Skip to main content
PLOS One logoLink to PLOS One
. 2014 Sep 3;9(9):e106252. doi: 10.1371/journal.pone.0106252

From Blue Light to Clock Genes in Zebrafish ZEM-2S Cells

Bruno C R Ramos 1, Maria Nathália C M Moraes 1, Maristela O Poletini 1,2, Leonardo H R G Lima 1, Ana Maria L Castrucci 1,*
Editor: Cristiano Bertolucci3
PMCID: PMC4153568  PMID: 25184495

Abstract

Melanopsin has been implicated in the mammalian photoentrainment by blue light. This photopigment, which maximally absorbs light at wavelengths between 470 and 480 nm depending on the species, is found in the retina of all classes of vertebrates so far studied. In mammals, melanopsin activation triggers a signaling pathway which resets the circadian clock in the suprachiasmatic nucleus (SCN). Unlike mammals, Drosophila melanogaster and Danio rerio do not rely only on their eyes to perceive light, in fact their whole body may be capable of detecting light and entraining their circadian clock. Melanopsin, teleost multiple tissue (tmt) opsin and others such as neuropsin and va-opsin, are found in the peripheral tissues of Danio rerio, however, there are limited data concerning the photopigment/s or the signaling pathway/s directly involved in light detection. Here, we demonstrate that melanopsin is a strong candidate to mediate synchronization of zebrafish cells. The deduced amino acid sequence of melanopsin, although being a vertebrate opsin, is more similar to invertebrate than vertebrate photopigments, and melanopsin photostimulation triggers the phosphoinositide pathway through activation of a Gq/11-type G protein. We stimulated cultured ZEM-2S cells with blue light at wavelengths consistent with melanopsin maximal absorption, and evaluated the time course expression of per1b, cry1b, per2 and cry1a. Using quantitative PCR, we showed that blue light is capable of slightly modulating per1b and cry1b genes, and drastically increasing per2 and cry1a expression. Pharmacological assays indicated that per2 and cry1a responses to blue light are evoked through the activation of the phosphoinositide pathway, which crosstalks with nitric oxide (NO) and mitogen activated protein MAP kinase (MAPK) to activate the clock genes. Our results suggest that melanopsin may be important in mediating the photoresponse in Danio rerio ZEM-2S cells, and provide new insights about the modulation of clock genes in peripheral clocks.

Introduction

Melanopsin was discovered in 1998 by Provencio and coworkers [1] in Xenopus leavis melanophores. This opsin arose as a strong candidate to mediate the synchronization process of the biological clock to light because it was found not only in the skin but also in the retina of this animal. In fact, further studies confirmed the presence of this opsin in the retina of all vertebrates studied to date [2][8]. So far, its major role in the entrainment of the biological clock has only been demonstrated in mammals [9][14]. Although an important vertebrate photopigment, melanopsin shares sequence identity with invertebrate opsins present in rhabdomeric photoreceptors [1],[5].

Rhabdomeric photoreceptor signaling was mainly studied in Drosophila melanogaster [15] and it involves the activation of Gq/11 protein, phospholipase C (PLC) and subsequent opening of transient receptor potential channels (TRPCs), resulting in membrane depolarization. Similar signaling pathway has been proposed for melanopsin. Heterologous expression of melanopsin in Xenopus sp. oocytes, Cercopithecus aethiops fibroblast-like kidney (COS), Mus musculus neuroblastoma (Neuro-2A) and Homo sapiens embryonic kidney (HEK-293) cells rendered these cells photosensitive [7], [16][19]. Antagonists and antibodies against Gq/11 abolished or greatly attenuated the melanopsin response to light [17], [19]. Furthermore different groups have demonstrated that melanopsin activates PLC with a subsequent production of inositol-3-phosphate (IP3), a raise in intracellular calcium, and protein kinase C (PKC) activation in both native [20][23] and heterologous [19], [24] systems.

Although the role of melanopsin in the setting of the central mammalian clock and its signaling pathway have been partially elucidated, many questions remain unanswered regarding the transduction mechanisms of melanopsin and other pigments, such as Rgr and Tmt, in peripheral clocks. Tmt has been a major candidate to modulate peripheral clocks [25], [26]. This study chose to investigate the involvement of the melanopsin signaling pathway in the regulation of clock genes by blue light in ZEM-2S cells.

The molecular mechanism of the circadian clock is based on feedback loops of cycling gene products, which control their own synthesis through gene and protein negative and positive regulation [27][29]. In mammals, the heterodimer composed of BMAL1 (brain and muscle Arnt-like protein 1) and CLOCK/NPAS2 (neuronal PAS domain protein 2) is a transcriptional activator that regulates transcription of Per (period) and Cry (cryptochrome) genes which encode the repressors of BMAL1 heterodimer activity, thus closing a negative feedback loop that generates rhythms of approximately 24 h [30], [31]. Clock genes are not only expressed in the central circadian pacemaker of mammals, but also in the majority of cell types from many different organisms [32]. In some organisms such as the fruit fly (Drosophila sp.) and the teleost Danio rerio, the clocks in the tissues can be directly synchronized by light [33][36] which raises a new issue about the hierarchy between the central oscillator and the peripheral clocks. Indeed, even clocks in cultured cells can be synchronized by light [36][38] and other factors, such as temperature [39] and serum shock [40], making them a great model to study peripheral clocks. Although still unproved, melanopsin may be the photopigment in these cells, as it has been found not only in the retina of all classes of vertebrates, but in peripheral tissues of Gadus morhua (cod) [41], Xenopus laevis (clawed frog) [20] and Gallus gallus (chicken) [42], and its presence may reflect a major role in photosynchronization of the peripheral clocks in these animals.

The popular zebrafish, Danio rerio, has been used for decades as a model to study vertebrate development; more recently, however, its use has rapidly expanded, and it has become a model of visual systems [43], pain mechanisms [44], diseases and the discovery of new drugs [45] as well. The zebrafish has also been useful to study the genetics of the circadian clock [46][48], particularly because clock in embryo-derived cell lines can be synchronized by light [36][38]. Although this species possesses six cry and four per genes, its core mechanism closely resembles the mammalian molecular clock [49]. It is important to mention that Danio rerio expresses five melanopsins (opn4m-1, opn4m-2, opn4m-3, opn4x-1 and opn4x-2) [7] and other opsins such as tmt opsin and va opsin (vertebrate ancient opsin), all of them being considered candidates to mediate the resetting of clock genes by light. Besides opsins, there are two other possible candidates by which light could reach clock genes and fulfill the role of the “circadian light-sensor”: (I) Photosensitive cry (cryptochrome) proteins and (II) flavin-containing oxidases. Despite the number of candidates, there has been no consensus about the nature of the photopigment responsible for resetting the clock genes in zebrafish.

Here we provide evidence that an opsin, in this case melanopsin, may mediate the photoentrainment of clock genes in zebrafish cells. Our results showing the influence of blue light on clock gene expression and the participation of the phosphoinositide pathway in this response are consistent with what is currently known about melanopsin. Furthermore we also show that clock gene induction depends on NO and mitogen-activated protein kinase (MAPK).

Materials and Methods

ZEM-2S cell culture

Fibroblast-like embryonic cells of Danio rerio (ZEM-2S) (kindly donated by Prof. Mark Rollag, Uniformed Services University of the Health Sciences, USA, originally purchased from ATCC, CRL-2147, Manassas, VA, USA) were maintained at 28°C in 50% Leibovitz L-15, 35% Dulbecco's Modified Eagle medium (D-MEM), 15% Ham's F12, and 15 mM 4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Life Technologies, Carlsbad, CA, USA), complemented with 10% fetal calf serum (Emcare, Campinas, SP, Brasil) and 1% antibiotic/antimycotic (10,000 U/mL penicillin; 10,000 µg/mL streptomycin; 25 µg/mL amphotericin B). Culture medium was changed twice a week and cells were harvested with Tyrode/ethylenediaminetetraacetic acid (EDTA) solution (NaCl 8.0 g/L; KCl 0.2 g/L; NaHCO3 1.0 g/L; NaH2PO4 0.05 g/L; MgCl2 1.0 g/L; EDTA 1.86 g/L) and subcultured (1∶3 dilution) when 80% confluent.

