQ aggregates associated with Hsp42 are delivered to the IPOD (Yan Wang, 2007, Kaganovich et al., 2008). Moreover, Rnq1-RFP aggregates in high [PIN+] cells also co-localized with Hsp42-GFP foci (Fig. 2E), indicating that Hsp42-GFP localizes to peripheral deposition sites which also sequester amyloidogenic prion aggregates. Thus, IPOD and Hsp42-marked peripheral aggregates may not be distinct compartments; instead, Hsp42 might associate with certain amyloidogenic proteins and assist in delivering them to the IPOD compartment. Overall, our data show that Pin4C large aggregates are directed to peripheral sites rather than juxtanuclear aggregates (JUNQ) that sequester non-amyloid misfolded soluble proteins.

Normally, Pin4 promotes mitosis, but DNA damage causes Pin4’s C-terminal domain to be hyperphosphorylated triggering the checkpoint machinery, leading to a delay in mitosis and thus to cell cycle arrest (Pike et al., 2004). Strikingly, overexpressed Pin4C is hyperphosphorylated in the presence of high [PIN+] even without DNA damage (Fig. 4A). It seems that the presence of high [PIN+] can promote the appearance of post-translational modifications in overexpressed Pin4C that mimics phosphorylation caused by DNA damage induced stress. However, unlike DNA damage, overexpressed Pin4C does not cause cell cycle arrest (Fig. S4A), but instead causes cell death (Fig. 1).

The Hsp40 J-protein Sis1 is required for [PIN+] prion propagation because it is needed to shear [PIN+] prion amyloid fibers to generate new seeds (Sondheimer N, 2001, Aron et al., 2007). We previously showed that Sis1 is sequestered into cytoplasmic Pin4C aggregates and that increased levels of Sis1 prevent overexpressed Pin4C from aggregating (Yang et al., 2013). We now find that overexpression of Sis1, while not affecting [PIN+] (Fig. 3B) (Higurashi et al., 2008), decreases hyperphosphorylation of overexpressed Pin4C, and renders it non-toxic (Fig. 3A and 4B). This is consistent with our hypothesis that Pin4C aggregation and hyperphosphorylation driven by [PIN+] causes Pin4C toxicity. Apparently, excess Sis1 impedes Pin4C aggregation and hyperphosphorylation. This differs from the way Sis1 detoxifies [PIN+], which is by enhancing conversion of Rnq1 to amyloid thereby reducing the amount of Rnq1 that forms toxic non-amyloid aggregates (Douglas et al., 2008). Thus, either antagonizing toxic aggregate formation or increasing amyloid formation can protect against prion associated amyloid toxicity, depending on the nature of the toxic species. Furthermore, Rnq1-mediated sequestration of the SPB protein Spc42, shown as the root cause of [PIN+] toxicity (Treusch & Lindquist, 2012), was not sequestered by overexpressed Pin4C (Fig. S3B and C). This further indicates that overexpressed Pin4C and Rnq1 cause cytotoxicity in the presence of [PIN+] by different mechanisms.

Strikingly, Pin4C aggregation and hyperphosphorylation in the presence of [PIN+] is associated with inhibition of UPS mediated degradation of cytosolic proteins (Fig. 5). Disruption of this quality control pathway is expected to disturb proper proteome balance and increase protein misfolding and aggregate deposition in the cytosol. Combined with our findings that Sis1 is sequestered into Pin4C aggregates (Yang et al., 2013) and excess Sis1 rescues Pin4C toxicity (Fig. 3A), the impairment of the protein quality control pathway caused by Pin4C aggregates is similar to a previous study demonstrating that polyQ aggregates interfere with the proteasome degradation of cytosolic proteins by sequestering Sis1 (Park et al., 2013). However, it is also possible that Pin4C aggregates directly impair the UPS function by overloading the proteasome since excess Sis1 prevents Pin4C and polyQ from aggregating.

