Genome-wide analysis of gestational gene-environment interactions in the developing kidney

Abstract

The G protein-coupled bradykinin B2 receptor (Bdkrb2) plays an important role in regulation of blood pressure under conditions of excess salt intake. Our previous work has shown that Bdkrb2 also plays a developmental role since Bdkrb2^−/− embryos, but not their wild-type or heterozygous littermates, are prone to renal dysgenesis in response to gestational high salt intake. Although impaired terminal differentiation and apoptosis are consistent findings in the Bdkrb2^−/− mutant kidneys, the developmental pathways downstream of gene-environment interactions leading to the renal phenotype remain unknown. Here, we performed genome-wide transcriptional profiling on embryonic kidneys from salt-stressed Bdkrb2^+/+ and Bdkrb2^−/− embryos. The results reveal significant alterations in key pathways regulating Wnt signaling, apoptosis, embryonic development, and cell-matrix interactions. In silico analysis reveal that nearly 12% of differentially regulated genes harbor one or more Pax2 DNA-binding sites in their promoter region. Further analysis shows that metanephric kidneys of salt-stressed Bdkrb2^−/− have a significant downregulation of Pax2 gene expression. This was corroborated in Bdkrb2^−/−;Pax2^GFP+/tg mice, demonstrating that Pax2 transcriptional activity is significantly repressed by gestational salt-Bdkrb2 interactions. We conclude that gestational gene (Bdkrb2) and environment (salt) interactions cooperate to impact gene expression programs in the developing kidney. Suppression of Pax2 likely contributes to the defects in epithelial survival, growth, and differentiation in salt-stressed BdkrB2^−/− mice.

congenital abnormalities of the kidney and urinary tract are the major cause of end-stage renal disease in infants and children younger than 4 yr of age (38). Depending on the study, genetic analysis has demonstrated that monogenic mutations account for 1.9–30% of cases of human renal dysgenesis (22, 36, 43, 47). These mutations usually involve key transcription factors (e.g., PAX2, EYA1, SALL1, HNF1β, WT1, HOXA11), secreted factors, extracellular matrix proteins, and receptor molecules (e.g., c-RET). Despite these advances, the etiology of the majority of cases of renal dysgenesis remains unknown. In this regard, environmental factors, such as vitamin A deficiency, gestational exposure to aminoglycosides, or nutritional protein deficiency, have been implicated (3, 7, 24, 45, 46). Another important cause of developmental defects is gene-environment interactions. In this case, neither the gene mutation nor the environmental stressor is capable of inducing a phenotypic change by itself; rather, a silent mutation requires an environmental stressor to reveal the abnormal phenotype. The cellular and molecular mechanism(s) by which gene-environment interactions induce organ dysgenesis and dysfunction are largely unknown, although DNA damage and epigenetic factors have been implicated (23).

In previous studies, we reported that mice lacking the G protein-coupled bradykinin B2 receptor gene (Bdkrb2) are prone to renal dysgenesis if exposed to gestational high salt via the maternal diet (13, 14). Importantly, neither Bdkrb2 gene disruption nor gestational salt stress alone is sufficient to cause renal dysgenesis, and both factors must interact to initiate metanephric apoptosis and impaired terminal epithelial cell differentiation (17, 21). The onset of renal dysgenesis is preceded by phosphorylation of the transcription factor p53 on serine 23 (Ser20 in human p53) by the checkpoint kinase 1 (Chk1) (17). In the presence of salt stress, P-Ser23-p53 activates promoters of proapoptotic genes (e.g., Bax), while repressing terminal differentiation genes (e.g., tubular transporters, cell adhesion molecules, and transcriptional regulators such as HNF1β) (17, 19). Germline deletion of p53 or Bax genes partially rescues the abnormal renal phenotype in salt-stressed Bdkrb2^−/− mice (19). Similarly, germline (knock-in) substitution of Ser23 by Ala23 in p53 prevents the development of renal dysgenesis in salt-stressed Bdkrb2-null mutants (12).

The present study was designed to examine the effects of fetal salt-Bdkrb2 interactions on the overall gene expression profile of the midgestation developing kidney. The results reveal a wide-ranging effect on key cellular pathways such as Wnt signaling, calcium signaling, apoptosis, and patterning. Moreover, our studies uncover an important effect of fetal salt-Bdkrb2 interactions on Pax2 gene expression, a key transcriptional regulator of renal growth and differentiation.

MATERIALS AND METHODS

Animals.

All animal protocols utilized in this study were approved by and in strict adherence to guidelines established by the Tulane University Institutional Animal Care and Use Committee. Mice with disruption of the entire protein-coding region (exon 3) of Bdkrb2 bred on C57bl6 background have been described (4, 14). Pax2(GFP) BAC transgenic mice (Pax2^gfp/+) carrying 30 kb of Pax2 genomic upstream regulatory sequences driving a GFP cassette were generously provided by the laboratory of Maxime Bouchard (30). These mice express the reporter faithfully mimicking the spatiotemporal developmental expression of endogenous Pax2. Bdkrb2^+/−;Pax2-GFP⁺ were back-crossed to Bdkrb2^−/− or Bdkrb2^+/− mice, and pregnant mice were placed on 5% NaCl diet for the duration of pregnancy or until surgical dissection, as described (8, 14). Genotyping was performed by PCR of genomic DNA. Bdkrb2 wild-type and mutant alleles were amplified with the following primers: 435: GGTCCTGAACACCAACATGG, 434: TGTCCTCAGCGTGTTCTTCC, and 014: AGGTGAGATGACAGGAGATC, and 013: CTTGGGTGGAGAGGCTATTC; and GFP: forward ACTGGTGTGAGAGGCGGGTTCTT, reverse GCTGGCGAAAGGGGGATGTGCTG.

RNA extraction and RT-PCR.

Total RNA was isolated with the RNeasy Mini Kit (QIAGEN, Valencia, CA). Quantitative Real Time PCR assays were performed with the 1-Step Brilliant QRT-PCR Master Mix Kit (Stratagene) containing 100 nM forward primer, 100 nM reverse primer, and 20 ng total RNA. Relative mRNA levels were normalized to GAPDH. The following real-time primers were purchased from Applied Biosystems: GFP transgene forward: CCACATGAAGCAGCAGGACTT and GFP transgene reverse: GGTGCGCTCCTGGACGTA, and probe TTCAAGTCCGCCATGCCCGAA labeled on the 5′- and 3′-ends with 6-FAM and TAMRA, respectively; PAX2 TaqMan primer set Mm01217933mH; GAPDH TaqMan Rodent primer set number Mm4308313.

Microarray.

Heterozygous pairings were done to obtain Bdkrb2^+/+ and Bdkrb2^−/− litter-matched kidneys. RNA (500 ng) was obtained from each of three pairs of Bdkrb2^+/+ and Bdkrb2^+/+ embryonic day (E) 14.5 kidneys, amplified, and labeled, and the cDNA was hybridized to Agilent 4X44K Whole Mouse Genome Microarray slide from Agilent Technologies. To prevent bias from signaling detection on different colors (Cy5 red, Cy3 green), we applied dye-swap strategy to this experiment, in which identical pairs of Bdkrb2^+/+ and Bdkrb2^−/− cDNA samples were reversely labeled by Cy5 and Cy3 into two groups. Raw data were processed by GeneSpring software. Only genes showing a significant (P < 0.05) differential change in expression after Benjamini and Hochberg false discovery rate (FDR) correction in the three datasets were used for further analyses. The microarray results were deposited in the National Center for Biotechnology Information database; the Gene Expression Omnibus number is GSE26681.

Quantitative real-time PCR.

Validation of microarray data was done by RT-PCR on RNA from E14.5 Bdkrb2^+/+ and Bdkrb2^−/− kidneys. Exon-spanning primer-probes for TaqMan gene expression assay from Applied Biosystems were utilized. Reactions were prepared by TaqMan RNA-to-CT 1-Step Kit and amplified by Stratagene Mx3000P and Mx3005P. Expression was normalized against endogenous GAPDH mRNA levels. Experimental and biological triplicates were applied.