Before the experiments, the serum concentration was reduced to 2% and 200 nM all-trans retinaldehyde (Sigma, St. Louis, MO, USA) was added. This experimental set-up has been established taking in account that (1) all the reactions to regenerate the chromophore have to happen within the same cell type; three among the five zebrafish melanopsins are bistable [7], that is the regeneration of 11-cis from all-trans chromophore occurs in situ, in response to a different wavelength, a typical mechanism of rhabdomeric opsins; (2) all 5 melanopsins of D. rerio transfected into Neuro-2A cells exhibit a better response to light if the assay is supplemented with the aldehyde [7]; (3) serum concentration in ZEM-2S cells was reduced to 2% during the assays. Cells were handled in the dark under a red safelight (7 W Konex bulb and Safe-Light filter GBX-2, Kodak, Rochester, NY, USA).

Blue light stimulation

Protocol 1

ZEM-2S cells were seeded (2×10∧6 cells/25 cm2 flask), placed in constant dark (DD) for 6 d, and stimulated with blue light (450–475 nm, λ peak = 463 nm, 87.85 to 95.17 µwatts/cm2) for 10 min at the beginning of day 7. The cells were then kept in DD and total RNA was extracted 1, 2, 6 and 12 h after the light pulse. A control group (without blue light pulse) was kept in DD throughout the experiment and RNA was extracted at the same time points. Although the cells were kept previously and throughout the experiments in DD, caution was taken to obtain the samples at the same time of the day in this and the following protocols.

Protocol 2

To investigate the signaling pathway evoking the increase in clock gene expression, the cells were separated in four groups: (I) DD; (II) DD in the presence of specific inhibitors; (III) submitted to a light pulse as in protocol 1; and (IV) submitted to a light pulse in the presence of an inhibitor. The inhibitors were added to the cells 30 min before light stimulation and remained in the flasks throughout the experiment. The following inhibitors were used: 1-[6-[[(17β)-3-methoxyestra-1,3,5(10)-trien-17-yl]amino]hexyl]-1H-pyrrole-2,5-dione (U-73122, phospholipase C, PLC, inhibitor); 1,2-bis(o-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid (BAPTA-AM, calcium chelator); 2-{1-[3-(amidinothio)propyl]-1H-indol-3-yl}-3-(1-methylindol-3-yl)maleimide methanesulfonate salt (RO 31-8220, protein kinase C, PKC, inhibitor); N-[2-[[[3-(4-chlorophenyl)-2-propenyl]methylamino]methyl]phenyl]-N-(2-hydroxyethyl)-4-methoxybenzenesulphonamide (KN-93, calcium/calmodulin kinase II, CAMK II, inhibitor); L-NG-nitroarginine methyl ester (L-NAME, NO synthase, NOS, inhibitor); 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one (PD-98059, mitogen-activated kinase kinase, MEK, inhibitor), and 9-(tetrahydro-2-furanyl)-9H-purin-6-amine (SQ-22536, adenylyl cyclase inhibitor), all from Enzo Life Sciences, Plymouth Meeting, PA, USA. Stock solutions were made in DMSO (maximal concentration in the culture medium was 0.1%), except for L-NAME and SQ-22536, which were dissolved in sterile water. The vehicles were previously tested and had no effect on the expression of the studied genes.

Protocol 3

We have previously shown in Xenopus laevis melanophores that light induces melanin dispersion through a phosphoinositide pathway. Interestingly, cGMP was also produced in response to light, but its permeable analogue did not elicit melanin translocation nor did the blockade of PKG affect the photoresponse [20]. Aiming to investigate the role of cGMP and whether NO is an intracellular messenger induced by light, we kept cells in DD as in protocol 1, and the guanylyl cyclase stimulator, 5-[1-(phenylmethyl)-1H-indazol-3-yl]-2-furanmethanol (YC-1, Enzo Life Sciences, Plymouth Meeting, PA, USA, dissolved in sterile water), at 40 µM, was added to the cells for 30 min at the beginning of day 7, and remained in the preparation throughout the experiment. Total RNA was extracted 2 h after the end of the treatment. Appropriate controls were as follows: negative control, no light/no YC-1; positive control, blue light/no YC-1.

Protocol 4

ZEM-2S cells were seeded (8×10∧5 cells/well in a 96 well plate) and placed in constant dark (DD) for 3 d. Cells were treated with 100 µM IBMX (3-isobutyl-1-methylxanthine, Enzo Life Science, Plymouth Meeting, PA, USA) 30 min prior to stimulation with blue light (450–475 nm, 87.85 to 95.17 µ watts/cm2) for 1, 5 and 10 min. As a positive control, 10 µM forskolin was applied for 15 min in dark-kept cells. After stimulation, cells were lysed, and the samples assayed according to the manufacturer's protocol (Direct 3′-5′-cyclic adenosine monophosphate enzyme-linked immunosorbent assay (ELISA) kit, Enzo Life Sciences, Plymouth Meeting, PA, USA). The nucleotide concentrations were compared by one-way ANOVA, followed by Tukey, and the difference was considered significant when p<0.05.

Total RNA extraction and RT-PCR

The medium was discarded, 1 mL of Tri-Reagent-LS (Life Technologies, Carlsbad, CA, USA) was added directly to the cells, and RNA was obtained according to the manufacturer's instructions. Following ethanol rinses, the RNA pellet was dried, resuspended in 20 µL of diethylpyrocarbonate H2O (Life Technologies, Carlsbad, CA, USA) and treated with DNase I according to the manufacturer's instructions (turbo-DNA-free, Life Technologies, Carlsbad, CA, USA). Total RNA concentration (absorbance at 260 nm) and the RNA quality (ratio A260/A280) were determined by using a Nanodrop spectrophotometer, Thermo Scientific, Wilmington, DE, USA), and RT-PCR was performed with 1 µg of total RNA, utilizing 1 µL of random primers (300 µg/µL, 6-mer) and Superscript III (200 U/µL, Life Technologies, Carlsbad, CA, USA), using the following protocol: 65°C for 5 min, kept on ice for 1 min; then, after the addition of the reverse transcriptase enzyme, 5 min at 25°C, 50 min at 50°C, and 15 min at 70°C.

Quantitative PCR

It has been reported that four (Cry1a, Cry1b, Cry2a, and Cry2b) among the 6 Cry proteins of zebrafish are able to inhibit mammalian CLOCK∶BMAL1 activity. In zebrafish eye, brain and body the mRNA rhythms of cry1a and cry1b peak during the daytime, whereas cry2a and cry2b peak in the evening. As to per genes, in zebrafish Z3 cells, per1 and per3 rhythms persist in constant conditions, whereas per2 mRNA is stimulated by light, but it is not rhythmic in constant conditions [46]. So, we chose to determine the photoresponse of the two cry genes, cry1a and cry1b, that peak in the daylight, and of a rhythmic and a light-stimulated per gene, respectively per1 and per2.

The solutions for quantitative PCR contained the primers and fluorescent probes, as shown in Table 1, and Supermix 1× (Life Technologies, Carlsbad, CA, USA) supplemented to final concentrations of 400 µM each dNTP, 6 mM MgCl2 and 0.1 U/µL Platinum Taq DNA polymerase (Life Technologies, USA). This solution was aliquoted over three wells and 1 ul of cDNA of each sample was added to each well. Each experimental cDNA was run in triplicates in 96 well plates.

Table 1. Danio rerio primers and probes for quantitative PCR.

Sequences Final concentration
18S rRNA X03205.1 For: 5′–CGGCTACCACATCCAAGGAA–3′ 50 nM
Rev: 5′–GCTGGAATTACCGCGGCT–3′ 50 nM
Pr:5′–/5TexRd/TGCTGGCACCAGACTTGCCCTC/3BHQ_2/–3′ 50 nM
per1 AY597250 or M_212439.2 For: 5′–AGCTCAAACTCTCACAGCCCTT–3′ 300 nM
Rev: 5′– TCAGAGCTGGCACTCAACAGA –3′ 300 nM
Pr:5′–/5Cy5/TCCACCCAGCAGTTCTCTGGCATACA/3BHQ_2/–3′ 200 nM
cry1b NM_131790.4 For: 5′–CGTCTCTGGAGGAGCTCGG–3′ 300 nM
Rev: 5′– TCTCCCCCGGGCCAC–3′ 300 nM
Pr:5′–/5HEX/TTTGAAACAGAGGGACTGTCCACTGCTG/3BHQ_1/–3′ 200 nM
per2 AY597250 or NM_212439.2 For: 5′– GTGGAGAAAGCGGGCAGC–3′ 300 nM
Rev:5′–GCTCTTGTTGCTGCTTTCAGTTCT–3′ 300 nM
Pr:5′/6FAM/ATGGGTTCAGGATCAAACCGCTGT/3BHQ_1/3′ 200 nM
cry1a NM_131790.4 For:5′–CTACAGGAAGGTCAAAAAGAACAGC–3′ 300 nM
Rev: 5′–CTCCTCGAACACCTTCATGCC–3′ 300 nM
Pr:5′–/5HEX/AAAGCGTGGGTTGTTTGTAGCAGC/3BHQ_1/–3′ 200 nM

For = forward primer; Rev = reverse primer; Pr = fluorescent probe; TexRd = Texas Red; Cy5 = Cyanine 5; Hex = 6-carboxy-2, 4,4, 5, 7,7 -hexachlorofluorescein succinimidyl ester; FAM = Carboxyfluorescein; 3BHQ_1 = Black hole quencher 1 (IDT); 3BHQ_2 = Black hole quencher 2 (IDT).