Although the [PIN+] prion itself is not toxic, its interaction with the heterologous Q/N-rich protein Pin4C gives rise to a hyperphosphorylated, misfolded, amyloidogenic Pin4C species that is associated with toxicity. The degree of overexpressed Pin4C aggregation and hyperphosphorylation decreases from high [PIN+], very high [PIN+], low [PIN+] to [pin−] (Fig. 4A), in correspondence with the level of cytotoxicity. It is possible that [PIN+] simply promotes aggregation and amyloid formation of overexpressed Pin4C and that the resulting alterations in Pin4C conformation lead to exposure of Pin4C phosphorylation sites and their subsequent phosphorylation; or vice versa, interactions between [PIN+] and Pin4C could enhance Pin4C phosphorylation that leads to increased Pin4C aggregation. The phosphorylated aggregate could exceed the capacity of the proteasome causing a toxic gain of function.

Our findings on Pin4C toxicity are reminiscent of amyloid associated toxicity and hyperphosphorylation in a number of neurodegenerative diseases: aggregated and hyperphosphorylated tau and TDP-43 are major components respectively associated with Alzheimer’s diseases (Kanaan et al., 2011) or Frontotemporal Lobar Dementia and amyotrophic lateral sclerosis (Arai et al., 2006, Neumann et al., 2006).

Not only is the presence of [PIN+] associated with hyperphosphorylation of overexpressed Pin4C, but it is also associated with a modest increase in hyperphosphorylation of endogenous Pin4 in the absence of DNA damage. In contrast, hyperphosphorylation of full-length Pin4 induced by DNA damage does not require [PIN+] (Fig. 4C). It seems that Pin4 hyperphosphorylation induced by DNA damage does not require Pin4 aggregation, as we also found that DNA damage does not induce Pin4C aggregation promoted by [PIN+] (Fig. S4B). Also, overexpressed full-length Pin4 does not form large aggregates or cause toxicity (data not shown). This may be because the Q/N-rich domain enriched in Pin4C is crucial for mediating its robust interactions with [PIN+] and converting it into a toxic aggregated form, or because the N-terminal Pin4 domain absent in Pin4C interferes with aggregation and toxicity. However, since full-length Pin4 is hyperphosphorylated in [PIN+] but not [pin−] cells (Fig. 4C), it appears that [PIN+] interacts with soluble endogenous Pin4, possibly exposing its phosphorylation sites and enhancing its phosphorylation. Given that the [PIN+] prion exists in wild strains, it is intriguing to hypothesize that the [PIN+] prion could serve as an epigenetic switch to promote post-translational modifications involved in biological processes.

In neurons, phosphorylation of molecular motors is a major mechanism used to regulate cellular processes in axons, such as fast axonal transport (Morfini et al., 2001). Our finding raises the possibility that other prion-like proteins, yet to be discovered, may regulate signaling pathway in neurons by promoting phosphorylation.

Experimental procedures

Plasmids

Pin4C and Pin4C-DsRed overexpression plasmids were made in pHR81H (2µ URA3 leu2-d) under a GAL1 promoter (Yang et al., 2006). The PIN4C fragment was PCR amplified using primers with BamHI linkers and subcloned into pHR81GAL1 at the BamHI site to produce pHR81GAL1-PIN4C-HA. The PCR primers were P1 (5’- cgggatccatgcttccccaagctgaaaga -3’) and P2 (5’ -cgggatccttaagcgtaatctggaacatcgtatgggtaccatagattcttcttgttttgg -3’). To express Rnq1-GFP from the Rnq1 promoter and Rnq1-RFP from the GAL1 promoter, we used pRS413RNQ1-RNQ1-GFP (CEN HIS3) and pRS416GAL1-RNQ1-RFP (CEN URA3) respectively which were kindly supplied by E. A. Craig (Aron et al., 2007). pRS416GAL1-RNQ1 (CEN URA3) and pYES3GAL1-SIS1 (2 μ TRP1) were kind gifts from S. L. Lindquist (Douglas et al., 2008). pRS424GAL1-SUP35C is in a 2 μ vector containing the SUP35 C-terminal domain under the GAL1 promoter (2 μ TRP1) (Vishveshwara et al., 2009). The CEN plasmid pRS315GAL1--SUP45 was a kind gift from Y. O. Chernoff, and its LEU2 marker was replaced with TRP1. The 2 μ plasmids YEp24YPT1-YPT1, pRS426YPT31-YPT31, pRS426SEC4-SEC4 and pRS426YPT6-GFP-YPT6 were kind gifts from N. Segev and their URE3 marker were replaced with HIS3. pRS423ADH-UFD1-HA (2 μ HIS3) and pRS313HAC1-HAC1 (CEN HIS3) were kind gifts from M. L. Duennwald (Duennwald & Lindquist, 2008). pRS413GAL1-CG* (CEN HIS3, ΔssCPY* fused with GFP) was a kind gift from F. U. Hartl (Park et al., 2013).