Metanephric organ culture.

Embryonic kidneys were aseptically microdissected from timed-pregnant mice at E12.5 and were cultured for the times indicated on polycarbonate Transwell filters (0.4 μm pore size; Corning Costar, Acton, MA) over medium (DMEM/F12 medium + 10% FBS) at 37°C and 5% CO₂, as described (35).

Immunofluorescence staining.

Postnatal day (P) 1 and E14.5 kidneys were fixed in 10% formalin and processed for paraffin embedding and sectioning. Antibodies for the following proteins were used: Pax2 (1:200, Invitrogen), LTA (1:100, Vector Laboratories), AQP-2 (1:500, SC-9882; Santa Cruz Biotechnology, Santa Cruz, CA), and Cytokeratin (1:200, Sigma).

The spatiotemporal expression pattern of the Pax2-GFP transgene was recorded and analyzed by GFP Fluorescent Microscopy during 48 h ex vivo organ culture. Images were acquired at the same exposure with Slidebook 4 (Intelligent imaging innovations, Denver, CO) operating an Olympus Spinning Disc microscope fitted with a Hamamatsu CCD. Sum pixel intensity was measured with the “mask segment” function of Slidebook 4. The same mask parameters were assigned to all images. Relative GFP fluorescence pixel intensity mask data were then exported and subjected to statistical analysis by t-test or ANOVA.

RESULTS

BdkrB2-regulated transcriptome in the developing kidney.

We previously reported that gestational salt stress of BdkrB2-null mice causes renal dysgenesis in the homozygous but not heterozygous or wild-type littermates (12, 14, 17, 19). To identify differentially expressed genes in BdkrB2-null kidneys that might be responsible for the phenotype, we performed gene expression microarray on E14.5 BdkrB2^+/+ and BdkrB2^−/− litter-matched kidneys. We chose E14.5 embryonic age because the renal phenotype becomes histologically evident between E15.5 and E16.5 (14, 17, 19). By two-color dye-swap strategy, the microarrays (44,000 probes) detected 348 unique genes with significant changes in gene expression (>1.5-fold change, P < 0.05) (Fig. 1). Of these, 158 transcripts were upregulated, and 190 transcripts were downregulated.

Fig. 1.

A scatterplot depicting the distribution of significantly altered genes between gestational salt-stressed Bdkrb2^−/− and Bdkrb2^+/+ kidneys at embryonic day (E) 14.5. Red, upregulated; yellow, unaltered; green, downregulated (P < 0.05, >1.5-fold).

Gene Ontology (GO) functional annotation of differentially expressed genes in wild-type and BdkrB2 mutants revealed that the top functional categories comprise regulation of calcium transport, extracellular structure/matrix organization, cell communication, Wnt receptor signaling, pattern specification, apoptosis, embryonic development, and anatomical structure morphogenesis (Fig. 2). Further functional categorization revealed that the upregulated genes in BdkrB2 mutants play integral roles in cell adhesion, transcriptional regulation, muscle development, and cell proliferation and fate (Fig. 3A). Downregulated genes clustered in pathways pertaining to DNA, RNA and protein metabolism, transcriptional regulation, cell proliferation/fate, and chromatin modification (Fig. 3B). Table 1 lists a subset of differentially expressed transcripts with known expression pattern in the developing kidney based on the GUDMAP database. Interestingly, several transcription factors (e.g., Homeobox genes, GATA6, and RXR) and Wnt6 are among the downregulated genes in the mutant kidneys. A more complete list of significantly upregulated and downregulated genes is presented in Tables 2 and 3. Quantitative RT-PCR confirmed the directional changes in five randomly selected genes, as well as in Dvl2 and Hoxb4 (Fig. 4, A–G).

Fig. 2.

Gene ontology analysis of differentially regulated genes in E14.5 Bdkrb2^−/− kidneys.

Fig. 3.

Functional categorization of upregulated (A) and downregulated (B) genes in gestational salt-stressed BdkrB2 mutant kidneys.

Table 1.

Selected differentially expressed transcripts with proven expression in GUDMAP database

Probe Set ID	Gene Title	Gene Symbol	Fold Change	P Value
A_51_P402391	activin A receptor, type 1B	Acvr1b	2.47	0.00598
A_51_P286301	bradykinin receptor, beta 1	Bdkrb1	2.30	0.0197
A_51_P149469	actin, alpha, cardiac muscle 1	Actc1	1.99	0.0232
A_51_P457196	secreted frizzled-related protein 4	Sfrp4	1.64	0.0204
A_51_P116651	dermatopontin	Dpt	1.59	0.0362
A_52_P480351	lysyl oxidase	Lox	1.56	0.0163
A_51_P487518	caspase 12	Casp12	1.52	0.0113
A_52_P299915	mitogen-activated protein kinase kinase 6	Map2k6	1.52	0.005
A_51_P176365	GTPase, IMAP family member 5	Gimap5	1.52	0.0336
A_52_P451073	tumor necrosis factor receptor superfamily, member 21	Tnfrsf21	1.50	0.000329
A_52_P315155	Eph receptor B2	Ephb2	−1.50	0.0488
A_52_P415155	wingless-related MMTV integration site 6	Wnt6	−1.50	0.00602
A_52_P349939	enolase 1, alpha nonneuron	Eno1	−1.50	0.0371
A_52_P285992	ADP-ribosylation factor GTPase activating protein 2	Zfp289	−1.51	0.034
A_51_P246471	pre-B cell leukemia transcription factor 2	Pbx2	−1.51	0.0123
A_51_P112319	homeobox D11	Hoxd11	−1.52	0.0271
A_51_P244892	protein inhibitor of activated STAT 4	Pias4	−1.53	0.00837
A_51_P360586	homeobox A6	Hoxa6	−1.57	0.00555
A_52_P519689	Retinold X receptor beta	Rxrb	−1.59	0.0429
A_52_P147070	calcium channel alpha 2/delta subunit 2	Cacna2d2	−1.62	0.00131
A_52_P565957	homeobox B4	Hoxb4	−1.66	0.0055
A_52_P595908	ring finger protein 138	Rnf138	−1.68	0.0308
A_52_P590175	GATA binding protein 6	Gata6	−2.85	0.0205
A_51_P301483	homeobox C8	Hoxc8	−18.87	0.0357

Table 2.

Upregulated genes in gestational salt-stressed BdkrB2−/− relative to BdkrB2+/+ mice