The oligonucleotides (Table 1) were designed using the Primer Express program (Life Technologies, Carlsbad, CA, USA), based on sequences obtained from GenBank (http://www.ncbi.nlm.nih.gov/GenBank), and synthesized by IDT (Coralville, IA, USA). Primer efficiencies were determined to be higher than 80%. 18S rRNA was utilized to normalize the values of the studied genes, as widely used [50][53], in order to correct for pipetting errors. All assays were performed using an iQ5 (BioRad, Hercules, CA, USA) thermocycler, with the following protocol: 7 min at 95°C followed by 50 cycles of 10 sec at 95°C and 1 min at 60°C.

Data analysis was based on the ΔΔCT method [54], and compared the number of cycles between control and experimental wells, by passing a threshold line through the geometric portions of the amplification curves. ΔCT, the difference between these values for the gene of interest and 18S rRNA, was then calculated. Next, the mean value of ΔCT for control wells was subtracted from the experimental values, originating the ΔΔCT. This value was then used as the negative exponential of base 2, averaged from at least four flasks of cells, from two independent experiments. The log data were analyzed by one-way ANOVA, followed by Tukey, and the difference was considered significant when p<0.05.

Results

Previous work from our group demonstrated that ZEM-2S embryonic cells are photosensitive and display differential growth under different light/dark regimens [38]. In that study two important discoveries led us to the present investigation. First, the presence of two melanopsin genes, initially mislabeled opn4m and opn4x (now known as opn4m-1 and opn4m-2, respectively) in ZEM-2S cells; second, per1 and cry1b expression did not vary under constant dark but displayed robust rhythms in conditions of light-dark cycles. According to the literature [7], zebrafish has five melanopsin genes, so we decided to investigate whether ZEM-2S cells expressed all five melanopsins, and we found the following expressions (average CTs of 6 time points along 24 h, determined in 3–6 flasks of cells): opn4m-2 = 30.9>opn4m-1 = 31.7>opn4m-3 = 33.3>opn4x-2 = 35.4>opn4x-1 = 35.8. We then asked whether blue light would effectively mimic what white light does, what would suggest melanopsin as one of the putative candidates for clock gene regulation in ZEM-2S cells. Our first step was to evaluate the gene expression of per1b, per2, cry1a and cry1b for up to 12 h after a 10 min blue light (450–475 nm) pulse, a range of wavelengths that spectrally overlap with the absorption spectrum of melanopsin. It is worth to mention that the five Danio rerio melanopsins may exhibit peak sensitivities varying between 470 and 484 nm [7]. According to the literature, per1b and cry1b are synchronized by light [46], [49] and per2 and cry1a are inducible by light [55], [56]. Our results show that per1b and cry1b can be altered by blue light pulse (Fig. 1): per1b expression slightly increased after two hours (p<0.0083) and cry1b expression slightly decreased after six hours (p<0.0001). Although responsive to the light stimulus, the responses of these genes were much smaller than what was seen for per2 and cry1a (Fig. 1). The expression of per2 increased about 6-fold two hours after the light pulse (p<0.0001), and cry1a mRNA increased about 4-fold at the same time point (p<0.0001), both returning to basal level after six hours.

Figure 1. Quantitative PCR of per1b, cry1b, per2 and cry1a in a Danio rerio embryonic cell line ZEM-2S.

Figure 1

The cells (2×10∧6) were stimulated with blue light (450–475 nm, 87.85 to 95.17 µwatts/cm2) for 10 min, and total RNA was extracted 1, 2, 6 and 12 h after the stimulus. ‘a’ is significantly different from ‘b’ and ‘b’ is significantly different from ‘c’ (p<0.05). In this and in figures 2 to 9, values are the mean ± Standard Error of Mean (n = 4–9).

To investigate light signaling we decided, therefore, to use per2 and cry1a expression as the output of the experimental system, at the time point of their maximal response, i.e. two hours after the blue light pulse. Albeit a blue light pulse could modulate these clock genes, this is not an irrefutable proof that melanopsin, in fact, mediates this response, since other opsins such as va-opsin, pinopsin, encephalopsin/tmts have maximal absorbance spectra within the range we used in this study. So, in addition, we investigated the signaling pathway evoked by blue light using pharmacological approaches and evaluating the impact of blocking some key steps of the putative melanopsin phototransduction cascade on the expression of multiple clock genes. According to what is known from our studies in Xenopus laevis melanophores [20], where melanopsin mediates the melanosome photodispersion response through the phosphoinositide cascade, our hypothesis was that light-stimulated melanopsin in ZEM-2S cells would affect clock genes through the same pathway. Although both cell lines are embryo-derived, one has to bear in mind that they are in different developmental stages and come from distinct vertebrate classes. The phospholipase C inhibitor, U-73122, at 100 nM (Fig. 2); 1 µM M BAPTA-AM, a potent calcium chelator (Fig. 3); and 100 nM Ro 31-8220, a protein kinase C inhibitor (Fig. 4) abolished the responses evoked by blue light on per2 and cry1a expression (p<0.0001). Despite demonstrating the participation of the phosphoinositide cascade in clock gene modulation, one further question remained: Which mechanism conveys this signaling pathway to gene expression?

Figure 2. Quantitative PCR of per2 and cry1a in a Danio rerio embryonic cell line ZEM-2S.

Figure 2

The cells (2×10∧6) were stimulated with blue light (450–475 nm, 87.85 to 95.17 µwatts/cm2) for 10 min, in the presence or absence of the PLC inhibitor, U-73122, at 100 nM, and total RNA was extracted 2 h after the stimulus. In this and the following figures, the asterisk means statistically significant differences from all other groups (p<0.05).

Figure 3. Quantitative PCR of per2 and cry1a in a Danio rerio embryonic cell line ZEM-2S.

Figure 3

The cells (2×10∧6) were stimulated with blue light (450–475 nm, 87.85 to 95.17 µwatts/cm2) for 10 min, in the presence or absence of the calcium chelator, BAPTA-AM, at 1 µM, and total RNA was extracted 2 h after the stimulus.

Figure 4. Quantitative PCR of per2 and cry1a in a Danio rerio embryonic cell line ZEM-2S.

Figure 4

The cells (2×10∧6) were stimulated with blue light (450–475 nm, 87.85 to 95.17 µwatts/cm2) for 10 min, in the presence or absence of the PKC inhibitor, Ro 31-8220, at 100 nM and total RNA was extracted 2 h after the stimulus.

In the mammalian SCN, few candidates fulfill this role. The involvement of NO/cGMP, MAPK and cAMP/protein kinase A (PKA) pathways has been extensively described in the literature to control and modulate the circadian response of the SCN [57]. So, our next step was to investigate the possibility of a crosstalk between the phosphoinositide cascade and these other signaling pathways.

From the previously mentioned study in Xenopus laevis [20], emerged a possible candidate to crosstalk with the PLC pathway. Isoldi and coworkers showed a 3-fold cGMP increase in Xenopus melanophores upon white light stimulation. Interestingly, the cyclic nucleotide does not take part in the light-induced pigment dispersion, as the blockade of cGMP production did not affect this response. Thus, we decided to evaluate whether the NO/cGMP pathway was involved with the induction of per2 and cry1a. It is well known that CAMK II activates NO synthase resulting in NO production [58]. Therefore we decided to use the CAMK II inhibitor, KN-93, to investigate the participation of NO in this response. KN-93 at 1 µM (Fig. 5) inhibited the light-induced increase of per2 and cry1a expression (p<0.0001), and 1 mM L-NAME, a non-specific inhibitor of NOS (Fig. 6), prevented the increase of per2 and cry1a expression (p<0.0001). Curiously, despite the apparent role of NOS in the light response, the guanylyl cyclase activator, Y-C1, at 40 µM, had no effect on per2 and cry1a expression, in cells maintained in DD (Fig. 7), suggesting that NO is probably acting through a cGMP-independent pathway.

Figure 5. Quantitative PCR of per2 and cry1a in a Danio rerio embryonic cell line ZEM-2S.