Yeast strains and Media

The yeast strains used are derivatives of 74-D694 (MATa ade1-14 leu2-3,112 his3-∆200 trp1-289 ura3-52 (Chernoff et al., 1993): low [PIN+] (L1943); medium [PIN+] (L1945); high [PIN+] (L1749), very high [PIN+] (L1953) (Derkatch et al., 2000, Bradley et al., 2002). Strains expressing endogenously tagged Hsp42-GFP or Spc42-GFP are from the GFP yeast library (MATa his3-∆1 leu2∆0 met15∆0 ura3∆0) (Huh et al., 2003). Y400, a derivative of W303-1A (MATa ade2-1 can1-100 leu2-3 trp1-1 ura3-1 sml2::HIS3) with endogenous Pin4 tagged with Myc was a kind gift from J. Heierhorst (Pike et al., 2004). The [PIN+] state of these strains was tested by crossing them to a [pin−] version of 64-D697 (MATa ade1-14 ura3-52 leu2-3,112 trp1-289 lys9-A21) (Derkatch et al., 1997) transformed with pCUP1-RNQ1-GFP. When grown in the presence of 50µM copper overnight, the appearance of fluorescent foci in these diploids indicated the presence of [PIN+]. Y400 was grown on 5mM guanidine hydrochloride to cure cells of [PIN+] (Derkatch et al., 2000).

To overexpress Pin4C, cells transformed with the 2 μ URA3 leu2-d plasmids, pHR81GAL1-PIN4C, or pHR81GAL1-PIN4C-DsRed, or pHR81GAL1-PIN4C-HA were grown in synthetic dextrose media lacking uracil (SD-Ura) for ~6 hr to early log phase, washed twice with water and then transferred to 2% raffinose + 2% galactose media lacking uracil and leucine (SGal-Ura-Leu) and grown overnight to induce the GAL1 promoter and amplify the plasmid copy number of these leu2-d bearing plasmids about 100 fold (Erhart & Hollenberg, 1983). Transformants overexpressing Pin4C and pYES3GAL1-SIS1 (2 μ TRP1) were selected on SD-Ura-Trp and replicated to SGal-Ura-Trp-Leu to induce overexpression of the GAL1 promoter controlled genes on both plasmids.

Pin4C Cytotoxicity Analysis

Strains harboring pHR81GAL1-PIN4C were grown overnight in SD-Ura and then 5-fold serial dilutions were spotted on either glucose or galactose -Ura-Leu plates that were incubated for 3 days and then photographed. For trypan blue staining, cells expressing Pin4C or the empty vector for 18 hr were treated with 0.2% trypan blue for 15 min and observed with light microscopy.

Cell Cycle Arrest Analysis

Cells harboring pHR81GAL1 were grown in 2% galactose medium for 16 hr followed by treatment of 0.1% MMS for 6 hr to allow cells at the mitosis stage to complete one cell cycle and ensure that all the cells are arrested at the G2 stage. Cells harboring pHR81GAL1-PIN4C were grown in 2% galactose medium for 16 hr. Fixed cells were permeabilized and stained with 4’,6’-diamidino-2-phenylindole (DAPI). 40 cells with medium-sized buds were scored per sample for a single nucleus retained in the mother cell at a magnification of 63× with a Zeiss Axioskop 2 microscope

Fluorescence microscopy

High [PIN+] cells with plasmids expressing Pin4C-DsRed (2 μ URA3 leu2-d) and Rnq1-GFP (CEN HIS3) were grown in SD-Ura-His for ~6 hr to early log phase, washed twice with water and then transferred to SGal-Ura-His-Leu. Cells were imaged with a Zeiss Axioskop 2 microscope at room temperature using a Plan Apochromat 63× objective (numerical aperture of 1.4), a camera (AxioCam MR3; Carl Zeiss), and the Axiovision acquisition software (Carl Zeiss). Final images were assembled from the different channels in Photoshop (Adobe). Brightness and contrast were adjusted equally for all images.