Gene Symbol	Entrez ID	Entrez Gene Name	Molecular Function	P Value
NCAPG2	76044	nonSMC condensin II complex, subunit G2	mitotic chromosome assembly and segregation	3.22E-09
MYH8	17885	myosin, heavy chain 8, skeletal muscle, perinatal	structural constituent of muscle	4.14E-02
FBLN5	23876	fibulin 5	cell adhesion; cell-matrix adhesion	4.03E-06
PLAC9	100039175	placenta-specific 9	extracellular region	7.04E-03
ACTC1	11464	actin, alpha, cardiac muscle 1	actin filament-based movement	1.84E-02
MYOD1	17927	myogenic differentiation 1	myogenic factors, muscle regeneration	2.34E-02
RPL31	114641	ribosomal protein L31	Ribosomes, component of the 60S subunit	3.32E-03
FNDC1	68655	fibronectin type III domain containing 1	extracellular region	4.47E-02
CNN1	12797	calponin 1, basic, smooth muscle	calmodulin binding, muscle contraction	4.85E-02
POP4	66161	processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)	processing of precursor RNAs, alternative splicing	4.85E-02
TEX14	83560	testis expressed 14	protein amino acid phosphorylation	2.99E-02
CRIP1	12925	cysteine-rich protein 1 (intestinal)	zinc ion binding, cell proliferation	2.03E-02
LUM	17022	lumican	regulate collagen fibril organization, epithelial cell migration	3.44E-02
PRELP	116847	proline/arginine-rich end leucine-rich repeat protein	extracellular matrix, skeletal system development	2.51E-02
NRXN1	18189	neurexin 1	cell adhesion molecules and receptors	1.36E-03
CD4	12504	CD4 molecule	membrane glycoprotein of T lymphocytes	1.65E-03
KDM6A	22289	lysine (K)-specific demethylase 6A	demethylation of tri/dimethylated histone H3	4.47E-02
ACTG2	11475	actin, gamma 2, smooth muscle, enteric	muscle contraction	4.42E-02
CLEC2D	232409	C-type lectin domain family 2, member D	natural killer cell receptor C-type lectin family	2.47E-02
CLMN	94040	calmin (calponin-like, transmembrane)	actin binding	6.17E-04
WNT1	22408	wingless-type MMTV integration site family, member 1	signal transducer activity; frizzled binding, transcription activator activity	2.47E-02
MYH11	17880	myosin, heavy chain 11, smooth muscle	smooth muscle myosin, muscle contraction	4.06E-02
COL12A1	12816	collagen, type XII, alpha 1	modify the interactions between collagen I fibrils	3.62E-04
FGF7	14178	fibroblast growth factor 7	type 2 fibroblast growth factor receptor binding	1.94E-02
GPRC5D	93746	G protein-coupled receptor, family C, group 5, member D	G protein-coupled receptor, undiscovered function	3.45E-02
KDM5C	20591	lysine (K)-specific demethylase 5C	chromatin modification; regulation of transcription	2.84E-03
SVEP1	64817	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	chromatin binding; calcium ion binding, cell adhesion	1.53E-02
AHNAK	66395	AHNAK nucleoprotein	protein binding, nervous system development	4.75E-02
ANXA8	11752	annexin A8	Anticoagulant, inhibits the thromboplastin-specific complex	3.94E-02
DCN	13179	decorin	component of connective tissue, binds to type I collagen fibrils	2.35E-03
CCBP2	59289	chemokine binding protein 2	beta chemokine receptor, development and growth of vascular tumors	4.06E-02
GPR116	224792	G protein-coupled receptor 116	G-protein coupled receptor	1.02E-02
CALM1	640703	calmodulin 1 (phosphorylase kinase, delta)	calcium-binding protein, neurogenesis	2.14E-02
PRSS35	244954	protease, serine, 35	Trypsin, proteolysis,	5.50E-03
MATN2	17181	matrilin 2	formation of filamentous networks	8.52E-04
COL6A3	12835	collagen, type VI, alpha 3	type VI collagen, cell adhesion in muscle	1.71E-02
ELN	13717	elastin	elastic fibers, extracellular matrix	3.09E-02
F13A1	74145	coagulation factor XIII, A1 polypeptide	blood coagulation; peptide cross-linking	3.09E-03
ARSI	545260	arylsulfatase family, member I	cell signaling, and degradation of macromolecules	2.10E-02
BCAT2	12036	branched chain amino-acid transaminase 2, mitochondrial	branched chain family amino acid biosynthesis	4.48E-02
VWF	22371	von Willebrand factor	platelet-vessel wall mediator	7.62E-03
ADAMTS5	23794	ADAM metallopeptidase with thrombospondin type 1 motif, 5	metalloendopeptidase activity, proteolysis	1.03E-03
SPON2	100689	spondin 2, extracellular matrix protein	cell adhesion; axon guidance	1.55E-03
AKAP12	83397	A kinase (PRKA) anchor protein 12	adenylate cyclase binding, cAMP biosynthesis	6.99E-03
CRIM1	50766	cysteine rich transmembrane BMP regulator 1 (chordin-like)	interact with growth factors, implicated in motor neuron differentiation and survival	6.42E-03
EGFR	13649	epidermal growth factor receptor	activation of MAPKK activity; cell morphogenesis	4.22E-02
FLT1	14254	fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)	VEGFR family, receptor tyrosine kinases, angiogenesis and vasculogenesis	1.62E-02
WNT2	22413	wingless-type MMTV integration site family member 2	secreted signaling proteins, regulation of cell fate and patterning during embryogenesis	2.07E-02
ITPR2	16439	inositol 1,4,5-triphosphate receptor, type 2	ion channel activity, response to hypoxia	2.50E-02
SLIT3	20564	slit homolog 3 (Drosophila)	calcium ion binding, organ morphogenesis	4.88E-03
CDK6	12571	cyclin-dependent kinase 6	G1 phase of mitotic cell cycle, cell-matrix adhesion	1.12E-02
MYLK	107589	myosin light chain kinase	phosphorylates myosin regulatory light chains	1.65E-02
COL1A2	12843	collagen, type I, alpha 2	extracellular matrix, skeletal system development	4.80E-02
CAV1	12389	caveolin 1, caveolae protein, 22 kDa	coupling integrins to the Ras-ERK pathway and promoting cell cycle progression	4.13E-02
STARD9	668880	StAR-related lipid transfer (START) domain containing 9	microtubule motor activity, microtubule-based movement	3.00E-02
DSP	109620	desmoplakin	intercellular junctions, cell-cell adhesion	5.78E-03
LTBP4	108075	latent transforming growth factor beta binding protein 4	transforming growth factor beta receptor activity, regulation of cell growth	1.36E-03
RB1	19645	retinoblastoma 1	tumor suppressor gene	4.78E-02
FOXP2	114142	forkhead box P2	orkhead/winged-helix (FOX) family of transcription factors.	2.47E-02
FBLN1	14114	fibulin 1	incorporated into fibrillar extracellular matrix	1.94E-02
ITPR1	16438	inositol 1,4,5-triphosphate receptor, type 1	intracellular receptor for inositol 1,4,5-trisphosphate, response to hypoxia	1.99E-02
THBS1	21825	thrombospondin 1	adhesive glycoprotein, angiogenesis	5.50E-03
ABCC9	20928	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	ATP-binding cassette (ABC) transporters, multi-drug resistance,	3.01E-02
NBEA	26422	neurobeachin	Target protein kinase A to specific subcellular sites	4.85E-02
LPP	210126	LIM domain containing preferred translocation partner in lipoma	protein binding, cell-cell adhesion and cell motility, transcriptional co-activator	2.00E-02
NFIA	18027	nuclear factor I/A	cellular transcription factors	1.16E-02
NAV3	260315	neuron navigator 3	ATPases associated with cellular activities	6.52E-03
COL3A1	12825	collagen, type III, alpha 1	type III collagen, cell-matrix adhesion	1.02E-02
RUNX2	12393	runt-related transcription factor 2	RUNX family of transcription factors,	2.55E-02
TNS1	21961	tensin 1	protein binding, focal adhesions,	7.76E-03
WISP1	22402	WNT1 inducible signaling pathway protein 1	a member of the WNT1 inducible signaling pathway (WISP) protein subfamily	3.94E-02
ADH1A	0	alcohol dehydrogenase 1A (class I), alpha polypeptide	alcohol metabolic process; oxidation reduction	1.79E-02
LAMA2	16773	laminin, alpha 2	mediate the attachment, migration, and organization of cells	2.09E-06
NID1	18073	nidogen 1	basement membrane glycoproteins, adhesion	1.57E-03
PCDH10	18526	protocadherin 10	cadherin superfamily, cell adhesion	3.26E-02
PPP2R2B	72930	protein phosphatase 2, regulatory subunit B, beta	negative control of cell growth and division, apoptosis	2.96E-02
SLC24A3	94249	solute carrier family 24 (sodium/potassium/calcium exchanger), member 3	intracellular calcium homeostasis,	4.55E-02
MANBA	110173	mannosidase, beta A, lysosomal	Lysosomal hydrolase activity,	4.59E-02
FBLN1	14114	fibulin 1	extracellular matrix structural constituent	1.27E-02
FIGF	14205	c-fos induced growth factor (vascular endothelial growth factor D)	angiogenesis, lymphangiogenesis, and endothelial cell growth	4.49E-02
FZD7	14369	frizzled homolog 7 (Drosophila)	receptors for Wnt signaling proteins	4.16E-03
AGRN	11603	agrin	formation of the neuromuscular junction	1.89E-02
ITPR2	16439	inositol 1,4,5-triphosphate receptor, type 2	response to hypoxia, inositol 1,4,5-trisphosphate-sensitive calcium-release channel	2.09E-03
HIPK2	15258	homeodomain interacting protein kinase 2	interacts with homeodomain transcription factors	4.45E-02
KLF4	16600	Kruppel-like factor 4 (gut)	transcription factor, mesodermal cell fate determination	6.44E-03
SIK3	70661	SIK family kinase 3	protein amino acid phosphorylation	2.23E-03
CHST3	53374	carbohydrate (chondroitin 6) sulfotransferase 3	catalyzes the sulfation of chondroitin, nvolved in cell migration and differentiation	3.45E-02
SLIT2	20563	slit homolog 2 (Drosophila)	GTPase inhibitor activity, metanephros development, ureteric bud developmen	4.35E-02
COL15A1	12819	collagen, type XV, alpha 1	adhere basement membranes to underlying connective tissue stroma	3.84E-02
BACH2	12014	BTB and CNC homology 1, basic leucine zipper transcription factor 2	transcription factor activity, regulation of transcription	3.09E-02
DMD	13405	dystrophin	muscle organ development	1.19E-03
EMX1	13796	empty spiracles homeobox 1	transcription factor activity	3.22E-02
ANTXR1	69538	anthrax toxin receptor 1	actin cytoskeleton reorganization	1.27E-02
EDNRA	13617	endothelin receptor type A	potent and long-lasting vasoconstriction	1.37E-02
CELSR1	12614	cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila)	establishment of planar polarity, cell adhesion	4.45E-02
LRP2BP	67620	LRP2 binding protein	protein binding	8.84E-03
PMP22	18858	peripheral myelin protein 22	major component of myelin	1.71E-02
DDX3X	13205	DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked	alteration of RNA secondary structure	3.38E-03
POSTN	50706	periostin, osteoblast specific factor	heparin binding, cell adhesion,	3.38E-02
PLCG2	234779	phospholipase C, gamma 2 (phosphatidylinositol-specific)	phosphoinositide phospholipase C activity	4.75E-02
ICAM1	15894	intercellular adhesion molecule 1	T cell activation, regulation of cell adhesion	4.32E-02
ITGB4	192897	integrin, beta 4	cell communication; cell adhesion	4.62E-02
COL6A1	12833	collagen, type VI, alpha 1	maintaining the integrity of various tissues	3.46E-02
TRPM5	56843	transient receptor potential cation channel, subfamily M, member 5	voltage-gated ion channel activity	4.14E-02
CALCRL	54598	calcitonin receptor-like	regulation of muscle contraction	3.44E-02
MLL5	69188	myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)	histone methyltransferase activity (H3-K4 specific)	1.58E-02
FAM46A	212943	family with sequence similarity 46, member A	N/A	2.14E-02
MYOF	226101	myoferlin	membrane regeneration and repair	3.00E-02
SFRP2	20319	secreted frizzled-related protein 2	putative Wnt-binding site of Frizzled proteins	2.47E-02
LHFP	108927	lipoma HMGIC fusion partner	member of the lipoma HMGIC fusion partner	7.40E-03
KCNK4	16528	potassium channel, subfamily K, member 4	voltage-gated ion channel activity	3.00E-02
ADAMTS15	235130	ADAM metallopeptidase with thrombospondin type 1 motif, 15	metalloendopeptidase activity, proteolysis	4.13E-02
TMCC3	319880	transmembrane and coiled-coil domain family 3	N/A	4.12E-02
G0S2	14373	G0/G1 switch 2	Apoptosis, cell cycle	2.75E-02
RBMS3	207181	RNA binding motif, single stranded interacting protein 3	c-myc gene single-strand binding protein	4.06E-02
CD248	70445	CD248 molecule, endosialin	sugar binding	4.06E-02
FAM107A	268709	family with sequence similarity 107, member A	regulation of cell growth	2.32E-02
PDGFRB	18596	platelet-derived growth factor receptor, beta polypeptide	kidney development, positive regulation of cell proliferation	4.45E-02
NPPC	18159	natriuretic peptide precursor C	potent natriuretic, diuretic, and vasodilating activities	1.84E-02
CGNL1	68178	cingulin-like 1	motor activity	3.73E-02
B4GALT1	14595	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1	type II membrane-bound glycoproteins, epithelial cell development	2.70E-03
MMRN2	105450	multimerin 2	extracellular matrix protein	7.88E-03
ATP7A	11977	ATPase, Cu2+ transporting, alpha polypeptide	copper transport across membranes, blood vessel development	3.17E-03
EMILIN3	280635	elastin microfibril interfacer 3	proteinaceous extracellular matrix	2.67E-02
SLC39A1	30791	solute carrier family 39 (zinc transporter), member 1	transmembrane transport	6.44E-03
PURB	19291	purine-rich element binding protein B	regulation of transcription	2.84E-02
SSH2	237860	slingshot homolog 2 (Drosophila)	actin cytoskeleton organization	6.46E-03
FNDC3B	72007	fibronectin type III domain containing 3B	positive regulation of fat cell differentiation	1.70E-02
KCNJ8	16523	potassium inwardly-rectifying channel, subfamily J, member 8	inward rectifier potassium channel activity, kidney development	6.80E-03
ZFP36L1	12192	zinc finger protein 36, C3H type-like 1	nuclear-transcribed mRNA catabolic process, vasculogenesis	2.50E-02
CDS2	110911	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2	hosphatidate cytidylyltransferase activity	5.74E-03
PBXIP1	229534	preB-cell leukemia homeobox interacting protein 1	transcription corepressor activity, cell differentiation	4.93E-02
PPP1R9A	243725	protein phosphatase 1, regulatory (inhibitor) subunit 9A	regulatory subunit of protein phosphatase I, controls actin cytoskeleton reorganization	1.60E-02
NID2	18074	nidogen 2 (osteonidogen)	cell-adhesion protein that binds collagens I and IV	1.08E-03
PKD1	18763	polycystic kidney disease 1 (autosomal dominant)	regulator of calcium permeable cation channels, calcium-independent cell-matrix adhesion	2.47E-02
SERTAD4	214791	SERTA domain containing 4	protein binding	4.78E-02
FBXO46	243867	F-box protein 46	protein binding	4.01E-02
SNX18	170625	sorting nexin 18	cell communication; protein transport	4.85E-02
PTPRF	19268	protein tyrosine phosphatase, receptor type, F	negative regulation of cytokine-mediated signaling pathway, cell adhesion	2.30E-02
SPCS2	66624	signal peptidase complex subunit 2 homolog (S. cerevisiae)	peptidase activity, signal peptide processing	2.67E-02
NES	18008	nestin	central nervous system development	5.50E-03
SESN1	140742	sestrin 1	response to DNA damage stimulus, cell cycle arrest; negative regulation of cell proliferation	3.94E-02

P < 0.05.

Table 3.

Downregulated genes in BdkrB2−/− relative to BdkrB2+/+ mice

Gene Symbol	Entrez ID	Entrez Gene Name	Molecular Function	P value
KDM5D	20592	lysine (K)-specific demethylase 5D	chromatin modification	6.52E-03
NUDT16	75686	nudix-type motif 16	RNA binding; hydrolase activity; metal binding	2.98E-02
LTA	16992	lymphotoxin alpha	cytokine produced by lymphocytes	4.75E-02
STARD13	243362	StAR-related lipid transfer (START) domain containing 13	GTPase activator activity, signal transduction	3.46E-02
RAPGEF5	217944	Rap guanine nucleotide exchange factor (GEF) 5	small GTPase mediated signal transduction	1.23E-05
CREG2	263764	cellular repressor of E1A-stimulated genes 2	N/A	1.27E-02
DDX23	74351	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	Embryogenesis and cellular growth and division	4.49E-02
NOP56	67134	NOP56 ribonucleoprotein homolog (yeast)	rRNA processing	3.51E-03
RPS13	68052	ribosomal protein S13	negative regulation of RNA splicing	3.53E-08
ADAM23	23792	ADAM metallopeptidase domain 23	metalloendopeptidase activity	1.27E-02
MSX2	17702	msh homeobox 2	DNA binding; transcription factor activity	3.43E-02
TPCN1	252972	two pore segment channel 1	voltage-gated ion channel activity	2.10E-02
BCAT2	12036	branched chain amino-acid transaminase 2, mitochondrial	Catalyzes production of the branched chain amino acids	2.26E-02
BSDC1	100383	BSD domain containing 1	protein binding	2.47E-02
GANC	76051	glucosidase, alpha; neutral C	carbohydrate metabolic process	4.98E-02
CHMP4B	75608	chromatin modifying protein 4B	interact with programmed cell death 6 interacting protein	1.37E-02
SCRIB	105782	scribbled homolog (Drosophila)	targeted to epithelial adherens junctions, cell polarization	4.89E-02
CLK1	12747	CDC-like kinase 1	governing splice site selection	4.09E-03
PABPN1	54196	poly(A) binding protein, nuclear 1	RNA processing; mRNA processing	3.11E-02
HOXD4	15436	homeobox D4	morphogenesis in all multicellular organisms	3.51E-03
TNKS2	74493	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	NAD+ ADP-ribosyltransferase activity, regulation of multicellular organism growth	1.66E-02
DNASE1L2	66705	deoxyribonuclease I-like 2	DNA binding; endonuclease activity	4.86E-02
RAF1	110157	v-raf-1 murine leukemia viral oncogene homolog 1	MAP kinase kinase kinase (MAP3K), control of gene expression involved in the cell division cycle, apoptosis, cell differentiation and cell migration.	1.70E-02
GAS5	14455	growth arrest-specific 5 (nonprotein coding)	N/A	2.64E-02
ZXDC	80292	ZXD family zinc finger C	positive regulation of transcription	2.09E-03
PNPLA6	50767	patatin-like phospholipase domain containing 6	deacetylates intracellular phosphatidylcholine	4.85E-02
BUB3	12237	budding uninhibited by benzimidazoles 3 homolog (yeast)	spindle checkpoint function, mitotic sister chromatid segregation, cell division	1.74E-02
MTHFSD	234814	methenyltetrahydrofolate synthetase domain containing	folic acid and derivative biosynthetic process	3.84E-02
CLK4	12750	CDC-like kinase 4	peptidyl-tyrosine phosphorylation	2.71E-02
LSM7	66094	LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)	nuclear mRNA splicing, via spliceosome	3.88E-02
RPL11	67025	ribosomal protein L11	RNA processing; translation; translational elongation	9.14E-03
NFATC2IP	18020	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein	cytokine production; regulation of transcription	4.45E-02
IDI1	319554	isopentenyl-diphosphate delta isomerase 1	cholesterol biosynthetic process	1.84E-02
C16ORF70	234678	chromosome 16 open reading frame 70	Golgi to plasma membrane protein transport	4.47E-02
GRWD1	101612	glutamate-rich WD repeat containing 1	role in ribosome biogenesis	1.25E-02
KCTD5	69259	potassium channel tetramerisation domain containing 5	voltage-gated potassium channel activity	1.89E-02
DDX51	69663	DEAD (Asp-Glu-Ala-Asp) box polypeptide 51	rRNA processing	3.85E-02
GTPBP3	70359	GTP binding protein 3 (mitochondrial)	tRNA modification	2.32E-02
PCSK7	18554	proprotein convertase subtilisin/kexin type 7	proprotein convertases, peptide hormone processing	4.06E-02
RNF168	70238	ring finger protein 168	double-strand break repair; response to ionizing radiation; chromatin modification; positive regulation of DNA repair; histone H2A K63-linked ubiquitination	1.27E-02
EDC3	353190	enhancer of mRNA decapping 3 homolog (S. cerevisiae)	associated with mRNA-decapping complex	2.58E-02
SNIP1	76793	Smad nuclear interacting protein 1	production of miRNAs involved in gene silencing	3.39E-02
DDX18	66942	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	alteration of RNA secondary structure	1.12E-04
NANS	94181	N-acetylneuraminic acid synthase	lipopolysaccharide biosynthetic process	3.73E-02
MED29	67224	mediator complex subunit 29	a multiprotein coactivator of RNA transcription	4.70E-03
SUPV3L1	338359	suppressor of var1, 3-like 1 (S. cerevisiae)	DNA duplex unwinding	1.53E-02
EXOSC7	66446	exosome component 7	3¢-5¢-exoribonuclease activity, RNA processing	2.47E-02
TRIM39	79263	tripartite motif-containing 39	protein binding; zinc ion binding, apoptosis	3.17E-02
DOCK5	68813	dedicator of cytokinesis 5	guanyl-nucleotide exchange factor activity	4.95E-02
DNAJC11	230935	DnaJ (Hsp40) homolog, subfamily C, member 11	heat shock protein binding	1.16E-02
TBP	21374	TATA box binding protein	Initiation of transcription, regulation of transcription	1.94E-02
MOXD1	59012	monooxygenase, DBH-like 1	monooxygenase activity, catecholamine metabolic process	1.02E-03
DIDO1	23856	death inducer-obliterator 1	transcription; apoptosis	4.06E-02
NUP43	69912	nucleoporin 43 kDa	Bidirectional transport of macromolecules	8.52E-04
KIAA1804	234878	mixed lineage kinase 4	protein phosphorylation, signal transduction	4.85E-02
RAD51AP1	19362	RAD51 associated protein 1	DNA recombination, DNA repair DNA binding	3.85E-02
HSPA14	50497	heat shock 70 kDa protein 14	ATP binding, nucleotide binding	3.99E-03
GPS1	1E +08	G protein pathway suppressor 1	catalyze deneddylation of proteins	2.47E-02
PRKAR2A	19087	protein kinase, cAMP-dependent, regulatory, type II, alpha	cAMP binding, cAMP-dependent protein kinase regulator activity	3.91E-02
GPKOW	209416	G patch domain and KOW motifs	ribosomal protein, nucleic acid binding	1.37E-02
TEX9	21778	testis expressed 9	testis-expressed sequence 9 protein	3.01E-02
GTPBP3	70359	GTP binding protein 3 (mitochondrial)	GTP catabolic process, tRNA modification	3.47E-02
ASNS	27053	asparagine synthetase (glutamine-hydrolyzing)	asparagine biosynthetic process, cellular amino acid biosynthetic process	1.65E-02
KLHDC4	234825	kelch domain containing 4	peptidease activity, hydrolysis of peptide bond	4.06E-02
MED22	20933	mediator complex subunit 22	regulation of transcription, DNA directed RNA polymerase	8.76E-03
CCDC117	104479	coiled-coil domain containing 117	chromosomal protein	4.13E-02
HDAC10	170787	histone deacetylase 10	chromatin modification, histone deacetylation	2.35E-03
POLR3C	74414	polymerase (RNA) III (DNA directed) polypeptide C (62kD)	innate immune response, positive regulation of innate immune response	1.98E-02
MTRF1L	108853	mitochondrial translational release factor 1-like	translation release factor activity	3.92E-02
RNF34	80751	ring finger protein 34	ligase activity, metal ion binding, apoptosis, metabolic proces	4.93E-04
UBP1	22221	upstream binding protein 1 (LBP-1a)	DNA binding, protein binding, angiogenesis, regulation of transcription	3.94E-02
BCCIP	66165	BRCA2 and CDKN1A interacting protein	kinase regulator activity, cell cycle, DNA repair	4.85E-02
LUC7L2	192196	LUC7-like 2 (S. cerevisiae)	enzyme binding, metal ion binding	1.89E-02
NOC4L	100608	nucleolar complex associated 4 homolog (S. cerevisiae)	nucleolus protein, formation of ribosome	8.76E-03
PPHLN1	223828	periphilin 1	keratinization	2.84E-03
EIF4A3	192170	eukaryotic translation initiation factor 4A3	ATP-dependent RNA helicase activity, negative regulation of translation	1.89E-02
NIF3L1	65102	NIF3 NGG1 interacting factor 3-like 1 (S. pombe)	transcription factor binding, positive regulation of transcription	4.89E-02
FASTKD5	380601	FAST kinase domains 5	protein kinase activity, apoptosis	4.45E-02
HAUS3	231123	HAUS augmin-like complex, subunit 3	cytoskeleton component, cell cycle, cell division	3.53E-05
PSEN1	19164	presenilin 1	beta-catenin binding, cadherin binding, activation of MAPKK activity	1.66E-03
PSMC1	19179	proteasome (prosome, macropain) 26S subunit, ATPase, 1	hydrolase activity, negative regulation of ubiquitin- protein ligase activity involved in mitotic cell cycle	4.06E-02
EXO1	26909	exonuclease 1	5′-3′ exodeoxyribonuclease activity, DNA recombination, DNA repair	2.99E-02
CBX2	12416	chromobox homolog 2	chromatin binding, DNA binding, chromatin assembly or disassembly, chromatin modification	4.75E-02
DIABLO	66593	diablo homolog (Drosophila)	activation of caspase activity, apoptosis	4.42E-02
EBNA1BP2	69072	EBNA1 binding protein 2	chromosome segregation, ribosome biogenesis	1.25E-02
FDPS	110196	farnesyl diphosphate synthase	dimethylallyltranstransferase activity, cholesterol biosynthetic proces	3.00E-02
METTL2B	52686	methyltransferase like 2B	methyltransferase activity, metabolic process, methylation	2.45E-02
PPP1R1A	58200	protein phosphatase 1, regulatory (inhibitor) subunit 1A	phosphoprotein phosphatase inhibitor activity, carbohydrate metabolic process	4.85E-02
SREBF2	20788	sterol regulatory element binding transcription factor 2	chromatin binding, DNA binding, cholesterol metabolic process	2.10E-02
RBM4	19653	RNA binding motif protein 4	mRNA 3′-UTR binding, circadian regulation of gene expression	1.94E-02
RPP38	227522	ribonuclease P/MRP 38 kDa subunit	hydrolase activity, ribonuclease P activity, tRNA processing	2.47E-02
USP38	74841	ubiquitin specific peptidase 38	Process ubiquitin-dependent protein catabolic process	4.95E-02
TUBG1	103733	tubulin, gamma 1	GTPase activity, microtubule nucleation	3.99E-03
MAX	17187	MYC associated factor X	negative regulation of gene expression, protein complex assembly	2.22E-02
DGAT1	13350	diacylglycerol O-acyltransferase 1	acyltransferase activity, glycerolipid metabolic process	3.99E-03
POLR2G	67710	polymerase (RNA) II (DNA directed) polypeptide G	DNA-directed RNA polymerase activity, RNA splicing, transcription	3.47E-02
EIF3B	27979	eukaryotic translation initiation factor 3, subunit B	nucleic acid binding, regulation of translational initiation	4.77E-02
SC4MOL	66234	sterol-C4-methyl oxidase-like	C-4 methylsterol oxidase activity, iron ion binding, fatty acid biosynthetic process	4.95E-02
GLRX3	30926	glutaredoxin 3	electron carrier activity, iron-sulfur cluster binding, cell redox homeostasis	3.01E-04
TNFRSF19	29820	tumor necrosis factor receptor superfamily, member 19	receptor activity, positive regulation of I-kappaB kinase/NF-kappaB cascade	4.85E-02
DOHH	1E +05	deoxyhypusine hydroxylase/monooxygenase	oxidation-reduction process, peptidyl-lysine modification to hypusine	5.49E-03

P < 0.05.

Fig. 4.

Quantitative RT-PCR validation of differentially expressed genes in the microarray. *P < 0.05.

Gestational salt stress suppresses epithelial Pax2 expression in BdkrB2^−/− mice.

In silico analysis revealed that ∼12% of the altered genes in salt-stressed BdkrB2^−/− embryonic kidneys (28 genes upregulated and 13 genes downregulated) harbor putative Pax2-binding sites in their promoter region (within −1 kb of the transcription start site) (Tables 4 and 5). Since Pax2-target genes in the E14.5 developing kidney are not known, it is not possible to discern if any of these genes are Pax2-regulated genes. Quantitative real-time RT-PCR performed on the renal medulla harvested from P1 salt-stressed Bdkrb2^+/+ and Bdkrb2^−/− kidneys validated expression changes of some genes (but not all). For example, we validated upregulation of Gpcr5d (+1.26 ± 0.10 fold vs. wild type, n = 5/group, P < 0.05) but failed to detect a statistically significant differential expression in Myh11, while there was tendency toward differential expression in Actg2 (+2.96 ± 1.15 P = 0.12). Although differential expression of Pax2 was not evident in the microarray, there was a significant yet modest (20%) reduction in Pax2 mRNA levels in mutants as compared wild-type mice (Fig. 5A). QPCR is more sensitive than hybridization-based technologies such as microarrays, which may explain why differential expression of Pax2 was not picked up by the microarray. Double immunofluorescence for Pax2 and the water channel AQP-2 confirmed the downregulation of Pax2 protein in collecting ducts of Bdkrb2 mice (Fig. 5B). Notably, downregulation of Pax2 is only observed in salt-stressed Bdkrb2 mutants indicating that Pax2 is responsive to gene-environment interactions and not to salt or gene mutations alone.

Table 4.

Upregulated genes in BdkrB2−/− with Pax2 binding sites

Gene Symbol	Entrez ID	Entrez Name	Molecular Function	Expression in Kidney	Start Position	End Position	Inspecting Sequence ID
Myh8	17885	myosin, heavy chain 8	motor activity, constituent of muscle	trunk mesenchyme	579	591	GXP_92669
Nrxn1	18189	neurexin 1	cell adhesion; axon guidance	trunk mesenchyme	60	72	GXP_185470
Actg2	11468	actin, gamma 2, smooth muscle, enteric	muscle contraction	ureter	240	252	GXP_303411
Myh11	17880	myosin, heavy chain 11, smooth muscle	muscle contraction	vasculature, pelvis, ureter	238	250	GXP_18305
Gprc5d	93746	G protein-coupled receptor, family C, group 5, member D	G protein-coupled receptor activity	N/A	449	461	GXP_2537517
Ahnak	66395	AHNAK nucleoprotein	nervous system development	ureteric tip and trunk, interstitium, vasculature	341	353	GXP_304725
Ccbp2	59289	chemokine binding protein 2	chemokine receptor activity	kidney	402	414	GXP_1805682
Col6a3	12835	collagen, type VI, alpha 3	cell adhesion; muscle organ development	diffused in metanephros	652	664	GXP_1457863
Adamts5	23794	ADAM metallopeptidase with thrombospondin type 1 motif, 5	metalloendopeptidase activity, integrin binding, proteolysis	urogenital sinus, primitive bladder	468	480	GXP_1239277
Sema5a	20356	sema domain, seven thrombospondin repeats	cell adhesion; cell-cell signaling; multicellular organismal development	ureteric tree and tips, vasculature, interstitium, mesenchyme, nephrons	1098	1110	GXP_89931
Col1a2	12843	collagen, type I, alpha 2	extracellular matrix structural constituent	renal vasculature	55	67	GXP_821204
Cav1	12389	caveolin 1, caveolae protein	regulator of the Ras-p42/44 mitogen-activated kinase cascade	trunk mesenchyme	32	44	GXP_150594
Rb1	19645	retinoblastoma 1	Cell cycle progression, apoptosis, proliferation regulator	kidney	546	558	GXP_1793835
Itpr1	16438	inositol 1,4,5-triphosphate receptor, type 1	response to hypoxia, calcium ion transport, ion channel activity	renal vasculature	537	549	GXP_105230
Thbs1	21825	thrombospondin 1	adhesive glycoprotein, cell-to-cell and cell-to-matrix interactions	metanephros, late tubules	410	422	GXP_1459831
Tns1	21961	tensin 1	focal adhesions, cell attaches to the extracellular matrix	proximal and distal tubule, medullary collecting duct	232	244	GXP_2220687
Manba	110173	mannosidase, beta A, lysosomal	hydrolase activity, glycoprotein catabolic process	N/A	256	268	GXP_1799746
Figf	14205	c-fos induced growth factor	PDGF/VEGF family, active in angiogenesis	metanephros	189	201	GXP_1471435
Spnb2	20742	spectrin beta 2	actin binding, calmodulin binding	trunk mesenchyme	551	563	GXP_118730
Zfp26	22688	Mus musculus zinc finger protein 26	DNA binding, metal ion binding, transcription factor, glial development	mesenchyme, ureteric tip and trunk, interstitium, tubules and vasculature	163	175	GXP_826162
Dmd	13405	dystrophin	dystrophin-glycoprotein complex, muscle organ development; skeletal muscle tissue development	metanephros	338	350	GXP_1470974
Icam1	15894	intercellular adhesion molecule 1	receptor activity, integrin binding	N/A	234	246	GXP_445321
Mll5	69188	myeloid/lymphoid or mixed-lineage leukemia 5	Histone methyltransferase, dimethylates 'Lys-4¢ of histone H3, myeloid differentiation	cap mesenchyme, interstitium, pelvic smooth muscle	494	506	GXP_239498
Rbms3	207181	RNA binding motif, single stranded interacting protein 3	DNA replication, gene transcription, cell cycle progression and apoptosis	N/A	267	279	GXP_229583
Nppc	18159	natriuretic peptide precursor C	vasodilating activities, body fluid homeostasis, blood pressure control	N/A	218	230	GXP_288775
Atp7a	11977	ATPase, Cu++ transporting, alpha polypeptide	blood vessel development; blood vessel remodeling	N/A	590	602	GXP_187
Fndc3b	72007	fibronectin type III domain containing 3B	positive regulation of fat cell differentiation	N/A	168	180	GXP_82518
Nes	18008	nestin	neural tube intermediate filamen	drainage component	198	210	GXP_1455614

Table 5.

Downregulated genes in BdkrB2−/− with Pax2 binding sites

Gene symbol	Entrez ID	Entrez Name	Molecular Function	Expression in Kidney	Start Position	End Position	Inspecting Sequence ID
Lta	16992	lymphotoxin alpha (TNF superfamily, member 1)	tumor necrosis factor, formation of secondary lymphoid organs, apoptosis	N/A	325	337	GXP_81886
Stard13	243362	StAR-related lipid transfer (START) domain containing 13	GTPase activator activity,	N/A	148	160	GXP_1801980
Rapgef5	217944	Rap guanine nucleotide exchange factor (GEF) 5	members of the RAS subfamily of GTPases function in signal transduction	N/A	158	170	GXP_413710
Adam23	23792	ADAM metallopeptidase domain 23	proteolysis; cell adhesion; central nervous system development	N/A	557	569	GXP_132501
D4Wsu53e	27981	DNA segment, Chr 4	tagging genes with cassette-exchange sites	N/A	170	182	GXP_287874
Ganc	76051	glucosidase, alpha; neutral C	carbohydrate metabolic process, hydrolase enzymes hydrolyse the glycosidic bond between two or more carbohydrates	N/A	723	735	GXP_2532326
Raf1	110157	v-raf-1 murine leukemia viral oncogene homolog 1	MAP kinase kinase kinase, cell division cycle, apoptosis, cell differentiation and cell migration.	cap mesenchyme	475	487	GXP_2537320
Clk4	12750	CDC-like kinase 4	CDC2-like protein kinase (CLK) family, regulation of alternative splicing	kidney	605	617	GXP_409562
Igh-6	16019	2 days neonate thymus thymic cells cDNA	immunoglobulin heavy chain 6, antigen binding	N/A	88	100	GXP_1236446
Supv3l1	338359	suppressor of var1, 3-like 1	DNA binding; DNA helicase activity, DNA duplex unwinding	kidney	301	313	GXP_115349
Zfp108	54678	Zinc finger protein 108	Interacting selectively and noncovalently with any metal ion	N/A	409	421	GXP_1466602
Tex9	21778	testis expressed 9	expressed in adult mouse testes	kidney	182	194	GXP_276197
Ubp1	22221	upstream binding protein 1	transcription factor activity, angiogenesis	ureter	169	181	GXP_712

Gene list was generated by Genomatix Program with zero mismatches. The start position and end position of binding are relative to the inspecting sequence of Genomatix Program. Some of the genes in the list may have more than one binding sites; only one binding site is presented.

Fig. 5.

Pax2 mRNA and protein are suppressed in the medulla of salt-stressed Bdkrb2^−/− mice. A: RNA was isolated from the medulla of P1 salt-stressed BdkrB2^+/+ and Bdkrb2^−/− kidneys. Pax2 and GAPDH mRNA were measured by real-time quantitative RT-PCR for the genes indicated. B: immunofluorescence staining of Pax2 in P1 kidney sections from postnatal day (P) 1 Bdkrb2^+/+ and Bdkrb2^−/− pups subjected to gestational high salt. AQP2 staining was used to mark the collecting ducts.

Gestational salt stress represses Pax2-driven reporter expression in mutant but not in wild-type mice.

To determine whether the reduction in Pax2 expression is mediated transcriptionally and is sensitive to gestational gene-environment interactions, we monitored GFP fluorescence as a surrogate of Pax2 promoter activity in vivo in salt-stressed Pax2-GFP;Bdkrb2^−/− mice. At E12.5 and E14.5, GFP reporter activity was detected in the UB and its branches and in the metanephric mesenchyme, thus mimicking endogenous Pax2 gene expression. This expression pattern is similar in both genotypes, i.e., Bdkrb2^+/+ and BdkrB2^−/− embryos. However, GFP fluorescence is markedly lower in Bdkrb2^−/− than Bdkrb2^+/+ kidneys (Fig. 6, A and C). Quantitative real-time RT-PCR demonstrated that GFP mRNA is significantly lower in mutant than wild-type kidneys at E12.5 and E14.5 (Fig. 6, B and D).

Fig. 6.

Pax2 promoter-driven reporter activity is reduced in salt-stressed Bdkrb2^−/− metanephroi. A, C: E12.5 and E14.5 metanephroi were harvested from genetic crosses of Bdkrb2^−/−;Pax2-GFP mice subjected to gestational high salt. Photographs of GFP fluorescence (a surrogate of Pax2 promoter activity) were captured at the time of harvest. GFP fluorescence is visibly lower in Bdkrb2^−/− than Bdkrb2^+/+ metanephroi. B, D: GFP mRNA was measured by real-time quantitative RT-PCR in E12.5 and E14.5 Bdkrb2^−/− and Bdkrb2^+/+ metanephroi (n = 4–5/group).

Removal of the salt stressor fails to restore Pax2 reporter activity in ex vivo cultured BdkrB2 mutant explants.

To determine whether Pax2 gene repression is reversible upon removal of the intrauterine stress, salt-stressed E12.5 Pax2-GFP;Bdkrb2^−/−, Bdkrb2^+/−, and Bdkrb2^+/+ metanephroi were grown in culture for 2 days, and the intensity of GFP recorded over time. As noted in Fig. 7A, at 0 h, GFP fluorescence intensity is higher in wild-type and heterozygous than mutant kidneys. More importantly, over the ensuing 48 h, although growth in size is observed in the three genotypes, GFP intensity remains low in the homozygous null mutants compared with wild-type and heterozygous kidneys. Measurement of GFP pixel intensity, shown in Fig. 7B, confirms that at E12.5, GFP fluorescence intensity is significantly lower in both heterozygous and homozygous Bdkrb2 mutants than wild-type controls.

Fig. 7.

Ex vivo culture of salt-stressed Bdkrb2^−/− metanephroi. A: E12.5 metanephroi were harvested from Pax2-GFP;Bdkrb2^+/+, Pax2-GFP;Bdkrb2^+/−, and Pax2-GFP;Bdkrb2^−/− littermates and grown in culture (n = 12–18/group). The intensity of GFP fluorescence, a surrogate of Pax2 promoter activity and expression, was recorded at times 0, 24, and 48 h. Bdkrb2^−/− metanephroi are smaller than the heterozygous and homozygous null mutants and maintain lower GFP fluorescence intensity ex vivo. B: quantitative measurement of GFP fluorescence reveals that although GFP pixel intensity increases in all groups during 24–48 h in the absence of the intrauterine salt stressor, the reduction in GFP intensity remains significantly lower in the Bdkrb2^−/− metanephroi.