Figure 5

The cells (2×10∧6) were stimulated with blue light (450–475 nm, 87.85 to 95.17 µwatts/cm2) for 10 min, in the presence or absence of the CAMK II inhibitor, KN-93, at 1 µM, and total RNA was extracted 2 h after the stimulus.

Figure 6. Quantitative PCR of per2 and cry1a in a Danio rerio embryonic cell line ZEM-2S.

Figure 6

The cells (2×10∧6) were stimulated with blue light (450–475 nm, 87.85 to 95.17 µwatts/cm2) for 10 min, in the presence or absence of the NOS inhibitor, L-NAME, at 1 mM and total RNA was extracted 2 h after the stimulus.

Figure 7. Quantitative PCR of per2 and cry1a in a Danio rerio embryonic cell line ZEM-2S.

Figure 7

The cells (2×10∧6) were stimulated with the guanylyl cyclase activator, Y-C1, at 40 µM in DD, and total RNA was extracted after 2 h.

The MAPK/ERK signaling pathway has already been implicated in the increased expression of per2 in response to white light in Danio rerio [59]; our results corroborate these data for blue light, since the inhibitor of MEK, PD-98059 at 40 µM, blocked the rise in expression of per2 and cry1a (p<0.0001) in response to the blue light pulse (Fig. 8).

Figure 8. Quantitative PCR of per2 and cry1a in a Danio rerio embryonic cell line ZEM-2S.

Figure 8

The cells (2×10∧6) were stimulated with blue light (450–475 nm, 87.85 to 95.17 µwatts/cm2) for 10 min, in the presence or absence of the MEK inhibitor, PD-98059 at 40 µM, and total RNA was extracted 2 h after the stimulus.

In addition, we evaluated the cAMP/PKA pathway. The inhibitor of adenylyl cyclase, SQ-22536 at 20 µM, decreased per2 and cry1a expression (p<0.0001, Fig. 9), and the quantification of cAMP, 10 min after the blue light pulse, shows that light, rather than increasing the nucleotide concentration, actually decreased cAMP concentration (Fig. 10). This effect can not be attributed to the natural and rapid breakdown of cAMP, as the phosphodiesterase inhibitor IBMX was present throughout the assay. Although these data seem controversial, other group has reported, in zebrafish Z3 cells [59], results which led to similar conclusions, indicating a complex system involving cAMP and clock genes.

Figure 9. Quantitative PCR of per2 and cry1a in a Danio rerio embryonic cell line ZEM-2S.

Figure 9

The cells (2×10∧6) were stimulated with blue light (450–475 nm, 87.85 to 95.17 µwatts/cm2) for 10 min, in the presence or absence of the adenylyl cyclase inhibitor, SQ-22536, at 20 µM, and total RNA was extracted 2 h after the stimulus.

Figure 10. Quantification of cAMP in a Danio rerio embryonic cell line ZEM-2S.

Figure 10

The cells (8×10∧4) were stimulated with blue light (450–475 nm, 87.85 to 95.17 µwatts/cm2) for 1, 5 or 10 min, and cAMP was measured immediately after each light pulse. Forskolin at 10 µM was used as a positive control in DD. Values are the mean ± SEM (n = 3).

Discussion

Melanopsin and peripheral clocks

For years the zebrafish has been used as a model in many areas of life sciences and in the last decade its use has expanded to the field of peripheral clocks. The discussion about peripheral clocks has gained even more importance by the fact that circadian system components may act in a reciprocal way, where peripheral and central clocks mutually interact to promote an adequate behavioral response. In mammals, for example, food availability exerts a powerful entrainment effect on behavior [60] and can reduce retinal input activation of cells that reside in the suprachiasmatic nucleus (SCN), promote transient disorganization of SCN outputs, and reduce sensitivity to SCN signals in hypothalamic sites responsible for integrating homeostatic and circadian information [61]. But in organisms such as Drosophila melanogaster, Danio rerio and Xenopus laevis, the impact of peripheral clocks can be even greater, since their bodies directly respond to light [33][36], [62], which makes the study of the mechanisms underlying peripheral clocks an intriguing issue.

Zebrafish have six cry genes, cry1a, 1b, 2a, 2b, 3 and 4, and four per genes, per1a, 1b, 2 and 3. All these genes exhibit cyclic expression pattern in light-dark cycle, which persists in constant dark, except per2 [46]. However, only two are known to be light induced, per2 and cry1a [49]. Both genes seem to have a critical role in resetting the circadian clock, whilst per2 is also involved in the onset of the pineal circadian clock [55] and cry1a is a key element of the photoentrainment molecular machinery [56]. But how does the light signal reach these clock genes?

Tmts have been proposed to be the light sensing pigment that resets peripheral clocks in fish [25], [26]. In addition, there has been some speculation about one of the cry genes acting as a photoreceptor [36], [59], [63], and some data suggest that oxidative stress could be the signal that increases clock gene expression [64]; our results, however, point to the role of an opsin in the regulation of ZEM-2S clock genes.

Previous results from our laboratory have shown that the Xenopus laevis melanophore response to light occurs between 450 and 470 nm, and the opsin suggested to participate is one of the two melanopsins [20]. Five melanopsin genes have been described in Danio rerio [7], and quantitative PCR of ZEM-2S cells has demonstrated that all five are detectable in this cell line. One has to bear in mind, however, that cell lines may show altered gene expression, with native genes turned off, bringing caution to the interpretation of data obtained in cultured cells. Furthermore, ZEM-2S cells are derived from gastrula and in such an early developmental stage, some genes may have already been turned on, while others may still be off.

It is important to mention that in the blind cavefish, Phreatichthys andruzzi, the light-insensitive clock is entrainable by food. However, the ectopic expression of opn4m-2 and tmt zebrafish homologues rescued the induction of a Per2-Luc reporter in the cavefish cells by blue (468 nm) or green (530 nm) light [26]. As it has been confirmed in Danio rerio that some melanopsin pigments are maximally sensitive to blue wavelengths [7], it is possible that melanopsin may be a good candidate to mediate entrainable light responses in zebrafish peripheral clocks. In this study, we have shown that light at wavelengths that fall within the absorbance spectra for melanopsin pigments that have been determined so far can modulate the expression of both per1b and cry1b and induce the expression of per2 and cry1a. Nevertheless it has yet to be shown that melanopsin is directly responsible for these changes, and other pigments that are sensitive to blue light and share components of the signaling pathway being assayed may also be critical. Furthermore, recent work in zebrafish have shown that activation of the per2 gene can be achieved by visible wavelengths other than blue, such as green (530 nm) and red (657 nm) [26], [65], and the participation of other opsins in the resetting of clock genes under white light cannot be discarded.

As previously stated, melanopsin shares both sequence identity and some similarities in signaling with invertebrate pigments compared to the other vertebrate opsin classes; for example, the involvement of a Gq/11-type G protein and the phosphoinositide pathway. After the photostimulation of melanopsin, PLC is activated, and the ultimate event in the mammalian retinal ganglion cells is the influx of calcium through TRP channels, and action potentials [66]. Interestingly, inositol trisphosphate (IP3) is not necessary for the calcium rise. Our data demonstrates that light-evoked responses are blocked in the presence of the PLC inhibitor U-73122, thereby, confirming that PLC is fundamentally important in the photoactivation of clock genes in ZEM-2S cells. This inhibitor has a broad activity, with no specificity for any particular subtype of PLC. It has been accepted that PLCβ4 would be the isoform involved in melanopsin signaling due to its high expression in mammalian eye as compared to the other isoforms, by analogy with the invertebrate phototransduction, and because the knockout of PLCβ4 abolished the photoresponses in a subtype of ganglion cells in mice [66].

Besides PLC, various studies have shown that melanopsin activation leads to a transient rise in intracellular calcium [17][20], [67]. The concentration of cytoplasmic calcium is strongly regulated by the cell, and two classes of receptors mediate calcium release from the endoplasmic reticulum: inositol 1,4,5 trisphosphate (IP3) and rianodine receptors [68]. IP3, as well as diacylglycerol (DAG)), is a cleavage product of the membrane phospholipid phosphatidyl inositol-4,5-bisphosphate (PIP2), and its role in calcium release in response to light has been demonstrated in some studies [20], [24]. However, application of DAG and IP3 analogues did not induce photoresponses in melanopsin positive ganglion cells strongly suggesting that the ion channels may be regulated by the depletion of PIP2, or by polyunsaturated fatty acids released from DAG cleavage [66]. The inhibition of per2 and cry1a expression by the chelator BAPTA-AM demonstrates the relevance of the calcium rise in the photoresponse of ZEM-2S cells.