Biochemical Analyses

Cells overexpressing Pin4C or Pin4C-HA encoded by the 2 μ URA3 leu2-d plasmids pHR81GAL1-PIN4C or pHR81GAL1-PIN4C-HA were grown in 100 ml SD-Ura for ~6 hr to early log phase, washed twice with water and then transferred to 100ml SGal-Ura-Leu and grown overnight to an A600 OD of 0.8. Crude cell extracts were prepared by vortexing the cells (Vortex-Genie 2) in 750 µl of lysis buffer [50 mM Tris–HCl (pH 7.5), 50 mM KCl, 10 mM MgCl2, 5% (w/v) glycerol, protease inhibitor cocktail diluted 1:50 (Sigma) and 5 mM PMSF] with glass beads (Biospec, 0.5 mm) at high speed, five times for 1 min with cooling on ice for 1 min between each vortexing. Lysates were cleared of cell debris by centrifuging them two times at 600g for 2 min (Mathur et al., 2009, Yang et al., 2013). For semi-denaturing detergent agarose gel electrophoresis (SDD-AGE), 50 µg of total protein in precleared lysates were incubated for 7 min in sample buffer [25 mM Tris, 200 mM glycine, 5% glycerol and 0.025% bromophenol blue] with 2% SDS at room temperature and resolved on 1.5% agarose gels (Bagriantsev et al., 2006).

For gel filtration analysis, crude lysates were loaded onto a Superose 6.0 column (GE Healthcare). Twenty-six fractions (0.7 to 2 ml) were collected and precipitated by incubating at 4°C overnight with 20% trichloroacetic acid. Fractions were then spun at maximum speed for 5 min, washed three times with acetone, dried, treated with 2% SDS sample buffer for 10 min at 95°C, loaded onto two 15-well gels in order (Mathur et al., 2012).

For the phosphorylation assays, immunocapture was as described previously (Yang et al., 2013, Bagriantsev et al., 2008). In brief, crude cell extracts were prepared in 750 µl of a higher salt lysis buffer [LB2: 40 mM Tris-HCl (pH 7.5), 150 mM KCl, 5 mM MgCl2, 10% glycerol]. 500 µl lysates of 0.5–1.0 mg ml−1 proteins were incubated with 1 µl of α-HA antibody or 5 µl of α-Myc for 2h on ice; samples were mixed with 50 µl magnetic beads with immobilized G protein (Miltenyi Biotec) and incubated on ice for 30 min. Then beads were washed with 1.0 ml of each of the following solutions at 4°C in the following order to remove nonspecifically bound proteins: LB2 with 1% Triton X-100; LB2, 210 mM KCl, 1% Triton X-100; LB2 with 1% Triton X-100; LB2; LB1 [40 mM Tris-HCl (pH 7.5), 50 mM KCl, 5 mM MgCl2, 5% glycerol]. After the magnetic beads were washed, λ protein phosphatase (New England Biolabs) was incubated with immunocaptured protein in μ column (Miltenyi Biotech) for 40 min at 30°C. Eluates following immunocapture and phosphatase incubation were treated with sample buffer containing 2% SDS at 95°C, and analyzed by SDS-PAGE and Western blotting. To visualize the phosphorylation of endogenous full-length Pin4, eluates were treated with sample buffer containing 2% SDS at 95°C, run on large 6% Tris-HCl SDS-PAGE gels and analyzed by Western blotting.

Anti-HA antibody was from Sigma. Anti-GFP monoclonal antibody was from Roche Applied Sciences. Anti-Myc antibody was from Santa Cruz.

Cycloheximide Experiments

Cells overexpressing PIN4C (2µ URA3 leu2-d) and CG* (HIS3) were grown in 2% glucose (SD-Ura-His) for ~6 hr to early log phase, washed twice with water and then transferred to 2% raffinose + 2% galactose media (SGal-Ura-His-Leu) for 16 hr. Cycloheximide (0.2 mg ml−1) was added and cells were removed at the indicated time points. Lysates were prepared as described above (Mathur et al., 2009), and analyzed by immunoblotting with the indicated antibodies.

Supplementary Material

Supp FigureS1-S4

Acknowledgments

We thank Y. O. Chernoff, E. A. Craig, M. L. Duennwald, F. U. Hartl, S. L. Lindquist and N. Segev for plasmids used in this study. We specially thank J. Heierhorst for providing us with Y400 strain expressing Myc tagged endogenous Pin4 and advice on phosphorylation assays. This work was supported by US Army Grant W911NF-10-1-0215 and National Institutes of Health Grant R01 GM 056350 to S.W.L. The content of this article is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Footnotes

There is no conflict of interest related to this work.

References

  1. Aguzzi A, Rajendran L. The transcellular spread of cytosolic amyloids, prions, and prionoids. Neuron. 2009;64:783–790. doi: 10.1016/j.neuron.2009.12.016. [DOI] [PubMed] [Google Scholar]
  2. Arai T, Hasegawa M, Akiyama H, Ikeda K, Nonaka T, Mori H, Mann D, Tsuchiya K, Yoshida M, Hashizume Y, Oda T. TDP-43 is a component of ubiquitin-positive tau-negative inclusions in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Biochemical and biophysical research communications. 2006;351:602–611. doi: 10.1016/j.bbrc.2006.10.093. [DOI] [PubMed] [Google Scholar]
  3. Aron R, Higurashi T, Sahi C, Craig EA. J-protein co-chaperone Sis1 required for generation of [RNQ+] seeds necessary for prion propagation. The EMBO journal. 2007;26:3794–3803. doi: 10.1038/sj.emboj.7601811. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bagriantsev SN, Gracheva EO, Richmond JE, Liebman SW. Variant-specific [PSI+] Infection Is Transmitted by Sup35 Polymers within [PSI+] Aggregates with Heterogeneous Protein Composition. Molecular biology of the cell. 2008;19:2433–2443. doi: 10.1091/mbc.E08-01-0078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bagriantsev SN, Kushnirov VV, Liebman SW. Analysis of amyloid aggregates using agarose gel electrophoresis. Methods in enzymology. 2006;412:33–48. doi: 10.1016/S0076-6879(06)12003-0. [DOI] [PubMed] [Google Scholar]
  6. Behrends C, Langer CA, Boteva R, Bottcher UM, Stemp MJ, Schaffar G, Rao BV, Giese A, Kretzschmar H, Siegers K, Hartl FU. Chaperonin TRiC promotes the assembly of polyQ expansion proteins into nontoxic oligomers. Molecular cell. 2006;23:887–897. doi: 10.1016/j.molcel.2006.08.017. [DOI] [PubMed] [Google Scholar]
  7. Binder LI, Guillozet-Bongaarts AL, Garcia-Sierra F, Berry RW. Tau, tangles, and Alzheimer's disease. Biochimica et biophysica acta. 2005;1739:216–223. doi: 10.1016/j.bbadis.2004.08.014. [DOI] [PubMed] [Google Scholar]
  8. Bradley ME, Edskes HK, Hong JY, Wickner RB, Liebman SW. Interactions among prions and prion"strains" in yeast. Proceedings of the National Academy of Sciences of the United States of America. 2002;99(Suppl 4):16392–16399. doi: 10.1073/pnas.152330699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Bradley ME, Liebman SW. Destabilizing interactions among [PSI(+)] and [PIN(+)] yeast prion variants. Genetics. 2003;165:1675–1685. doi: 10.1093/genetics/165.4.1675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chernoff YO, Derkach IL, Inge-Vechtomov SG. Multicopy SUP35 gene induces de-novo appearance of psi-like factors in the yeast Saccharomyces cerevisiae. Curr Genet. 1993;24:268–270. doi: 10.1007/BF00351802. [DOI] [PubMed] [Google Scholar]
  11. Cooper AA, Gitler AD, Cashikar A, Haynes CM, Hill KJ, Bhullar B, Liu K, Xu K, Strathearn KE, Liu F, Cao S, Caldwell KA, Caldwell GA, Marsischky G, Kolodner RD, Labaer J, Rochet JC, Bonini NM, Lindquist S. Alpha-synuclein blocks ER-Golgi traffic and Rab1 rescues neuron loss in Parkinson's models. Science (New York, N.Y. 2006;313:324–328. doi: 10.1126/science.1129462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Coustou V, Deleu C, Saupe S, Begueret J. The protein product of the het-s heterokaryon incompatibility gene of the fungus Podospora anserina behaves as a prion analog. Proceedings of the National Academy of Sciences of the United States of America. 1997;94:9773–9778. doi: 10.1073/pnas.94.18.9773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dagkesamanskaya AR, Ter-Avanesyan MD. Interaction of the yeast omnipotent suppressors SUP1(SUP45) and SUP2(SUP35) with non-mendelian factors. Genetics. 1991;128:513–520. doi: 10.1093/genetics/128.3.513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Derkatch IL, Bradley ME, Hong JY, Liebman SW. Prions affect the appearance of other prions: the story of [PIN(+)] Cell. 2001;106:171–182. doi: 10.1016/s0092-8674(01)00427-5. [DOI] [PubMed] [Google Scholar]
  15. Derkatch IL, Bradley ME, Masse SV, Zadorsky SP, Polozkov GV, Inge-Vechtomov SG, Liebman SW. Dependence and independence of [PSI(+)] and [PIN(+)]: a two-prion system in yeast? The EMBO journal. 2000;19:1942–1952. doi: 10.1093/emboj/19.9.1942. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Derkatch IL, Bradley ME, Zhou P, Chernoff YO, Liebman SW. Genetic and environmental factors affecting the de novo appearance of the [PSI+] prion in Saccharomyces cerevisiae. Genetics. 1997;147:507–519. doi: 10.1093/genetics/147.2.507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Derkatch IL, Chernoff YO, Kushnirov VV, Inge-Vechtomov SG, Liebman SW. Genesis and variability of [PSI] prion factors in Saccharomyces cerevisiae. Genetics. 1996;144:1375–1386. doi: 10.1093/genetics/144.4.1375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Douglas PM, Summers DW, Ren HY, Cyr DM. Reciprocal efficiency of RNQ1 and polyglutamine detoxification in the cytosol and nucleus. Molecular biology of the cell. 2009;20:4162–4173. doi: 10.1091/mbc.E09-02-0170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Douglas PM, Treusch S, Ren HY, Halfmann R, Duennwald ML, Lindquist S, Cyr DM. Chaperone-dependent amyloid assembly protects cells from prion toxicity. Proceedings of the National Academy of Sciences of the United States of America. 2008;105:7206–7211. doi: 10.1073/pnas.0802593105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Duennwald ML, Lindquist S. Impaired ERAD and ER stress are early and specific events in polyglutamine toxicity. Genes & development. 2008;22:3308–3319. doi: 10.1101/gad.1673408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Erhart E, Hollenberg CP. The presence of a defective LEU2 gene on 2 mu DNA recombinant plasmids of Saccharomyces cerevisiae is responsible for curing and high copy number. Journal of bacteriology. 1983;156:625–635. doi: 10.1128/jb.156.2.625-635.1983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Glabe CG. Common mechanisms of amyloid oligomer pathogenesis in degenerative disease. Neurobiology of aging. 2006;27:570–575. doi: 10.1016/j.neurobiolaging.2005.04.017. [DOI] [PubMed] [Google Scholar]
  23. Gong H, Romanova NV, Allen KD, Chandramowlishwaran P, Gokhale K, Newnam GP, Mieczkowski P, Sherman MY, Chernoff YO. Polyglutamine toxicity is controlled by prion composition and gene dosage in yeast. PLoS genetics. 2012;8:e1002634. doi: 10.1371/journal.pgen.1002634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Higurashi T, Hines JK, Sahi C, Aron R, Craig EA. Specificity of the J-protein Sis1 in the propagation of 3 yeast prions. Proceedings of the National Academy of Sciences of the United States of America. 2008;105:16596–16601. doi: 10.1073/pnas.0808934105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Huh WK, Falvo JV, Gerke LC, Carroll AS, Howson RW, Weissman JS, O'Shea EK. Global analysis of protein localization in budding yeast. Nature. 2003;425:686–691. doi: 10.1038/nature02026. [DOI] [PubMed] [Google Scholar]
  26. Jiang H, Poirier MA, Liang Y, Pei Z, Weiskittel CE, Smith WW, DeFranco DB, Ross CA. Depletion of CBP is directly linked with cellular toxicity caused by mutant huntingtin. Neurobiology of disease. 2006;23:543–551. doi: 10.1016/j.nbd.2006.04.011. [DOI] [PubMed] [Google Scholar]
  27. Kaganovich D, Kopito R, Frydman J. Misfolded proteins partition between two distinct quality control compartments. Nature. 2008;454:1088–1095. doi: 10.1038/nature07195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kanaan NM, Morfini GA, LaPointe NE, Pigino GF, Patterson KR, Song Y, Andreadis A, Fu Y, Brady ST, Binder LI. Pathogenic forms of tau inhibit kinesin-dependent axonal transport through a mechanism involving activation of axonal phosphotransferases. J Neurosci. 2011;31:9858–9868. doi: 10.1523/JNEUROSCI.0560-11.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kucsera J, Yarita K, Takeo K. Simple detection method for distinguishing dead and living yeast colonies. Journal of microbiological methods. 2000;41:19–21. doi: 10.1016/s0167-7012(00)00136-6. [DOI] [PubMed] [Google Scholar]
  30. Mathur V, Hong JY, Liebman SW. Ssa1 overexpression and [PIN(+)] variants cure [PSI(+)] by dilution of aggregates. Journal of molecular biology. 2009;390:155–167. doi: 10.1016/j.jmb.2009.04.063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Mathur V, Seuring C, Riek R, Saupe SJ, Liebman SW. Localization of HET-S to the cell periphery, not to [Het-s] aggregates, is associated with [Het-s]-HET-S toxicity. Molecular and cellular biology. 2012;32:139–153. doi: 10.1128/MCB.06125-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Meriin AB, Zhang X, He X, Newnam GP, Chernoff YO, Sherman MY. Huntington toxicity in yeast model depends on polyglutamine aggregation mediated by a prion-like protein Rnq1. The Journal of cell biology. 2002;157:997–1004. doi: 10.1083/jcb.200112104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Meriin AB, Z X, Alexandrov IM, Salnikova AB, Ter-Avanesian MD, Chernoff YO, Sherman MY. Endocytosis machinery is involved in aggregation of proteins with expanded polyglutamine domains. FASEB J. 2007;21:1915–1925. doi: 10.1096/fj.06-6878com. [DOI] [PubMed] [Google Scholar]
  34. Morfini G, Szebenyi G, Richards B, Brady ST. Regulation of kinesin: implications for neuronal development. Developmental neuroscience. 2001;23:364–376. doi: 10.1159/000048720. [DOI] [PubMed] [Google Scholar]
  35. Neumann M, Sampathu DM, Kwong LK, Truax AC, Micsenyi MC, Chou TT, Bruce J, Schuck T, Grossman M, Clark CM, McCluskey LF, Miller BL, Masliah E, Mackenzie IR, Feldman H, Feiden W, Kretzschmar HA, Trojanowski JQ, Lee VM. Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science (New York, N.Y. 2006;314:130–133. doi: 10.1126/science.1134108. [DOI] [PubMed] [Google Scholar]
  36. Nucifora FC, Jr, Sasaki M, Peters MF, Huang H, Cooper JK, Yamada M, Takahashi H, Tsuji S, Troncoso J, Dawson VL, Dawson TM, Ross CA. Interference by huntingtin and atrophin-1 with cbp-mediated transcription leading to cellular toxicity. Science (New York, N.Y. 2001;291:2423–2428. doi: 10.1126/science.1056784. [DOI] [PubMed] [Google Scholar]
  37. Park SH, Kukushkin Y, Gupta R, Chen T, Konagai A, Hipp MS, Hayer-Hartl M, Hartl FU. PolyQ proteins interfere with nuclear degradation of cytosolic proteins by sequestering the Sis1p chaperone. Cell. 2013;154:134–145. doi: 10.1016/j.cell.2013.06.003. [DOI] [PubMed] [Google Scholar]
  38. Pike BL, Yongkiettrakul S, Tsai MD, Heierhorst J. Mdt1, a novel Rad53 FHA1 domain-interacting protein, modulates DNA damage tolerance and G(2)/M cell cycle progression in Saccharomyces cerevisiae. Molecular and cellular biology. 2004;24:2779–2788. doi: 10.1128/MCB.24.7.2779-2788.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Prusiner SB. Novel proteinaceous infectious particles cause scrapie. Science (New York, N.Y. 1982;216:136–144. doi: 10.1126/science.6801762. [DOI] [PubMed] [Google Scholar]
  40. Seuring C, Greenwald J, Wasmer C, Wepf R, Saupe SJ, Meier BH, Riek R. The mechanism of toxicity in HET-S/HET-s prion incompatibility. PLoS biology. 2013;10:e1001451. doi: 10.1371/journal.pbio.1001451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Sondheimer N, Lindquist S. Rnq1: an epigenetic modifier of protein function in yeast. Molecular cell. 2000;5:163–172. doi: 10.1016/s1097-2765(00)80412-8. [DOI] [PubMed] [Google Scholar]
  42. Sondheimer N, L N, Craig EA, Lindquist S. The role of Sis1 in the maintenance of the [RNQ+] prion. EMBO J. 2001;20:2435–2442. doi: 10.1093/emboj/20.10.2435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Specht S, Miller SB, Mogk A, Bukau B. Hsp42 is required for sequestration of protein aggregates into deposition sites in Saccharomyces cerevisiae. The Journal of cell biology. 2011;195:617–629. doi: 10.1083/jcb.201106037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Stein KC, True HL. The [RNQ+] prion: a model of both functional and pathological amyloid. Prion. 2011;5:291–298. doi: 10.4161/pri.5.4.18213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Treusch S, Lindquist S. An intrinsically disordered yeast prion arrests the cell cycle by sequestering a spindle pole body component. The Journal of cell biology. 2012;197:369–379. doi: 10.1083/jcb.201108146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Vishveshwara N, Bradley ME, Liebman SW. Sequestration of essential proteins causes prion associated toxicity in yeast. Molecular microbiology. 2009;73:1101–1114. doi: 10.1111/j.1365-2958.2009.06836.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Wickner RB. [URE3] as an altered URE2 protein: evidence for a prion analog in Saccharomyces cerevisiae. Science (New York, N.Y. 1994;264:566–569. doi: 10.1126/science.7909170. [DOI] [PubMed] [Google Scholar]
  48. Wickner RB, Masison DC, Edskes HK. [PSI] and [URE3] as yeast prions. Yeast (Chichester, England) 1995;11:1671–1685. doi: 10.1002/yea.320111609. [DOI] [PubMed] [Google Scholar]
  49. Wu J, Lin F, Qin Z. Sequestration of glyceraldehyde-3-phosphate dehydrogenase to aggregates formed by mutant huntingtin. Acta biochimica et biophysica Sinica. 2007;39:885–890. doi: 10.1111/j.1745-7270.2007.00352.x. [DOI] [PubMed] [Google Scholar]
  50. Yan Wang ABM, Costello Catherine E, Sherman Michael Y. Characterization of Proteins Associated with Polyglutamine Aggregates:A Novel Approach Towards Isolation of Aggregates from Protein Conformation Disorders. Prion. 2007;1:128–135. doi: 10.4161/pri.1.2.4440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Yang W, Yang H, Tien P. In vitro self-propagation of recombinant PrPSc-like conformation generated in the yeast cytoplasm. FEBS letters. 2006;580:4231–4235. doi: 10.1016/j.febslet.2006.06.074. [DOI] [PubMed] [Google Scholar]
  52. Yang Z, Hong JY, Derkatch IL, Liebman SW. Heterologous gln/asn-rich proteins impede the propagation of yeast prions by altering chaperone availability. PLoS genetics. 2013;9:e1003236. doi: 10.1371/journal.pgen.1003236. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp FigureS1-S4
NIHMS614058-supplement-Supp_FigureS1-S4.pdf (11.2MB, pdf)

RESOURCES