DISCUSSION

We reported previously that BdkrB2^−/− mice are predisposed to renal dysgenesis in the presence of embryonic salt stress (14, 17). This mouse model of a human disease offers a unique opportunity to uncover the genetic and epigenetic mechanisms underlying gene-environment interactions in congenital renal disease. The present study demonstrates that BdkrB2 mutant kidneys from salt-stressed embryos manifest gene expression changes involving transcription factors, Wnt, cell survival, and cell-matrix pathways. Moreover, we found that Pax2 gene expression is repressed in collecting ducts of salt-stressed Bdkrb2^−/− embryos. Lastly, utilizing genetic crosses between Bdkrb2^−/− mice and BAC transgenic mice carrying a Pax2-GFP reporter cassette, we show that Pax2 transcriptional activity is repressed in salt-stressed Bdkrb2^−/− embryonic kidneys. To our knowledge, this is the first demonstration of a renal developmental regulator that is sensitive to gene-environment interactions.

Clinical studies have demonstrated that mutations in genes encoding renal developmental regulators account for a relatively small fraction of congenital abnormalities in renal and urinary tract development (22, 36). Examples of these genes include Pax2, Eya1, Six1, Sall1, HNF1β, Ret, Robo, WT1, and Notch. The etiology of the remaining cases is unknown, but it is possible that mutations in other developmental genes will be identified in the future. It is also conceivable that gestational exposure to environmental factors (e.g., drugs, toxins) or gene-environment interactions account for a significant proportion of sporadic renal dysgenesis.

The gene-environment interaction model implies that an inherited germline mutation is phenotypically silent, presumably because it is compensated for by genes with overlapping functions. The homeostatic function of the mutant gene is revealed following exposure to a stressor that overwhelms the capacity of compensatory mechanisms. An example of genetic susceptibility is a patient with a bleeding disorder who is asymptomatic but bleeds when exposed to a stressor that impairs hemostasis, such as an antiplatelet drug or physical trauma. In our animal model, renal dysgenesis is produced by defined gene-environment interactions (13, 14). Mice harboring a homozygous deletion of the Bdkrb2 are developmentally normal and fertile. However, Bdkrb2^−/− embryos exposed to gestational salt stress via the maternal diet develop renal dysgenesis due to impaired collecting duct growth and differentiation (12, 14, 17, 19). Interestingly, adult Bdkrb2 mutants develop hypertension if fed a high-salt diet (1, 8, 25).

The combination of Bdkrb2 inactivation and embryonic salt stress results in transcriptional activation of proapoptotic and repression of terminal differentiation genes (17, 19). Germline deletion of p53 from the genome of Bdkrb2^−/− mice protects against apoptosis (19). Since p53 is sensor and a hub for multiple intracellular pathways (15, 16, 40), it was important to determine the cellular and molecular pathways that are altered at the onset of renal dysgenesis. Our microarray analysis revealed that while apoptosis is one of the top 10 pathways that are altered in mutant kidneys, other important pathways included Wnt signaling, calcium signaling, extracellular matrix organization, and cell communication. The following discussion focuses on the major genetic networks downstream of gene-environment interactions and how they might affect kidney development.

Intracellular calcium signaling.

Several gene products involved in intracellular calcium removal (ATP2B2, decreased), sarcoplasmic calcium release (ryanodine receptor RYR1, increased), or calcium entry/release into the cell (bradykinin receptor type 1 BdkrB1, increased) suggest that salt-stressed BdkrB2^−/− cells accumulate excess intracellular calcium. The latter effect may have significant effects on membrane protein function, cell shape and mobility, gene expression, and activation of apoptosis (33).

Extracellular matrix metabolism.

Enhanced expression of fibulin 5 (Fbln5), a secreted extracellular matrix protein, and lysyl oxidase (Lox), which catalyzes cross-linking of collagen fibers, is observed in dysplastic BdkrB2^−/− kidneys, which manifest expanded interstitium. Mutations in Fbln5 and Lox are implicated in various vasculopathies and inherited musculoskeletal disorders.

Regulation of cellular communication and signaling.

Several key cell membrane-associated or cell surface protein-encoding genes, e.g., small G protein binding and Rho-dependent signaling (ARHGEF1), cell-matrix signaling (integrin B3, ITGB3), and ephrin B2 (EPHB2) are downregulated, whereas genes involved in TGF-β (activin A type 1B receptor, ACVR1B) and NF-κB (IKBKG) signaling are upregulated. This imbalance may contribute to cellular injury in the dysplastic BdkrB2 null kidneys.

Pattern specification process.

Several Homeobox genes (HoxB4, HoxC8, HoxA6, and HoxD11) are downregulated in salt-stressed BdkrB2 mutant kidneys. Hox genes are known to play a key role in anterio-posterior axis specification (26), and within the kidney they may play a role in defining the segmental specification of the nephron (29, 44). Hoxd11 paralogs and Pbx2 genes are expressed in the kidney and their mutations cause renal dysgenesis.

Wnt receptor signaling.

Both canonical and noncanonical Wnts play important roles in kidney development (39). BdkrB2^−/− exhibit reduced expression of Wnt6, Dvl2, and Axin1 and upregulation of the soluble receptor for Wnt, Sfrp4, suggesting impaired Wnt signaling.

Apoptosis.

Enhanced cell death is a prominent feature in BdkrB2^−/− mutant kidneys (19). This is partly mediated by p53 activation via Chk1-mediated serine 23 phosphorylation. Indeed, multiple proapoptotic genes in the tumor necrosis factor pathway (TNFRSF21, LTA, EIF5A), caspase 12, and mitochondrial membrane protein Mtch1 are dysregulated in BdkrB2 null kidneys.

Downregulation of Pax2.

The present study demonstrates reduced Pax2 protein and mRNA abundance in embryonic and newborn kidneys of salt-stressed Bdkrb2^−/− mice and reduced reporter (GFP) expression in kidneys of Bdkrb2^−/− mice carrying a BAC Pax2-GFP transgene. Pax2 is a transcription factor that is highly expressed in proliferating epithelial progenitors and is rapidly downregulated during terminal differentiation (2, 11, 41). Pax2 plays multiple and sequential roles in renal development, including specification of the metanephric blastema, and survival and differentiation of nephron progenitors and collecting ducts (5, 6, 9, 11, 27, 34, 42). Deregulated expression of Pax2 results in cystic kidneys (10, 28), whereas Pax2 gene dosage reduction causes renal hypoplasia in humans and mice (31, 32, 37). Based on these data, we suggest that reduced Pax2 activity in salt-stressed BdkrB2^−/− mice is an important contributing factor in the pathogenesis of the renal phenotype. Interestingly, allowing metanephric growth ex vivo failed to normalize Pax2 reporter activity, suggesting that the Pax2 promoter retains a repressive memory even after removal of the embryonic stressor or that a longer period outside the intrauterine environment may be necessary to reverse the repression. Epigenetic therapy that favors a permissive chromatin environment (e.g., HDAC or Dnmt inhibitors) may be of therapeutic benefit.

In summary, the present study demonstrates that gestational gene-environment interactions alter the metanephric transcriptome prior to the onset of the renal phenotype. Moreover, the Pax2 gene is sensitive to gestational gene-environment interactions.

GRANTS

This work was supported by National Institutes of Health Grants DK-56264 and Center Of Biomedical Research Excellence 1P20 RR-017659.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).

AUTHOR CONTRIBUTIONS

Author contributions: L.Y., X.Y., and D.B. performed experiments; L.Y., D.B., Z.S., and S.S.E.-D. analyzed data; L.Y., D.B., Z.S., and S.S.E.-D. interpreted results of experiments; L.Y. prepared figures; L.Y. drafted manuscript; L.Y., X.Y., D.B., Z.S., and S.S.E.-D. approved final version of manuscript; Z.S. and S.S.E.-D. edited and revised manuscript; S.S.E.-D. conception and design of research.