Another important enzyme, PKC, has also been shown to play a role in the activation of clock genes in our model. It is well known that PKC comprises a large family of proteins, subdivided in three subfamilies: (i) classic PKC (cPKC), which are activated by calcium, DAG, phosphatidyl choline and phorbol esters; (ii) new PKC (nPKC), which are activated by the same compounds as cPKC, but calcium insensitive; and (iii) atypical PKC (aPKC), which are only activated by phosphatidyl serines [69]. The presence of a non-specific PKC inhibitor, Ro 31-8220, blocked the response to a blue light stimulus in ZEM-2S cells, and amongst all isoforms of PKC the most likely to participate in clock gene activation is PKCzeta [22]. In mice, the ablation of the PKCzeta gene (Prkcz) induces a similar phenotype to the melanopsin knockout mouse [22], and its presence has been reported in the zebrafish central nervous system [70].

Taken together, these two results (i.e. blue light-evoked responses and phosphoinositide pathway photoactivation) suggest that melanopsin may be a good candidate to induce per2 and cry1a in ZEM-2S cells under these experimental conditions. Other possible candidates include va opsin and tmt opsin, but phylogenetic studies have shown that these two opsins exhibit higher sequence similarity to other vertebrate (non-melanopsin) opsin classes compared to invertebrate pigments [71], [72], suggesting they may signal via an activation of transducin (Gi/0), phosphodiesterase and the hydrolysis of cyclic nucleotides. In fact, it has been demonstrated that the opn3 family which includes tmts signal through Gi/G0 proteins in the teleost Takifugu rubripes and the mosquito Anopheles stephensi [73]. There are many further opsin genes identified in the zebrafish genome (e.g. peropsin and rgr); however, at present very little is known about their expression patterns and putative physiological roles.

Cry proteins also sense blue light, but the data presented here do not agree with the known cry signaling. In Drosophila melanogaster the CRY protein undergoes a conformational change after light absorption by its flavin component, allowing activated CRY to interact with Timeless (TIM) and others factors to promote TIM proteolysis, resulting in the resetting of the circadian clock [74]. Therefore, CRY acts as a “light sensor” and directly resets the clock molecular machinery, without the activation of a signaling cascade. On the other hand, in zebrafish ZEM-2S cells, light can act through a signaling pathway (phosphoinositide) to modulate clock genes expression, making the resetting of the circadian clock by photosensitive Cry unlikely. However, the possibility of oxidative stress is still perfectly plausible. Pittendrigh [75] postulated a hypothesis called “escape-from-light”, where both light and temperature played major roles in the evolution of circadian organization, thus it would not be surprising that opsins (or other light detecting mechanisms) and oxidative stress co-exist in the same circadian system and even contribute to the same response (see discussion below).

PLC pathway crosstalks

In excitable cells that express melanopsin, the ultimate event of the light-activated phosphoinositide pathway is usually the opening of the transient receptor potential channels subclass C (TRPC channels) and cell depolarization [76], but the potential link between the PLC signaling pathway and clock gene activation remains unknown.

In the SCN, cAMP seems to be an important second messenger triggering the expression of clock genes. The cyclic nucleotide activates PKA which is able, among other effects, to catalyze cAMP response element binding protein (CREB) phosphorylation in several models [56]. Cyclic AMP content fluctuates in the SCN [77], [78], and the in vitro application of its permeable analogue during the middle of the subjective day induces phase shifts [79]. More recently, cAMP signaling was proposed to be part of the molecular mechanism of the circadian clock itself and not just restricted to an involvement with the photoentrainment pathway [80]. Some of our data presented inconsistent or seemingly opposing results: namely that the quantification of cAMP suggested that this cyclic nucleotide is not required for the light-induced expression of clock genes, whereas the presence of an adenylyl cyclase inhibitor reduced per2 and cry1a expression. Similar results were reported in a study with Danio rerio Z3 cells [59], in which the inhibition of PKA reduced the induction of per2 expression by light. By contrast, forskolin, an adenylyl cyclase activator, did not induce per2 expression. Given the literature reports and the data presented here, the role of cAMP in the modulation of clock genes remains unclear and needs to be further investigated.

On the other hand, several studies have suggested that clock gene activation might result from stimulation of the NO/cGMP cascade. Pharmacological and electrophysiological studies in the mammalian SCN demonstrated the importance of neuronal nitric oxide synthase (nNOS) in the circadian response to light as well as its association with CAMK II [81][88]. Similarly, our results indicate the participation of NOS and CAMK II in clock gene activation, since the presence of either inhibitor, L-NAME or KN-93, significantly reduced the photoinduced increase in expression of two representative clock genes.

An unexpected result was obtained with the guanylyl cyclase (GC) activator, YC-1. The classic NO pathway comprises the production of NO by NOS, followed by the stimulation of GC, an increase in cGMP levels and finally the activation of protein kinase G (PKG). However, the increase of cGMP promoted by YC-1 in ZEM-2S cells did not induce per2 and cry1a expression. This is strong evidence that PKG activation is unrelated to the increase in expression for at least two clock genes, and that NO may act through a cGMP-independent pathway. Indeed, in neuronal cells, NO is capable of eliciting ERK phosphorylation without cGMP involvement [89], and may provide a pathway by which light, through NO production, could trigger the MAPK/ERK pathway [90].

Interestingly, the MAPK cascade is another pathway that appears to be involved with clock gene activation in ZEM-2S cells. MAPKs are activated by a variety of stimuli such as growth factors, cytokines, oncogenes and stressful conditions, and they are known to regulate cellular processes such as gene expression, differentiation and proliferation [91]. Moreover, MAPKs have been reported to play an important role in the formation of circadian rhythms in the SCN [92], [93]. Inhibition of ERK2 has been reported to block the circadian response to light [94][97], and the three family members, ERK1/2, p38 and c-Jun N-terminal kinase (JNK), exhibit diurnal and circadian changes in their activity in the SCN [98]. In zebrafish, the involvement of MAPKs and light in the induction of clock genes has been investigated [59], [65], [99]. Although not all in agreement, these studies all show the fundamental importance of the kinase in circadian entrainment: two reports show that MAPK has a positive effect under white light, since its inhibition decreases the induction of clock genes, but a latter study shows that, under blue light, MAPK acts negatively, where the presence of its inhibitor yielded a stronger and more sustained expression of per2 and cry1a. Our data corroborate the first two reports, as an inhibitor of MEK (PD-98059) drastically reduced the enhancement of per2 and cry1a expression by blue light.

These two signaling pathways, MAPK and NO, may act together, since both are involved with CREB phosphorylation in the SCN [90], [100]. In addition, NO is found to be necessary for ERK phosphorylating activity in primary cortical neuronal cultures [89]. The similarities between the signaling pathways in the mouse SCN and peripheral zebrafish cells suggest a preserved mechanism for the modulation of clock genes throughout vertebrate evolution. Such conserved mechanisms are obviously critical to cellular function and, therefore, illustrates an increasing need to better understand the resetting mechanisms that underpin clock gene expression in peripheral clocks.

Oxidative stress and opsins

For many years scientists have been searching to identify the photoreceptor molecules that render zebrafish cells sensitive to light and to elucidate how they function to reset clock genes. There is supporting evidence for two possibilities, oxidative stress and opsins. Most data supporting oxidative stress suggest that flavin-containing oxidases are the light sensors responsible for circadian photoentrainment in zebrafish cells [64], [101]; however their functional role has yet to be demonstrated. Some studies have suggested that opsins such as Tmt may be the elusive photopigment [25], [26]; however, our results imply that Opn4 (or at least an opsin that shows some resemblance to the signaling pathway of melanopsin) may underpin photoentrainment in the zebrafish. Strengthening this possibility, light sensitivity of the cavefish Phreatichthys andruzzii clock is lost due to mutations in tmt and opn4m-2, and is rescued after transfection with zebrafish tmt and opn4m-2 [26]. Since Tmt signaling has been proved to be via Gi/G0 [73], our data on blue light signaling through phosphoinositide cascade point to Opn4.

Of course it is possible that these mechanisms, oxidative stress and opsin signaling, are not mutually exclusive of each other. Indeed, these two cellular processes seem to converge on the same signaling component, specifically MAPK in this case [59], [64], suggesting that these two mechanisms have probably evolved due to the same selective pressure, i.e. light associated to higher temperatures. The difference between these two signaling pathways lies on the molecules that activate the MAPK pathway: in oxidative stress activation relies on the action of reactive oxygen species (ROS) [64], [101], whereas the signaling pathway proposed here is based on the generation of reactive nitrogen species (RNS). A large number of reports indicate that RNS, as well as ROS, may act on signaling pathways through post-translational modifications, providing robust spatial and temporal control of protein conformation that result in the fine adjustment of a particular protein activity (for review, see [102], [103]). The physiological relevance of these two distinct systems may be justified by the levels of irradiance to which zebrafish are exposed.

At dusk and dawn, due to a lower level of irradiance for example, opsins may offer a better detection system for circadian entrainment, where just a single photon can trigger opsin activation [71], [72]. In this scenario, oxidative stress may be more effective under high irradiance levels or stressful light conditions, thus not only reinforcing circadian photoentrainment but linking it to photoreactive mechanisms such as DNA repair [101].

Data Availability

The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper.

Funding Statement

BCRR Coordenação de Aperfeiçoamento de Pessoal de Ensino Superior, LHRGL Fundação de Amparo a Pesquisa do Estado de São Paulo(#2011/23930-8), AMLC Fundação de Amparo a Pesquisa do Estado de São Paulo (#2012-50214-4) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (301293/2011-2), MNCMM Fundação de Amparo a Pesquisa do Estado de São Paulo (2010/51374-0). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Provencio I, Jiang G, De Grip WJ, Hayes WP, Rollag MD (1998) Melanopsin: An opsin in melanophores, brain, and eye. Proc Natl Acad Sci USA 95: 340–345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Jenkins A, Munoz M, Tarttelin EE, Bellingham J, Foster RG, et al. (2003) VA opsin, melanopsin, and an inherent light response within retinal interneurons. Curr Biol 13: 1269–1278. [DOI] [PubMed] [Google Scholar]
  • 3. Bailey MJ, Cassone VM (2005) Melanopsin expression in the chick retina and pineal gland. Brain Res Mol Brain Res 134: 345–348. [DOI] [PubMed] [Google Scholar]
  • 4. Chaurasia SS, Rollag MD, Jiang G, Hayes WP, Haque R, et al. (2005) Molecular cloning, localization and circadian expression of chicken melanopsin (Opn4): differential regulation of expression in pineal and retinal cell types. J Neurochem 92: 158–170. [DOI] [PubMed] [Google Scholar]
  • 5. Bellingham J, Chaurasia SS, Melyan Z, Liu C, Cameron MA, et al. (2006) Evolution of melanopsin photoreceptors: discovery and characterization of a new melanopsin in nonmammalian vertebrates. PLoS Biol 4: e254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Tomonari S, Takagi A, Noji S, Ohuchi H (2007) Expression pattern of the melanopsin-like (cOpn4m) and VA opsin-like genes in the developing chicken retina and neural tissues. Gene Expr Patterns 7: 746–753. [DOI] [PubMed] [Google Scholar]
  • 7. Davies WI, Zheng L, Hughes S, Tamai TK, Turton M, et al. (2011) Functional diversity of melanopsins and their global expression in the teleost retina. Cell Mol Life Sci 68: 4115–4132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Davies WI, Tay BH, Zheng L, Danks JA, Brenner S, et al. (2012) Evolution and functional characterisation of melanopsins in a deep-sea chimaera (elephant shark, Callorhinchus milii). PLoS One 7 (12) e51276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Berson DM, Dunn FA, Takao M (2002) Phototransduction by retinal ganglion cells that set the circadian clock. Science 295: 1070–1073. [DOI] [PubMed] [Google Scholar]
  • 10. Provencio I, Rollag MD, Castrucci AM (2002) Photoreceptive net in the mammalian retina. This mesh of cells may explain how some blind mice can still tell day from night. Nature 415: 493. [DOI] [PubMed] [Google Scholar]
  • 11. Lucas RJ, Hattar S, Takao M, Berson DM, Foster RG, et al. (2003) Diminished pupillary light reflex at high irradiances in melanopsin-knockout mice. Science 299: 245–247. [DOI] [PubMed] [Google Scholar]
  • 12. Ruby NF, Brennan TJ, Xie X, Cao V, Franken P, et al. (2002) Role of melanopsin in circadian responses to light. Science 298: 2211–2213. [DOI] [PubMed] [Google Scholar]
  • 13. Panda S, Antoch MP, Miller BH, Su AI, Schook AB, et al. (2002) Coordinated transcription of key pathways in the mouse by the circadian clock. Cell 109: 307–320. [DOI] [PubMed] [Google Scholar]
  • 14. Panda S, Provencio I, Tu DC, Pires SS, Rollag MD, et al. (2003) Melanopsin is required for non-image-forming photic responses in blind mice. Science 301: 525–527. [DOI] [PubMed] [Google Scholar]
  • 15. Hardie RC, Raghu P (2001) Visual transduction in Drosophila. Nature 413: 186–193. [DOI] [PubMed] [Google Scholar]
  • 16. Newman LA, Walker MT, Brown RL, Cronin TW, Robinson PR (2003) Melanopsin forms a functional short-wavelength photopigment. Biochemistry 42 (44) 12734–12738. [DOI] [PubMed] [Google Scholar]
  • 17. Panda S, Nayak SK, Campo B, Walker JR, Hogenesch JB, et al. (2005) Illumination of the melanopsin signaling pathway. Science 307: 600–604. [DOI] [PubMed] [Google Scholar]
  • 18. Melyan Z, Tarttelin EE, Bellingham J, Lucas RJ, Hankins MW (2005) Addition of human melanopsin renders mammalian cells photoresponsive. Nature 433: 741–745. [DOI] [PubMed] [Google Scholar]
  • 19. Qiu X, Kumbalasiri T, Carlson SM, Wong KY, Krishna V, et al. (2005) Induction of photosensitivity by heterologous expression of melanopsin. Nature 433: 745–749. [DOI] [PubMed] [Google Scholar]
  • 20. Isoldi MC, Rollag MD, Castrucci AM, Provencio I (2005) Rhabdomeric phototransduction initiated by the vertebrate photopigment melanopsin. Proc Natl Acad Sci USA 102: 1217–1221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Contin MA, Verra DM, Guido ME (2006) An invertebrate-like phototransduction cascade mediates light detection in the chicken retinal ganglion cells. FASEB J 20 (14) 2648–2650. [DOI] [PubMed] [Google Scholar]
  • 22. Peirson SN, Oster H, Jones SL, Leitges M, Hankins MW, et al. (2007) Microarray analysis and functional genomics identify novel components of melanopsin signaling. Curr Biol 17 (16) 1363–1372. [DOI] [PubMed] [Google Scholar]
  • 23. Graham DM, Wong KY, Shapiro P, Frederick C, Pattabiraman K, et al. (2008) Melanopsin ganglion cells use a membrane-associated rhabdomeric phototransduction cascade. J Neurophysiol 99 (5) 2522–2532. [DOI] [PubMed] [Google Scholar]
  • 24. Kumbalasiri T, Rollag MD, Isoldi MC, Castrucci AM, Provencio I (2007) Melanopsin triggers the release of internal calcium stores in response to light. Photochem Photobiol 83: 273–279. [DOI] [PubMed] [Google Scholar]
  • 25. Moutsaki P, Whitmore D, Bellingham J, Sakamoto K, David-Gray ZK, et al. (2003) Teleost multiple tissue (tmt) opsin: a candidate photopigment regulating the peripheral clocks of zebrafish? Brain Res Mol Brain Res 112: 135–145. [DOI] [PubMed] [Google Scholar]
  • 26. Cavallari N, Frigato E, Vallone D, Fröhlich N, Lopez-Olmeda JF, et al. (2011) A blind circadian clock in cavefish reveals that opsins mediate peripheral clock photoreception. PLoS Biol 9 (9) e1001142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Dunlap JC (1999) Molecular bases for circadian clocks. Cell 96: 271–290. [DOI] [PubMed] [Google Scholar]
  • 28. Shearman LP, Sriram S, Weaver DR, Maywood ES, Chaves I, et al. (2000) Interacting molecular loops in the mammalian circadian clock. Science 288: 1013–1019. [DOI] [PubMed] [Google Scholar]
  • 29. Okamura H, Yamaguchi S, Yagita K (2002) Molecular machinery of the circadian clock in mammals. Cell Tissue Res 309: 47–56. [DOI] [PubMed] [Google Scholar]
  • 30. Bass J, Takahashi JS (2010) Circadian integration of metabolism and energetics. Science 330: 1349–1354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Zhang EE, Kay SA (2010) Clocks not winding down: unravelling circadian networks. Nat Rev Mol Cell Biol 11: 764–776. [DOI] [PubMed] [Google Scholar]
  • 32. Huang W, Ramsey KM, Marcheva B, Bass J (2011) Circadian rhythms, sleep, and metabolism. J Clin Invest 121: 2133–2141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Emery P, So WV, Kaneko M, Hall JC, Rosbash M (1998) CRY, a Drosophila clock and light-regulated cryptochrome, is a major contributor to circadian rhythm resetting and photosensitivity. Cell 95: 669–679. [DOI] [PubMed] [Google Scholar]
  • 34. Plautz JD, Kaneko M, Hall JC, Kay SA (1997) Independent photoreceptive circadian clocks throughout Drosophila. Science 278 (5343) 1632–1635. [DOI] [PubMed] [Google Scholar]
  • 35. Ceriani MF, Darlington TK, Staknis D, Mas P, Petti AA, et al. (1999) Light-dependent sequestration of TIMELESS by CRYPTOCHROME. Science 285: 553–556. [DOI] [PubMed] [Google Scholar]
  • 36. Whitmore D, Foulkes NS, Sassone-Corsi P (2000) Light acts directly on organs and cells in culture to set the vertebrate circadian clock. Nature 404: 87–91. [DOI] [PubMed] [Google Scholar]
  • 37. Pando MP, Morse D, Cermakian N, Sassone-Corsi P (2002) Phenotypic rescue of a peripheral clock genetic defect via SCN hierarchical dominance. Cell 110: 107–117. [DOI] [PubMed] [Google Scholar]
  • 38. Farhat FP, Martins CB, De Lima LH, Isoldi MC, Castrucci AM (2009) Melanopsin and clock genes: regulation by light and endothelin in the zebrafish ZEM-2S cell line. Chronobiol Int 26: 1090–1119. [DOI] [PubMed] [Google Scholar]
  • 39. Buhr ED, Yoo SH, Takahashi JS (2010) Temperature as a universal resetting cue for mammalian circadian oscillators. Science 330: 379–385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Balsalobre A, Damiola F, Schibler U (1998) A serum shock induces circadian gene expression in mammalian tissue culture cells. Cell 93: 929–937. [DOI] [PubMed] [Google Scholar]
  • 41. Drivenes Ø1, Søviknes AM, Ebbesson LO, Fjose A, Seo HC, et al. (2003) Isolation and characterization of two teleost melanopsins and their differential expression within the inner retina. J Comp Neurol 456 (1) 84–93. [DOI] [PubMed] [Google Scholar]
  • 42. Lima LHRG, Scarparo AC, Isoldi MC, Visconti MA, Castrucci AML (2006) Melanopsin in chicken melanocytes and retina. Biol Rhythm Res 37: 393–404. [Google Scholar]
  • 43. Bilotta J, Saszik S (2001) The zebrafish as a model visual system. Int J Dev Neurosci 19: 621–629. [DOI] [PubMed] [Google Scholar]
  • 44. Gonzalez-Nunez V, Rodriguez RE (2009) The zebrafish: a model to study the endogenous mechanisms of pain. ILAR J 50: 373–386. [DOI] [PubMed] [Google Scholar]
  • 45. Chakraborty C, Hsu CH, Wen ZH, Lin CS, Agoramoorthy G (2009) Zebrafish: a complete animal model for in vivo drug discovery and development. Curr Drug Metab 10: 116–124. [DOI] [PubMed] [Google Scholar]
  • 46. Cahill GM (2002) Clock mechanisms in zebrafish. Cell Tissue Res 309 (1) 27–34. [DOI] [PubMed] [Google Scholar]
  • 47. Tamai TK, Carr AJ, Whitmore D (2005) Zebrafish circadian clocks: cells that see light. Biochem Soc Trans 33 (Pt 5) 962–966. [DOI] [PubMed] [Google Scholar]
  • 48. Idda ML, Bertolucci C, Vallone D, Gothilf Y, Sánchez-Vázquez FJ, et al. (2012) Circadian clocks: lessons from fish. Prog Brain Res 199: 41–57. [DOI] [PubMed] [Google Scholar]
  • 49. Vatine G, Vallone D, Gothilf Y, Foulkes NF (2011) It's time to swim! Zebrafish and the circadian clock. FEBS lett 585 (10) 1485–1494. [DOI] [PubMed] [Google Scholar]
  • 50. Goidin D, Mamessier A, Staquet MJ, Schmitt D, Berthier-Vergnes O (2001) Ribosomal 18S RNA prevails over glyceraldehyde-3-phosphate dehydrogenase and beta-actin genes as internal standard for quantitative comparison of mRNA levels in invasive and noninvasive human melanoma cell subpopulations. Anal Biochem 295: 17–21. [DOI] [PubMed] [Google Scholar]
  • 51. McCurley TA, Callard GV (2008) Characterization of housekeeping genes in zebrafish: male-female differences and effects of tissue type, developmental stage and chemical treatment. BMC Mol Biol 9: 102–119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Aerts JL, Gonzales MI, Topalian LS (2004) Selection of appropriate control genes to assess expression of tumor antigens using real-time RT-PCR. Biotechniques 36: 84–86, 88, 90–91. [DOI] [PubMed] [Google Scholar]
  • 53. Zhu LJ, Altmann SW (2005) mRNA and 18S-RNA coapplication-reverse transcription for quantitative gene expression analysis. Anal Biochem 345: 102–109. [DOI] [PubMed] [Google Scholar]
  • 54. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402–408. [DOI] [PubMed] [Google Scholar]
  • 55. Ziv L, Gothilf Y (2006) Period2 expression pattern and its role in the development of the pineal circadian clock in zebrafish. Chronobiol Int 23 (1–2) 101–112. [DOI] [PubMed] [Google Scholar]
  • 56. Tamai TK, Young LC, Whitmore D (2007) Light signaling to the zebrafish circadian clock by Cryptochrome 1a. Proc Natl Acad Sci USA 104 (37) 14712–14717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Golombek DA, Rosenstein RE (2010) Physiology of circadian entrainment. Physiol Rev 90: 1063–1102. [DOI] [PubMed] [Google Scholar]
  • 58. Hayashi Y, Nishio M, Naito Y, Yokokura H, Nimura Y, et al. (1999) Regulation of neuronal nitric-oxide synthase by calmodulin kinases. J Biol Chem 274 (29) 20597–20602. [DOI] [PubMed] [Google Scholar]
  • 59. Cermakian N, Pando MP, Thompson CL, Pinchak AB, Selby CP, et al. (2002) Light induction of a vertebrate clock gene involves signaling through blue-light receptors and MAP kinases. Curr Biol 12 (10) 844–848. [DOI] [PubMed] [Google Scholar]
  • 60. Stokkan KA, Yamazaki S, Tei H, Sakaki Y, Menaker M (2001) Entrainment of the circadian clock in the liver by feeding. Science 291: 490–493. [DOI] [PubMed] [Google Scholar]
  • 61. Blum ID, Lamont EW, Abizaid A (2012) Competing clocks: metabolic status moderates signals from the master circadian pacemaker. Neurosci Biobehav Rev 36: 254–270. [DOI] [PubMed] [Google Scholar]
  • 62. Rollag MD, Provencio I, Sugden D, Green CB (2000) Cultured amphibian melanophores: A model system to study melanopsin photobiology. Methods Enzymol 316: 291–309. [DOI] [PubMed] [Google Scholar]
  • 63. Tamai TK, Carr AJ, Whitmore D (2005) Zebrafish circadian clocks: cells that see light. Biochem Soc Trans 33 (5) 962–966. [DOI] [PubMed] [Google Scholar]
  • 64. Hirayama J, Cho S, Sassone-Corsi P (2007) Circadian control by the reduction/oxidation pathway: catalase represses light-dependent clock gene expression in the zebrafish. Proc Natl Acad Sci USA 104 (40) 15747–15752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Mracek P, Pagano C, Fröhlich N, Idda ML, Cuesta IH, et al. (2013) ERK signaling regulates light-induced gene expression via D-Box enhancers in a differential, wavelength-dependent manner. PLoS One 8 (6) e67858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Hughes S, Hankins MW, Foster RG, Peirson SN (2012) Melanopsin phototransduction: Slowly emerging from the dark. Progress in Brain Res 199: 19–40. [DOI] [PubMed] [Google Scholar]
  • 67. Sekaran S, Foster RG, Lucas RJ, Hankins MW (2003) Calcium imaging reveals a network of intrinsically light-sensitive inner-retinal neurons. Curr Biol 13: 1290–1298. [DOI] [PubMed] [Google Scholar]
  • 68. Berridge G, Cramer R, Galione A, Patel S (2002) Metabolism of the novel Ca2+-mobilizing messenger nicotinic acid-adenine dinucleotide phosphate via a 2′-specific Ca2+-dependent phosphatase. Biochem J 365: 295–301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Nishizuka Y (1988) The heterogeneity and differential expression of multiple species of the protein kinase C family. Biofactors 1: 17–20. [PubMed] [Google Scholar]
  • 70. Patten SA, Sihra RK, Dhami KS, Coutts CA, Ali DW (2007) Differential expression of PKC isoforms in developing zebrafish. Int J Dev Neurosci 25: 155–164. [DOI] [PubMed] [Google Scholar]
  • 71. Koyanagi M, Terakita A (2014) Diversity of animal opsin-based pigments and their optogenetic potential. Biochim Biophys Acta 1837: 710–716. [DOI] [PubMed] [Google Scholar]
  • 72. Davies WL, Hankins MW, Foster RG (2010) Vertebrate ancient opsin and melanopsin: divergent irradiance detectors. Photochem Photobiol Sci 9: 1444–1457. [DOI] [PubMed] [Google Scholar]
  • 73. Koyanagi M, Takada E, Nagata T, Tsukamoto H, Terakita A (2013) Homologs of vertebrate Opn3 potentially serve as a light sensor in nonphotoreceptive tissue. Proc Natl Acad Sci USA 110 (13) 4998–5003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74. Ozturk N, Selby CP, Zhong D, Sancar A (2014) Mechanism of photosignaling by Drosophila cryptochrome: role of the redox status of the flavin chromophore. J Biol Chem 289 (8) 4634–4642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75. Pittendrigh CS (1993) Temporal organization: reflections of a Darwinian clock-watcher. Annu Rev Physiol 55: 16–54. [DOI] [PubMed] [Google Scholar]
  • 76. Hankins MW, Peirson SN, Foster RG (2008) Melanopsin: an exciting photopigment. Trends Neurosci 31: 27–36. [DOI] [PubMed] [Google Scholar]
  • 77. Prosser RA, Gillette MU (1991) Cyclic changes in cAMP concentration and phosphodiesterase activity in a mammalian circadian clock studied in vitro. Brain Res 568: 185–192. [DOI] [PubMed] [Google Scholar]
  • 78. Ferreyra GA, Golombek DA (2000) Cyclic AMP and protein kinase A rhythmicity in the mammalian suprachiasmatic nuclei. Brain Res 858: 33–39. [DOI] [PubMed] [Google Scholar]
  • 79. Prosser RA, Gillette MU (1989) The mammalian circadian clock in the suprachiasmatic nuclei is reset in vitro by cAMP. J Neurosci 9: 1073–1081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80. O'Neill JS, Maywood ES, Chesham JE, Takahashi JS, Hastings MH (2008) cAMP-dependent signaling as a core component of the mammalian circadian pacemaker. Science 320: 949–953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81. Golombek DA, Ralph MR (1994) KN-62, an inhibitor of Ca2+/calmodulin kinase II, attenuates circadian responses to light. Neuroreport 5: 1638–1640. [DOI] [PubMed] [Google Scholar]
  • 82. Golombek DA, Ralph MR (1995) Circadian responses to light: the calmodulin connection. Neurosci Lett 192: 101–104. [DOI] [PubMed] [Google Scholar]
  • 83. Ding JM, Chen D, Weber ET, Faiman LE, Rea MA, et al. (1994) Resetting the biological clock: mediation of nocturnal circadian shifts by glutamate and NO. Science 266: 1713–1717. [DOI] [PubMed] [Google Scholar]
  • 84. Watanabe A, Ono M, Shibata S, Watanabe S (1995) Effect of a nitric oxide synthase inhibitor, N-nitro-L-arginine methylester, on light-induced phase delay of circadian rhythm of wheel-running activity in golden hamsters. Neurosci Lett 192: 25–28. [DOI] [PubMed] [Google Scholar]
  • 85. Fukushima T, Shimazoe T, Shibata S, Watanabe A, Ono M, et al. (1997) The involvement of calmodulin and Ca2+/calmodulin-dependent protein kinase II in the circadian rhythms controlled by the suprachiasmatic nucleus. Neurosci Lett 227: 45–48. [DOI] [PubMed] [Google Scholar]
  • 86. Melo L, Golombek DA, Ralph MR (1997) Regulation of circadian photic responses by nitric oxide. J Biol Rhythms 12: 319–326. [DOI] [PubMed] [Google Scholar]
  • 87. Ferreyra GA, Cammarota MP, Golombek DA (1998) Photic control of nitric oxide synthase activity in the hamster suprachiasmatic nuclei. Brain Res 797: 190–196. [DOI] [PubMed] [Google Scholar]
  • 88. Agostino PV, Ferreyra GA, Murad AD, Watanabe Y, Golombek DA (2004) Diurnal, circadian and photic regulation of calcium/calmodulin-dependent kinase II and neuronal nitric oxide synthase in the hamster suprachiasmatic nuclei. Neurochem Int 44: 617–625. [DOI] [PubMed] [Google Scholar]
  • 89. Yun HY, Gonzalez-Zulueta M, Dawson VL, Dawson TM (1998) Nitric oxide mediates N-methyl-D-aspartate receptor-induced activation of p21ras. Proc Natl Acad Sci USA 95: 5773–5778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90. Obrietan K, Impey S, Smith D, Athos J, Storm DR (1999) Circadian regulation of cAMP response element-mediated gene expression in the suprachiasmatic nuclei. J Biol Chem 274: 17748–17756. [DOI] [PubMed] [Google Scholar]
  • 91. Krishna M, Narang H (2008) The complexity of mitogen-activated protein kinases (MAPKs) made simple. Cell Mol Life Sci 65: 3525–3544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92. Chansard M, Molyneux P, Nomura K, Harrington ME, Fukuhara C (2007) c-Jun N-terminal kinase inhibitor SP600125 modulates the period of mammalian circadian rhythms. Neuroscience 145: 812–823. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93. Akashi M, Hayasaka N, Yamazaki S, Node K (2008) Mitogen-activated protein kinase is a functional component of the autonomous circadian system in the suprachiasmatic nucleus. J Neurosci 28: 4619–4623. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94. Obrietan K, Impey S, Storm DR (1998) Light and circadian rhythmicity regulate MAP kinase activation in the suprachiasmatic nuclei. Nat Neurosci 1: 693–700. [DOI] [PubMed] [Google Scholar]
  • 95. Butcher GQ, Doner J, Dziema H, Collamore M, Burgoon PW, et al. (2002) The p42/44 mitogen-activated protein kinase pathway couples photic input to circadian clock entrainment. J Biol Chem 277: 29519–29525. [DOI] [PubMed] [Google Scholar]
  • 96. Butcher GQ, Lee B, Obrietan K (2003) Temporal regulation of light-induced extracellular signal-regulated kinase activation in the suprachiasmatic nucleus. J Neurophysiol 90: 3854–3863. [DOI] [PubMed] [Google Scholar]
  • 97. Dziema H, Oatis B, Butcher GQ, Yates R, Hoyt KR, et al. (2003) The ERK/MAP kinase pathway couples light to immediate-early gene expression in the suprachiasmatic nucleus. Eur J Neurosci 17: 1617–1627. [DOI] [PubMed] [Google Scholar]
  • 98. Pizzio GA, Hainich EC, Ferreyra GA, Coso OA, Golombek DA (2003) Circadian and photic regulation of ERK, JNK and p38 in the hamster SCN. Neuroreport 14: 1417–1419. [DOI] [PubMed] [Google Scholar]
  • 99. Hirayama J, Miyamura N, Uchida Y, Asaoka Y, Honda R, et al. (2009) Common light signaling pathways controlling DNA repair and circadian clock entrainment in zebrafish. Cell Cycle 8 (17) 2794–2801. [DOI] [PubMed] [Google Scholar]
  • 100. Ding JM, Faiman LE, Hurst WJ, Kuriashkina LR, Gillette MU (1997) Resetting the biological clock: mediation of nocturnal CREB phosphorylation via light, glutamate, and nitric oxide. J Neurosci 17: 667–675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101. Uchida Y, Hirayama J, Nishina H (2010) A common origin: signaling similarities in the regulation of the circadian clock and DNA damage responses. Biol Pharm Bull 33 (4) 535–544. [DOI] [PubMed] [Google Scholar]
  • 102. Hess DT, Matsumoto A, Kim SO, Marshall HE, Stamler JS (2005) Protein S-nitrosylation: purview and parameters. Nat Rev Mol Cell Biol 6 (2) 150–166. [DOI] [PubMed] [Google Scholar]
  • 103. Martínez-Ruiz A, Cadenas S, Lamas S (2011) Nitric oxide signaling: classical, less classical, and nonclassical mechanisms. Free Radic Biol Med 51 (1) 17–29. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES