Skip to main content
Physiological Genomics logoLink to Physiological Genomics
. 2014 Jul 8;46(17):655–670. doi: 10.1152/physiolgenomics.00035.2014

Genome-wide analysis of gestational gene-environment interactions in the developing kidney

Lei Yan 1, Xiao Yao 1, Dimcho Bachvarov 2, Zubaida Saifudeen 1, Samir S El-Dahr 1,✉
PMCID: PMC4154247  PMID: 25005792

Abstract

The G protein-coupled bradykinin B2 receptor (Bdkrb2) plays an important role in regulation of blood pressure under conditions of excess salt intake. Our previous work has shown that Bdkrb2 also plays a developmental role since Bdkrb2−/− embryos, but not their wild-type or heterozygous littermates, are prone to renal dysgenesis in response to gestational high salt intake. Although impaired terminal differentiation and apoptosis are consistent findings in the Bdkrb2−/− mutant kidneys, the developmental pathways downstream of gene-environment interactions leading to the renal phenotype remain unknown. Here, we performed genome-wide transcriptional profiling on embryonic kidneys from salt-stressed Bdkrb2+/+ and Bdkrb2−/− embryos. The results reveal significant alterations in key pathways regulating Wnt signaling, apoptosis, embryonic development, and cell-matrix interactions. In silico analysis reveal that nearly 12% of differentially regulated genes harbor one or more Pax2 DNA-binding sites in their promoter region. Further analysis shows that metanephric kidneys of salt-stressed Bdkrb2−/− have a significant downregulation of Pax2 gene expression. This was corroborated in Bdkrb2−/−;Pax2GFP+/tg mice, demonstrating that Pax2 transcriptional activity is significantly repressed by gestational salt-Bdkrb2 interactions. We conclude that gestational gene (Bdkrb2) and environment (salt) interactions cooperate to impact gene expression programs in the developing kidney. Suppression of Pax2 likely contributes to the defects in epithelial survival, growth, and differentiation in salt-stressed BdkrB2−/− mice.

Keywords: kidney development, bradykinin receptor-knockout mice, paired box transcription factor-2, gestational salt intake, microarray


congenital abnormalities of the kidney and urinary tract are the major cause of end-stage renal disease in infants and children younger than 4 yr of age (38). Depending on the study, genetic analysis has demonstrated that monogenic mutations account for 1.9–30% of cases of human renal dysgenesis (22, 36, 43, 47). These mutations usually involve key transcription factors (e.g., PAX2, EYA1, SALL1, HNF1β, WT1, HOXA11), secreted factors, extracellular matrix proteins, and receptor molecules (e.g., c-RET). Despite these advances, the etiology of the majority of cases of renal dysgenesis remains unknown. In this regard, environmental factors, such as vitamin A deficiency, gestational exposure to aminoglycosides, or nutritional protein deficiency, have been implicated (3, 7, 24, 45, 46). Another important cause of developmental defects is gene-environment interactions. In this case, neither the gene mutation nor the environmental stressor is capable of inducing a phenotypic change by itself; rather, a silent mutation requires an environmental stressor to reveal the abnormal phenotype. The cellular and molecular mechanism(s) by which gene-environment interactions induce organ dysgenesis and dysfunction are largely unknown, although DNA damage and epigenetic factors have been implicated (23).

In previous studies, we reported that mice lacking the G protein-coupled bradykinin B2 receptor gene (Bdkrb2) are prone to renal dysgenesis if exposed to gestational high salt via the maternal diet (13, 14). Importantly, neither Bdkrb2 gene disruption nor gestational salt stress alone is sufficient to cause renal dysgenesis, and both factors must interact to initiate metanephric apoptosis and impaired terminal epithelial cell differentiation (17, 21). The onset of renal dysgenesis is preceded by phosphorylation of the transcription factor p53 on serine 23 (Ser20 in human p53) by the checkpoint kinase 1 (Chk1) (17). In the presence of salt stress, P-Ser23-p53 activates promoters of proapoptotic genes (e.g., Bax), while repressing terminal differentiation genes (e.g., tubular transporters, cell adhesion molecules, and transcriptional regulators such as HNF1β) (17, 19). Germline deletion of p53 or Bax genes partially rescues the abnormal renal phenotype in salt-stressed Bdkrb2−/− mice (19). Similarly, germline (knock-in) substitution of Ser23 by Ala23 in p53 prevents the development of renal dysgenesis in salt-stressed Bdkrb2-null mutants (12).

The present study was designed to examine the effects of fetal salt-Bdkrb2 interactions on the overall gene expression profile of the midgestation developing kidney. The results reveal a wide-ranging effect on key cellular pathways such as Wnt signaling, calcium signaling, apoptosis, and patterning. Moreover, our studies uncover an important effect of fetal salt-Bdkrb2 interactions on Pax2 gene expression, a key transcriptional regulator of renal growth and differentiation.

MATERIALS AND METHODS

Animals.

All animal protocols utilized in this study were approved by and in strict adherence to guidelines established by the Tulane University Institutional Animal Care and Use Committee. Mice with disruption of the entire protein-coding region (exon 3) of Bdkrb2 bred on C57bl6 background have been described (4, 14). Pax2(GFP) BAC transgenic mice (Pax2gfp/+) carrying 30 kb of Pax2 genomic upstream regulatory sequences driving a GFP cassette were generously provided by the laboratory of Maxime Bouchard (30). These mice express the reporter faithfully mimicking the spatiotemporal developmental expression of endogenous Pax2. Bdkrb2+/−;Pax2-GFP+ were back-crossed to Bdkrb2−/− or Bdkrb2+/− mice, and pregnant mice were placed on 5% NaCl diet for the duration of pregnancy or until surgical dissection, as described (8, 14). Genotyping was performed by PCR of genomic DNA. Bdkrb2 wild-type and mutant alleles were amplified with the following primers: 435: GGTCCTGAACACCAACATGG, 434: TGTCCTCAGCGTGTTCTTCC, and 014: AGGTGAGATGACAGGAGATC, and 013: CTTGGGTGGAGAGGCTATTC; and GFP: forward ACTGGTGTGAGAGGCGGGTTCTT, reverse GCTGGCGAAAGGGGGATGTGCTG.

RNA extraction and RT-PCR.

Total RNA was isolated with the RNeasy Mini Kit (QIAGEN, Valencia, CA). Quantitative Real Time PCR assays were performed with the 1-Step Brilliant QRT-PCR Master Mix Kit (Stratagene) containing 100 nM forward primer, 100 nM reverse primer, and 20 ng total RNA. Relative mRNA levels were normalized to GAPDH. The following real-time primers were purchased from Applied Biosystems: GFP transgene forward: CCACATGAAGCAGCAGGACTT and GFP transgene reverse: GGTGCGCTCCTGGACGTA, and probe TTCAAGTCCGCCATGCCCGAA labeled on the 5′- and 3′-ends with 6-FAM and TAMRA, respectively; PAX2 TaqMan primer set Mm01217933mH; GAPDH TaqMan Rodent primer set number Mm4308313.

Microarray.

Heterozygous pairings were done to obtain Bdkrb2+/+ and Bdkrb2−/− litter-matched kidneys. RNA (500 ng) was obtained from each of three pairs of Bdkrb2+/+ and Bdkrb2+/+ embryonic day (E) 14.5 kidneys, amplified, and labeled, and the cDNA was hybridized to Agilent 4X44K Whole Mouse Genome Microarray slide from Agilent Technologies. To prevent bias from signaling detection on different colors (Cy5 red, Cy3 green), we applied dye-swap strategy to this experiment, in which identical pairs of Bdkrb2+/+ and Bdkrb2−/− cDNA samples were reversely labeled by Cy5 and Cy3 into two groups. Raw data were processed by GeneSpring software. Only genes showing a significant (P < 0.05) differential change in expression after Benjamini and Hochberg false discovery rate (FDR) correction in the three datasets were used for further analyses. The microarray results were deposited in the National Center for Biotechnology Information database; the Gene Expression Omnibus number is GSE26681.

Quantitative real-time PCR.

Validation of microarray data was done by RT-PCR on RNA from E14.5 Bdkrb2+/+ and Bdkrb2−/− kidneys. Exon-spanning primer-probes for TaqMan gene expression assay from Applied Biosystems were utilized. Reactions were prepared by TaqMan RNA-to-CT 1-Step Kit and amplified by Stratagene Mx3000P and Mx3005P. Expression was normalized against endogenous GAPDH mRNA levels. Experimental and biological triplicates were applied.

Metanephric organ culture.

Embryonic kidneys were aseptically microdissected from timed-pregnant mice at E12.5 and were cultured for the times indicated on polycarbonate Transwell filters (0.4 μm pore size; Corning Costar, Acton, MA) over medium (DMEM/F12 medium + 10% FBS) at 37°C and 5% CO2, as described (35).

Immunofluorescence staining.

Postnatal day (P) 1 and E14.5 kidneys were fixed in 10% formalin and processed for paraffin embedding and sectioning. Antibodies for the following proteins were used: Pax2 (1:200, Invitrogen), LTA (1:100, Vector Laboratories), AQP-2 (1:500, SC-9882; Santa Cruz Biotechnology, Santa Cruz, CA), and Cytokeratin (1:200, Sigma).

The spatiotemporal expression pattern of the Pax2-GFP transgene was recorded and analyzed by GFP Fluorescent Microscopy during 48 h ex vivo organ culture. Images were acquired at the same exposure with Slidebook 4 (Intelligent imaging innovations, Denver, CO) operating an Olympus Spinning Disc microscope fitted with a Hamamatsu CCD. Sum pixel intensity was measured with the “mask segment” function of Slidebook 4. The same mask parameters were assigned to all images. Relative GFP fluorescence pixel intensity mask data were then exported and subjected to statistical analysis by t-test or ANOVA.

RESULTS

BdkrB2-regulated transcriptome in the developing kidney.

We previously reported that gestational salt stress of BdkrB2-null mice causes renal dysgenesis in the homozygous but not heterozygous or wild-type littermates (12, 14, 17, 19). To identify differentially expressed genes in BdkrB2-null kidneys that might be responsible for the phenotype, we performed gene expression microarray on E14.5 BdkrB2+/+ and BdkrB2−/− litter-matched kidneys. We chose E14.5 embryonic age because the renal phenotype becomes histologically evident between E15.5 and E16.5 (14, 17, 19). By two-color dye-swap strategy, the microarrays (44,000 probes) detected 348 unique genes with significant changes in gene expression (>1.5-fold change, P < 0.05) (Fig. 1). Of these, 158 transcripts were upregulated, and 190 transcripts were downregulated.

Fig. 1.

Fig. 1.

A scatterplot depicting the distribution of significantly altered genes between gestational salt-stressed Bdkrb2−/− and Bdkrb2+/+ kidneys at embryonic day (E) 14.5. Red, upregulated; yellow, unaltered; green, downregulated (P < 0.05, >1.5-fold).

Gene Ontology (GO) functional annotation of differentially expressed genes in wild-type and BdkrB2 mutants revealed that the top functional categories comprise regulation of calcium transport, extracellular structure/matrix organization, cell communication, Wnt receptor signaling, pattern specification, apoptosis, embryonic development, and anatomical structure morphogenesis (Fig. 2). Further functional categorization revealed that the upregulated genes in BdkrB2 mutants play integral roles in cell adhesion, transcriptional regulation, muscle development, and cell proliferation and fate (Fig. 3A). Downregulated genes clustered in pathways pertaining to DNA, RNA and protein metabolism, transcriptional regulation, cell proliferation/fate, and chromatin modification (Fig. 3B). Table 1 lists a subset of differentially expressed transcripts with known expression pattern in the developing kidney based on the GUDMAP database. Interestingly, several transcription factors (e.g., Homeobox genes, GATA6, and RXR) and Wnt6 are among the downregulated genes in the mutant kidneys. A more complete list of significantly upregulated and downregulated genes is presented in Tables 2 and 3. Quantitative RT-PCR confirmed the directional changes in five randomly selected genes, as well as in Dvl2 and Hoxb4 (Fig. 4, A–G).

Fig. 2.

Fig. 2.

Gene ontology analysis of differentially regulated genes in E14.5 Bdkrb2−/− kidneys.

Fig. 3.

Fig. 3.

Functional categorization of upregulated (A) and downregulated (B) genes in gestational salt-stressed BdkrB2 mutant kidneys.

Table 1.

Selected differentially expressed transcripts with proven expression in GUDMAP database

Probe Set ID Gene Title Gene Symbol Fold Change P Value
A_51_P402391 activin A receptor, type 1B Acvr1b 2.47 0.00598
A_51_P286301 bradykinin receptor, beta 1 Bdkrb1 2.30 0.0197
A_51_P149469 actin, alpha, cardiac muscle 1 Actc1 1.99 0.0232
A_51_P457196 secreted frizzled-related protein 4 Sfrp4 1.64 0.0204
A_51_P116651 dermatopontin Dpt 1.59 0.0362
A_52_P480351 lysyl oxidase Lox 1.56 0.0163
A_51_P487518 caspase 12 Casp12 1.52 0.0113
A_52_P299915 mitogen-activated protein kinase kinase 6 Map2k6 1.52 0.005
A_51_P176365 GTPase, IMAP family member 5 Gimap5 1.52 0.0336
A_52_P451073 tumor necrosis factor receptor superfamily, member 21 Tnfrsf21 1.50 0.000329
A_52_P315155 Eph receptor B2 Ephb2 −1.50 0.0488
A_52_P415155 wingless-related MMTV integration site 6 Wnt6 −1.50 0.00602
A_52_P349939 enolase 1, alpha nonneuron Eno1 −1.50 0.0371
A_52_P285992 ADP-ribosylation factor GTPase activating protein 2 Zfp289 −1.51 0.034
A_51_P246471 pre-B cell leukemia transcription factor 2 Pbx2 −1.51 0.0123
A_51_P112319 homeobox D11 Hoxd11 −1.52 0.0271
A_51_P244892 protein inhibitor of activated STAT 4 Pias4 −1.53 0.00837
A_51_P360586 homeobox A6 Hoxa6 −1.57 0.00555
A_52_P519689 Retinold X receptor beta Rxrb −1.59 0.0429
A_52_P147070 calcium channel alpha 2/delta subunit 2 Cacna2d2 −1.62 0.00131
A_52_P565957 homeobox B4 Hoxb4 −1.66 0.0055
A_52_P595908 ring finger protein 138 Rnf138 −1.68 0.0308
A_52_P590175 GATA binding protein 6 Gata6 −2.85 0.0205
A_51_P301483 homeobox C8 Hoxc8 −18.87 0.0357
Table 2.

Upregulated genes in gestational salt-stressed BdkrB2−/− relative to BdkrB2+/+ mice

Gene Symbol Entrez ID Entrez Gene Name Molecular Function P Value
NCAPG2 76044 nonSMC condensin II complex, subunit G2 mitotic chromosome assembly and segregation 3.22E-09
MYH8 17885 myosin, heavy chain 8, skeletal muscle, perinatal structural constituent of muscle 4.14E-02
FBLN5 23876 fibulin 5 cell adhesion; cell-matrix adhesion 4.03E-06
PLAC9 100039175 placenta-specific 9 extracellular region 7.04E-03
ACTC1 11464 actin, alpha, cardiac muscle 1 actin filament-based movement 1.84E-02
MYOD1 17927 myogenic differentiation 1 myogenic factors, muscle regeneration 2.34E-02
RPL31 114641 ribosomal protein L31 Ribosomes, component of the 60S subunit 3.32E-03
FNDC1 68655 fibronectin type III domain containing 1 extracellular region 4.47E-02
CNN1 12797 calponin 1, basic, smooth muscle calmodulin binding, muscle contraction 4.85E-02
POP4 66161 processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) processing of precursor RNAs, alternative splicing 4.85E-02
TEX14 83560 testis expressed 14 protein amino acid phosphorylation 2.99E-02
CRIP1 12925 cysteine-rich protein 1 (intestinal) zinc ion binding, cell proliferation 2.03E-02
LUM 17022 lumican regulate collagen fibril organization, epithelial cell migration 3.44E-02
PRELP 116847 proline/arginine-rich end leucine-rich repeat protein extracellular matrix, skeletal system development 2.51E-02
NRXN1 18189 neurexin 1 cell adhesion molecules and receptors 1.36E-03
CD4 12504 CD4 molecule membrane glycoprotein of T lymphocytes 1.65E-03
KDM6A 22289 lysine (K)-specific demethylase 6A demethylation of tri/dimethylated histone H3 4.47E-02
ACTG2 11475 actin, gamma 2, smooth muscle, enteric muscle contraction 4.42E-02
CLEC2D 232409 C-type lectin domain family 2, member D natural killer cell receptor C-type lectin family 2.47E-02
CLMN 94040 calmin (calponin-like, transmembrane) actin binding 6.17E-04
WNT1 22408 wingless-type MMTV integration site family, member 1 signal transducer activity; frizzled binding, transcription activator activity 2.47E-02
MYH11 17880 myosin, heavy chain 11, smooth muscle smooth muscle myosin, muscle contraction 4.06E-02
COL12A1 12816 collagen, type XII, alpha 1 modify the interactions between collagen I fibrils 3.62E-04
FGF7 14178 fibroblast growth factor 7 type 2 fibroblast growth factor receptor binding 1.94E-02
GPRC5D 93746 G protein-coupled receptor, family C, group 5, member D G protein-coupled receptor, undiscovered function 3.45E-02
KDM5C 20591 lysine (K)-specific demethylase 5C chromatin modification; regulation of transcription 2.84E-03
SVEP1 64817 sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1 chromatin binding; calcium ion binding, cell adhesion 1.53E-02
AHNAK 66395 AHNAK nucleoprotein protein binding, nervous system development 4.75E-02
ANXA8 11752 annexin A8 Anticoagulant, inhibits the thromboplastin-specific complex 3.94E-02
DCN 13179 decorin component of connective tissue, binds to type I collagen fibrils 2.35E-03
CCBP2 59289 chemokine binding protein 2 beta chemokine receptor, development and growth of vascular tumors 4.06E-02
GPR116 224792 G protein-coupled receptor 116 G-protein coupled receptor 1.02E-02
CALM1 640703 calmodulin 1 (phosphorylase kinase, delta) calcium-binding protein, neurogenesis 2.14E-02
PRSS35 244954 protease, serine, 35 Trypsin, proteolysis, 5.50E-03
MATN2 17181 matrilin 2 formation of filamentous networks 8.52E-04
COL6A3 12835 collagen, type VI, alpha 3 type VI collagen, cell adhesion in muscle 1.71E-02
ELN 13717 elastin elastic fibers, extracellular matrix 3.09E-02
F13A1 74145 coagulation factor XIII, A1 polypeptide blood coagulation; peptide cross-linking 3.09E-03
ARSI 545260 arylsulfatase family, member I cell signaling, and degradation of macromolecules 2.10E-02
BCAT2 12036 branched chain amino-acid transaminase 2, mitochondrial branched chain family amino acid biosynthesis 4.48E-02
VWF 22371 von Willebrand factor platelet-vessel wall mediator 7.62E-03
ADAMTS5 23794 ADAM metallopeptidase with thrombospondin type 1 motif, 5 metalloendopeptidase activity, proteolysis 1.03E-03
SPON2 100689 spondin 2, extracellular matrix protein cell adhesion; axon guidance 1.55E-03
AKAP12 83397 A kinase (PRKA) anchor protein 12 adenylate cyclase binding, cAMP biosynthesis 6.99E-03
CRIM1 50766 cysteine rich transmembrane BMP regulator 1 (chordin-like) interact with growth factors, implicated in motor neuron differentiation and survival 6.42E-03
EGFR 13649 epidermal growth factor receptor activation of MAPKK activity; cell morphogenesis 4.22E-02
FLT1 14254 fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor) VEGFR family, receptor tyrosine kinases, angiogenesis and vasculogenesis 1.62E-02
WNT2 22413 wingless-type MMTV integration site family member 2 secreted signaling proteins, regulation of cell fate and patterning during embryogenesis 2.07E-02
ITPR2 16439 inositol 1,4,5-triphosphate receptor, type 2 ion channel activity, response to hypoxia 2.50E-02
SLIT3 20564 slit homolog 3 (Drosophila) calcium ion binding, organ morphogenesis 4.88E-03
CDK6 12571 cyclin-dependent kinase 6 G1 phase of mitotic cell cycle, cell-matrix adhesion 1.12E-02
MYLK 107589 myosin light chain kinase phosphorylates myosin regulatory light chains 1.65E-02
COL1A2 12843 collagen, type I, alpha 2 extracellular matrix, skeletal system development 4.80E-02
CAV1 12389 caveolin 1, caveolae protein, 22 kDa coupling integrins to the Ras-ERK pathway and promoting cell cycle progression 4.13E-02
STARD9 668880 StAR-related lipid transfer (START) domain containing 9 microtubule motor activity, microtubule-based movement 3.00E-02
DSP 109620 desmoplakin intercellular junctions, cell-cell adhesion 5.78E-03
LTBP4 108075 latent transforming growth factor beta binding protein 4 transforming growth factor beta receptor activity, regulation of cell growth 1.36E-03
RB1 19645 retinoblastoma 1 tumor suppressor gene 4.78E-02
FOXP2 114142 forkhead box P2 orkhead/winged-helix (FOX) family of transcription factors. 2.47E-02
FBLN1 14114 fibulin 1 incorporated into fibrillar extracellular matrix 1.94E-02
ITPR1 16438 inositol 1,4,5-triphosphate receptor, type 1 intracellular receptor for inositol 1,4,5-trisphosphate, response to hypoxia 1.99E-02
THBS1 21825 thrombospondin 1 adhesive glycoprotein, angiogenesis 5.50E-03
ABCC9 20928 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 ATP-binding cassette (ABC) transporters, multi-drug resistance, 3.01E-02
NBEA 26422 neurobeachin Target protein kinase A to specific subcellular sites 4.85E-02
LPP 210126 LIM domain containing preferred translocation partner in lipoma protein binding, cell-cell adhesion and cell motility, transcriptional co-activator 2.00E-02
NFIA 18027 nuclear factor I/A cellular transcription factors 1.16E-02
NAV3 260315 neuron navigator 3 ATPases associated with cellular activities 6.52E-03
COL3A1 12825 collagen, type III, alpha 1 type III collagen, cell-matrix adhesion 1.02E-02
RUNX2 12393 runt-related transcription factor 2 RUNX family of transcription factors, 2.55E-02
TNS1 21961 tensin 1 protein binding, focal adhesions, 7.76E-03
WISP1 22402 WNT1 inducible signaling pathway protein 1 a member of the WNT1 inducible signaling pathway (WISP) protein subfamily 3.94E-02
ADH1A 0 alcohol dehydrogenase 1A (class I), alpha polypeptide alcohol metabolic process; oxidation reduction 1.79E-02
LAMA2 16773 laminin, alpha 2 mediate the attachment, migration, and organization of cells 2.09E-06
NID1 18073 nidogen 1 basement membrane glycoproteins, adhesion 1.57E-03
PCDH10 18526 protocadherin 10 cadherin superfamily, cell adhesion 3.26E-02
PPP2R2B 72930 protein phosphatase 2, regulatory subunit B, beta negative control of cell growth and division, apoptosis 2.96E-02
SLC24A3 94249 solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 intracellular calcium homeostasis, 4.55E-02
MANBA 110173 mannosidase, beta A, lysosomal Lysosomal hydrolase activity, 4.59E-02
FBLN1 14114 fibulin 1 extracellular matrix structural constituent 1.27E-02
FIGF 14205 c-fos induced growth factor (vascular endothelial growth factor D) angiogenesis, lymphangiogenesis, and endothelial cell growth 4.49E-02
FZD7 14369 frizzled homolog 7 (Drosophila) receptors for Wnt signaling proteins 4.16E-03
AGRN 11603 agrin formation of the neuromuscular junction 1.89E-02
ITPR2 16439 inositol 1,4,5-triphosphate receptor, type 2 response to hypoxia, inositol 1,4,5-trisphosphate-sensitive calcium-release channel 2.09E-03
HIPK2 15258 homeodomain interacting protein kinase 2 interacts with homeodomain transcription factors 4.45E-02
KLF4 16600 Kruppel-like factor 4 (gut) transcription factor, mesodermal cell fate determination 6.44E-03
SIK3 70661 SIK family kinase 3 protein amino acid phosphorylation 2.23E-03
CHST3 53374 carbohydrate (chondroitin 6) sulfotransferase 3 catalyzes the sulfation of chondroitin, nvolved in cell migration and differentiation 3.45E-02
SLIT2 20563 slit homolog 2 (Drosophila) GTPase inhibitor activity, metanephros development, ureteric bud developmen 4.35E-02
COL15A1 12819 collagen, type XV, alpha 1 adhere basement membranes to underlying connective tissue stroma 3.84E-02
BACH2 12014 BTB and CNC homology 1, basic leucine zipper transcription factor 2 transcription factor activity, regulation of transcription 3.09E-02
DMD 13405 dystrophin muscle organ development 1.19E-03
EMX1 13796 empty spiracles homeobox 1 transcription factor activity 3.22E-02
ANTXR1 69538 anthrax toxin receptor 1 actin cytoskeleton reorganization 1.27E-02
EDNRA 13617 endothelin receptor type A potent and long-lasting vasoconstriction 1.37E-02
CELSR1 12614 cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila) establishment of planar polarity, cell adhesion 4.45E-02
LRP2BP 67620 LRP2 binding protein protein binding 8.84E-03
PMP22 18858 peripheral myelin protein 22 major component of myelin 1.71E-02
DDX3X 13205 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked alteration of RNA secondary structure 3.38E-03
POSTN 50706 periostin, osteoblast specific factor heparin binding, cell adhesion, 3.38E-02
PLCG2 234779 phospholipase C, gamma 2 (phosphatidylinositol-specific) phosphoinositide phospholipase C activity 4.75E-02
ICAM1 15894 intercellular adhesion molecule 1 T cell activation, regulation of cell adhesion 4.32E-02
ITGB4 192897 integrin, beta 4 cell communication; cell adhesion 4.62E-02
COL6A1 12833 collagen, type VI, alpha 1 maintaining the integrity of various tissues 3.46E-02
TRPM5 56843 transient receptor potential cation channel, subfamily M, member 5 voltage-gated ion channel activity 4.14E-02
CALCRL 54598 calcitonin receptor-like regulation of muscle contraction 3.44E-02
MLL5 69188 myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) histone methyltransferase activity (H3-K4 specific) 1.58E-02
FAM46A 212943 family with sequence similarity 46, member A N/A 2.14E-02
MYOF 226101 myoferlin membrane regeneration and repair 3.00E-02
SFRP2 20319 secreted frizzled-related protein 2 putative Wnt-binding site of Frizzled proteins 2.47E-02
LHFP 108927 lipoma HMGIC fusion partner member of the lipoma HMGIC fusion partner 7.40E-03
KCNK4 16528 potassium channel, subfamily K, member 4 voltage-gated ion channel activity 3.00E-02
ADAMTS15 235130 ADAM metallopeptidase with thrombospondin type 1 motif, 15 metalloendopeptidase activity, proteolysis 4.13E-02
TMCC3 319880 transmembrane and coiled-coil domain family 3 N/A 4.12E-02
G0S2 14373 G0/G1 switch 2 Apoptosis, cell cycle 2.75E-02
RBMS3 207181 RNA binding motif, single stranded interacting protein 3 c-myc gene single-strand binding protein 4.06E-02
CD248 70445 CD248 molecule, endosialin sugar binding 4.06E-02
FAM107A 268709 family with sequence similarity 107, member A regulation of cell growth 2.32E-02
PDGFRB 18596 platelet-derived growth factor receptor, beta polypeptide kidney development, positive regulation of cell proliferation 4.45E-02
NPPC 18159 natriuretic peptide precursor C potent natriuretic, diuretic, and vasodilating activities 1.84E-02
CGNL1 68178 cingulin-like 1 motor activity 3.73E-02
B4GALT1 14595 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 type II membrane-bound glycoproteins, epithelial cell development 2.70E-03
MMRN2 105450 multimerin 2 extracellular matrix protein 7.88E-03
ATP7A 11977 ATPase, Cu2+ transporting, alpha polypeptide copper transport across membranes, blood vessel development 3.17E-03
EMILIN3 280635 elastin microfibril interfacer 3 proteinaceous extracellular matrix 2.67E-02
SLC39A1 30791 solute carrier family 39 (zinc transporter), member 1 transmembrane transport 6.44E-03
PURB 19291 purine-rich element binding protein B regulation of transcription 2.84E-02
SSH2 237860 slingshot homolog 2 (Drosophila) actin cytoskeleton organization 6.46E-03
FNDC3B 72007 fibronectin type III domain containing 3B positive regulation of fat cell differentiation 1.70E-02
KCNJ8 16523 potassium inwardly-rectifying channel, subfamily J, member 8 inward rectifier potassium channel activity, kidney development 6.80E-03
ZFP36L1 12192 zinc finger protein 36, C3H type-like 1 nuclear-transcribed mRNA catabolic process, vasculogenesis 2.50E-02
CDS2 110911 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 hosphatidate cytidylyltransferase activity 5.74E-03
PBXIP1 229534 preB-cell leukemia homeobox interacting protein 1 transcription corepressor activity, cell differentiation 4.93E-02
PPP1R9A 243725 protein phosphatase 1, regulatory (inhibitor) subunit 9A regulatory subunit of protein phosphatase I, controls actin cytoskeleton reorganization 1.60E-02
NID2 18074 nidogen 2 (osteonidogen) cell-adhesion protein that binds collagens I and IV 1.08E-03
PKD1 18763 polycystic kidney disease 1 (autosomal dominant) regulator of calcium permeable cation channels, calcium-independent cell-matrix adhesion 2.47E-02
SERTAD4 214791 SERTA domain containing 4 protein binding 4.78E-02
FBXO46 243867 F-box protein 46 protein binding 4.01E-02
SNX18 170625 sorting nexin 18 cell communication; protein transport 4.85E-02
PTPRF 19268 protein tyrosine phosphatase, receptor type, F negative regulation of cytokine-mediated signaling pathway, cell adhesion 2.30E-02
SPCS2 66624 signal peptidase complex subunit 2 homolog (S. cerevisiae) peptidase activity, signal peptide processing 2.67E-02
NES 18008 nestin central nervous system development 5.50E-03
SESN1 140742 sestrin 1 response to DNA damage stimulus, cell cycle arrest; negative regulation of cell proliferation 3.94E-02

P < 0.05.

Table 3.

Downregulated genes in BdkrB2−/− relative to BdkrB2+/+ mice

Gene Symbol Entrez ID Entrez Gene Name Molecular Function P value
KDM5D 20592 lysine (K)-specific demethylase 5D chromatin modification 6.52E-03
NUDT16 75686 nudix-type motif 16 RNA binding; hydrolase activity; metal binding 2.98E-02
LTA 16992 lymphotoxin alpha cytokine produced by lymphocytes 4.75E-02
STARD13 243362 StAR-related lipid transfer (START) domain containing 13 GTPase activator activity, signal transduction 3.46E-02
RAPGEF5 217944 Rap guanine nucleotide exchange factor (GEF) 5 small GTPase mediated signal transduction 1.23E-05
CREG2 263764 cellular repressor of E1A-stimulated genes 2 N/A 1.27E-02
DDX23 74351 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 Embryogenesis and cellular growth and division 4.49E-02
NOP56 67134 NOP56 ribonucleoprotein homolog (yeast) rRNA processing 3.51E-03
RPS13 68052 ribosomal protein S13 negative regulation of RNA splicing 3.53E-08
ADAM23 23792 ADAM metallopeptidase domain 23 metalloendopeptidase activity 1.27E-02
MSX2 17702 msh homeobox 2 DNA binding; transcription factor activity 3.43E-02
TPCN1 252972 two pore segment channel 1 voltage-gated ion channel activity 2.10E-02
BCAT2 12036 branched chain amino-acid transaminase 2, mitochondrial Catalyzes production of the branched chain amino acids 2.26E-02
BSDC1 100383 BSD domain containing 1 protein binding 2.47E-02
GANC 76051 glucosidase, alpha; neutral C carbohydrate metabolic process 4.98E-02
CHMP4B 75608 chromatin modifying protein 4B interact with programmed cell death 6 interacting protein 1.37E-02
SCRIB 105782 scribbled homolog (Drosophila) targeted to epithelial adherens junctions, cell polarization 4.89E-02
CLK1 12747 CDC-like kinase 1 governing splice site selection 4.09E-03
PABPN1 54196 poly(A) binding protein, nuclear 1 RNA processing; mRNA processing 3.11E-02
HOXD4 15436 homeobox D4 morphogenesis in all multicellular organisms 3.51E-03
TNKS2 74493 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 NAD+ ADP-ribosyltransferase activity, regulation of multicellular organism growth 1.66E-02
DNASE1L2 66705 deoxyribonuclease I-like 2 DNA binding; endonuclease activity 4.86E-02
RAF1 110157 v-raf-1 murine leukemia viral oncogene homolog 1 MAP kinase kinase kinase (MAP3K), control of gene expression involved in the cell division cycle, apoptosis, cell differentiation and cell migration. 1.70E-02
GAS5 14455 growth arrest-specific 5 (nonprotein coding) N/A 2.64E-02
ZXDC 80292 ZXD family zinc finger C positive regulation of transcription 2.09E-03
PNPLA6 50767 patatin-like phospholipase domain containing 6 deacetylates intracellular phosphatidylcholine 4.85E-02
BUB3 12237 budding uninhibited by benzimidazoles 3 homolog (yeast) spindle checkpoint function, mitotic sister chromatid segregation, cell division 1.74E-02
MTHFSD 234814 methenyltetrahydrofolate synthetase domain containing folic acid and derivative biosynthetic process 3.84E-02
CLK4 12750 CDC-like kinase 4 peptidyl-tyrosine phosphorylation 2.71E-02
LSM7 66094 LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae) nuclear mRNA splicing, via spliceosome 3.88E-02
RPL11 67025 ribosomal protein L11 RNA processing; translation; translational elongation 9.14E-03
NFATC2IP 18020 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein cytokine production; regulation of transcription 4.45E-02
IDI1 319554 isopentenyl-diphosphate delta isomerase 1 cholesterol biosynthetic process 1.84E-02
C16ORF70 234678 chromosome 16 open reading frame 70 Golgi to plasma membrane protein transport 4.47E-02
GRWD1 101612 glutamate-rich WD repeat containing 1 role in ribosome biogenesis 1.25E-02
KCTD5 69259 potassium channel tetramerisation domain containing 5 voltage-gated potassium channel activity 1.89E-02
DDX51 69663 DEAD (Asp-Glu-Ala-Asp) box polypeptide 51 rRNA processing 3.85E-02
GTPBP3 70359 GTP binding protein 3 (mitochondrial) tRNA modification 2.32E-02
PCSK7 18554 proprotein convertase subtilisin/kexin type 7 proprotein convertases, peptide hormone processing 4.06E-02
RNF168 70238 ring finger protein 168 double-strand break repair; response to ionizing radiation; chromatin modification; positive regulation of DNA repair; histone H2A K63-linked ubiquitination 1.27E-02
EDC3 353190 enhancer of mRNA decapping 3 homolog (S. cerevisiae) associated with mRNA-decapping complex 2.58E-02
SNIP1 76793 Smad nuclear interacting protein 1 production of miRNAs involved in gene silencing 3.39E-02
DDX18 66942 DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 alteration of RNA secondary structure 1.12E-04
NANS 94181 N-acetylneuraminic acid synthase lipopolysaccharide biosynthetic process 3.73E-02
MED29 67224 mediator complex subunit 29 a multiprotein coactivator of RNA transcription 4.70E-03
SUPV3L1 338359 suppressor of var1, 3-like 1 (S. cerevisiae) DNA duplex unwinding 1.53E-02
EXOSC7 66446 exosome component 7 3¢-5¢-exoribonuclease activity, RNA processing 2.47E-02
TRIM39 79263 tripartite motif-containing 39 protein binding; zinc ion binding, apoptosis 3.17E-02
DOCK5 68813 dedicator of cytokinesis 5 guanyl-nucleotide exchange factor activity 4.95E-02
DNAJC11 230935 DnaJ (Hsp40) homolog, subfamily C, member 11 heat shock protein binding 1.16E-02
TBP 21374 TATA box binding protein Initiation of transcription, regulation of transcription 1.94E-02
MOXD1 59012 monooxygenase, DBH-like 1 monooxygenase activity, catecholamine metabolic process 1.02E-03
DIDO1 23856 death inducer-obliterator 1 transcription; apoptosis 4.06E-02
NUP43 69912 nucleoporin 43 kDa Bidirectional transport of macromolecules 8.52E-04
KIAA1804 234878 mixed lineage kinase 4 protein phosphorylation, signal transduction 4.85E-02
RAD51AP1 19362 RAD51 associated protein 1 DNA recombination, DNA repair DNA binding 3.85E-02
HSPA14 50497 heat shock 70 kDa protein 14 ATP binding, nucleotide binding 3.99E-03
GPS1 1E +08 G protein pathway suppressor 1 catalyze deneddylation of proteins 2.47E-02
PRKAR2A 19087 protein kinase, cAMP-dependent, regulatory, type II, alpha cAMP binding, cAMP-dependent protein kinase regulator activity 3.91E-02
GPKOW 209416 G patch domain and KOW motifs ribosomal protein, nucleic acid binding 1.37E-02
TEX9 21778 testis expressed 9 testis-expressed sequence 9 protein 3.01E-02
GTPBP3 70359 GTP binding protein 3 (mitochondrial) GTP catabolic process, tRNA modification 3.47E-02
ASNS 27053 asparagine synthetase (glutamine-hydrolyzing) asparagine biosynthetic process, cellular amino acid biosynthetic process 1.65E-02
KLHDC4 234825 kelch domain containing 4 peptidease activity, hydrolysis of peptide bond 4.06E-02
MED22 20933 mediator complex subunit 22 regulation of transcription, DNA directed RNA polymerase 8.76E-03
CCDC117 104479 coiled-coil domain containing 117 chromosomal protein 4.13E-02
HDAC10 170787 histone deacetylase 10 chromatin modification, histone deacetylation 2.35E-03
POLR3C 74414 polymerase (RNA) III (DNA directed) polypeptide C (62kD) innate immune response, positive regulation of innate immune response 1.98E-02
MTRF1L 108853 mitochondrial translational release factor 1-like translation release factor activity 3.92E-02
RNF34 80751 ring finger protein 34 ligase activity, metal ion binding, apoptosis, metabolic proces 4.93E-04
UBP1 22221 upstream binding protein 1 (LBP-1a) DNA binding, protein binding, angiogenesis, regulation of transcription 3.94E-02
BCCIP 66165 BRCA2 and CDKN1A interacting protein kinase regulator activity, cell cycle, DNA repair 4.85E-02
LUC7L2 192196 LUC7-like 2 (S. cerevisiae) enzyme binding, metal ion binding 1.89E-02
NOC4L 100608 nucleolar complex associated 4 homolog (S. cerevisiae) nucleolus protein, formation of ribosome 8.76E-03
PPHLN1 223828 periphilin 1 keratinization 2.84E-03
EIF4A3 192170 eukaryotic translation initiation factor 4A3 ATP-dependent RNA helicase activity, negative regulation of translation 1.89E-02
NIF3L1 65102 NIF3 NGG1 interacting factor 3-like 1 (S. pombe) transcription factor binding, positive regulation of transcription 4.89E-02
FASTKD5 380601 FAST kinase domains 5 protein kinase activity, apoptosis 4.45E-02
HAUS3 231123 HAUS augmin-like complex, subunit 3 cytoskeleton component, cell cycle, cell division 3.53E-05
PSEN1 19164 presenilin 1 beta-catenin binding, cadherin binding, activation of MAPKK activity 1.66E-03
PSMC1 19179 proteasome (prosome, macropain) 26S subunit, ATPase, 1 hydrolase activity, negative regulation of ubiquitin- protein ligase activity involved in mitotic cell cycle 4.06E-02
EXO1 26909 exonuclease 1 5′-3′ exodeoxyribonuclease activity, DNA recombination, DNA repair 2.99E-02
CBX2 12416 chromobox homolog 2 chromatin binding, DNA binding, chromatin assembly or disassembly, chromatin modification 4.75E-02
DIABLO 66593 diablo homolog (Drosophila) activation of caspase activity, apoptosis 4.42E-02
EBNA1BP2 69072 EBNA1 binding protein 2 chromosome segregation, ribosome biogenesis 1.25E-02
FDPS 110196 farnesyl diphosphate synthase dimethylallyltranstransferase activity, cholesterol biosynthetic proces 3.00E-02
METTL2B 52686 methyltransferase like 2B methyltransferase activity, metabolic process, methylation 2.45E-02
PPP1R1A 58200 protein phosphatase 1, regulatory (inhibitor) subunit 1A phosphoprotein phosphatase inhibitor activity, carbohydrate metabolic process 4.85E-02
SREBF2 20788 sterol regulatory element binding transcription factor 2 chromatin binding, DNA binding, cholesterol metabolic process 2.10E-02
RBM4 19653 RNA binding motif protein 4 mRNA 3′-UTR binding, circadian regulation of gene expression 1.94E-02
RPP38 227522 ribonuclease P/MRP 38 kDa subunit hydrolase activity, ribonuclease P activity, tRNA processing 2.47E-02
USP38 74841 ubiquitin specific peptidase 38 Process ubiquitin-dependent protein catabolic process 4.95E-02
TUBG1 103733 tubulin, gamma 1 GTPase activity, microtubule nucleation 3.99E-03
MAX 17187 MYC associated factor X negative regulation of gene expression, protein complex assembly 2.22E-02
DGAT1 13350 diacylglycerol O-acyltransferase 1 acyltransferase activity, glycerolipid metabolic process 3.99E-03
POLR2G 67710 polymerase (RNA) II (DNA directed) polypeptide G DNA-directed RNA polymerase activity, RNA splicing, transcription 3.47E-02
EIF3B 27979 eukaryotic translation initiation factor 3, subunit B nucleic acid binding, regulation of translational initiation 4.77E-02
SC4MOL 66234 sterol-C4-methyl oxidase-like C-4 methylsterol oxidase activity, iron ion binding, fatty acid biosynthetic process 4.95E-02
GLRX3 30926 glutaredoxin 3 electron carrier activity, iron-sulfur cluster binding, cell redox homeostasis 3.01E-04
TNFRSF19 29820 tumor necrosis factor receptor superfamily, member 19 receptor activity, positive regulation of I-kappaB kinase/NF-kappaB cascade 4.85E-02
DOHH 1E +05 deoxyhypusine hydroxylase/monooxygenase oxidation-reduction process, peptidyl-lysine modification to hypusine 5.49E-03

P < 0.05.

Fig. 4.

Fig. 4.

Quantitative RT-PCR validation of differentially expressed genes in the microarray. *P < 0.05.

Gestational salt stress suppresses epithelial Pax2 expression in BdkrB2−/− mice.

In silico analysis revealed that ∼12% of the altered genes in salt-stressed BdkrB2−/− embryonic kidneys (28 genes upregulated and 13 genes downregulated) harbor putative Pax2-binding sites in their promoter region (within −1 kb of the transcription start site) (Tables 4 and 5). Since Pax2-target genes in the E14.5 developing kidney are not known, it is not possible to discern if any of these genes are Pax2-regulated genes. Quantitative real-time RT-PCR performed on the renal medulla harvested from P1 salt-stressed Bdkrb2+/+ and Bdkrb2−/− kidneys validated expression changes of some genes (but not all). For example, we validated upregulation of Gpcr5d (+1.26 ± 0.10 fold vs. wild type, n = 5/group, P < 0.05) but failed to detect a statistically significant differential expression in Myh11, while there was tendency toward differential expression in Actg2 (+2.96 ± 1.15 P = 0.12). Although differential expression of Pax2 was not evident in the microarray, there was a significant yet modest (20%) reduction in Pax2 mRNA levels in mutants as compared wild-type mice (Fig. 5A). QPCR is more sensitive than hybridization-based technologies such as microarrays, which may explain why differential expression of Pax2 was not picked up by the microarray. Double immunofluorescence for Pax2 and the water channel AQP-2 confirmed the downregulation of Pax2 protein in collecting ducts of Bdkrb2 mice (Fig. 5B). Notably, downregulation of Pax2 is only observed in salt-stressed Bdkrb2 mutants indicating that Pax2 is responsive to gene-environment interactions and not to salt or gene mutations alone.

Table 4.

Upregulated genes in BdkrB2−/− with Pax2 binding sites

Gene Symbol Entrez ID Entrez Name Molecular Function Expression in Kidney Start Position End Position Inspecting Sequence ID
Myh8 17885 myosin, heavy chain 8 motor activity, constituent of muscle trunk mesenchyme 579 591 GXP_92669
Nrxn1 18189 neurexin 1 cell adhesion; axon guidance trunk mesenchyme 60 72 GXP_185470
Actg2 11468 actin, gamma 2, smooth muscle, enteric muscle contraction ureter 240 252 GXP_303411
Myh11 17880 myosin, heavy chain 11, smooth muscle muscle contraction vasculature, pelvis, ureter 238 250 GXP_18305
Gprc5d 93746 G protein-coupled receptor, family C, group 5, member D G protein-coupled receptor activity N/A 449 461 GXP_2537517
Ahnak 66395 AHNAK nucleoprotein nervous system development ureteric tip and trunk, interstitium, vasculature 341 353 GXP_304725
Ccbp2 59289 chemokine binding protein 2 chemokine receptor activity kidney 402 414 GXP_1805682
Col6a3 12835 collagen, type VI, alpha 3 cell adhesion; muscle organ development diffused in metanephros 652 664 GXP_1457863
Adamts5 23794 ADAM metallopeptidase with thrombospondin type 1 motif, 5 metalloendopeptidase activity, integrin binding, proteolysis urogenital sinus, primitive bladder 468 480 GXP_1239277
Sema5a 20356 sema domain, seven thrombospondin repeats cell adhesion; cell-cell signaling; multicellular organismal development ureteric tree and tips, vasculature, interstitium, mesenchyme, nephrons 1098 1110 GXP_89931
Col1a2 12843 collagen, type I, alpha 2 extracellular matrix structural constituent renal vasculature 55 67 GXP_821204
Cav1 12389 caveolin 1, caveolae protein regulator of the Ras-p42/44 mitogen-activated kinase cascade trunk mesenchyme 32 44 GXP_150594
Rb1 19645 retinoblastoma 1 Cell cycle progression, apoptosis, proliferation regulator kidney 546 558 GXP_1793835
Itpr1 16438 inositol 1,4,5-triphosphate receptor, type 1 response to hypoxia, calcium ion transport, ion channel activity renal vasculature 537 549 GXP_105230
Thbs1 21825 thrombospondin 1 adhesive glycoprotein, cell-to-cell and cell-to-matrix interactions metanephros, late tubules 410 422 GXP_1459831
Tns1 21961 tensin 1 focal adhesions, cell attaches to the extracellular matrix proximal and distal tubule, medullary collecting duct 232 244 GXP_2220687
Manba 110173 mannosidase, beta A, lysosomal hydrolase activity, glycoprotein catabolic process N/A 256 268 GXP_1799746
Figf 14205 c-fos induced growth factor PDGF/VEGF family, active in angiogenesis metanephros 189 201 GXP_1471435
Spnb2 20742 spectrin beta 2 actin binding, calmodulin binding trunk mesenchyme 551 563 GXP_118730
Zfp26 22688 Mus musculus zinc finger protein 26 DNA binding, metal ion binding, transcription factor, glial development mesenchyme, ureteric tip and trunk, interstitium, tubules and vasculature 163 175 GXP_826162
Dmd 13405 dystrophin dystrophin-glycoprotein complex, muscle organ development; skeletal muscle tissue development metanephros 338 350 GXP_1470974
Icam1 15894 intercellular adhesion molecule 1 receptor activity, integrin binding N/A 234 246 GXP_445321
Mll5 69188 myeloid/lymphoid or mixed-lineage leukemia 5 Histone methyltransferase, dimethylates 'Lys-4¢ of histone H3, myeloid differentiation cap mesenchyme, interstitium, pelvic smooth muscle 494 506 GXP_239498
Rbms3 207181 RNA binding motif, single stranded interacting protein 3 DNA replication, gene transcription, cell cycle progression and apoptosis N/A 267 279 GXP_229583
Nppc 18159 natriuretic peptide precursor C vasodilating activities, body fluid homeostasis, blood pressure control N/A 218 230 GXP_288775
Atp7a 11977 ATPase, Cu++ transporting, alpha polypeptide blood vessel development; blood vessel remodeling N/A 590 602 GXP_187
Fndc3b 72007 fibronectin type III domain containing 3B positive regulation of fat cell differentiation N/A 168 180 GXP_82518
Nes 18008 nestin neural tube intermediate filamen drainage component 198 210 GXP_1455614
Table 5.

Downregulated genes in BdkrB2−/− with Pax2 binding sites

Gene symbol Entrez ID Entrez Name Molecular Function Expression in Kidney Start Position End Position Inspecting Sequence ID
Lta 16992 lymphotoxin alpha (TNF superfamily, member 1) tumor necrosis factor, formation of secondary lymphoid organs, apoptosis N/A 325 337 GXP_81886
Stard13 243362 StAR-related lipid transfer (START) domain containing 13 GTPase activator activity, N/A 148 160 GXP_1801980
Rapgef5 217944 Rap guanine nucleotide exchange factor (GEF) 5 members of the RAS subfamily of GTPases function in signal transduction N/A 158 170 GXP_413710
Adam23 23792 ADAM metallopeptidase domain 23 proteolysis; cell adhesion; central nervous system development N/A 557 569 GXP_132501
D4Wsu53e 27981 DNA segment, Chr 4 tagging genes with cassette-exchange sites N/A 170 182 GXP_287874
Ganc 76051 glucosidase, alpha; neutral C carbohydrate metabolic process, hydrolase enzymes hydrolyse the glycosidic bond between two or more carbohydrates N/A 723 735 GXP_2532326
Raf1 110157 v-raf-1 murine leukemia viral oncogene homolog 1 MAP kinase kinase kinase, cell division cycle, apoptosis, cell differentiation and cell migration. cap mesenchyme 475 487 GXP_2537320
Clk4 12750 CDC-like kinase 4 CDC2-like protein kinase (CLK) family, regulation of alternative splicing kidney 605 617 GXP_409562
Igh-6 16019 2 days neonate thymus thymic cells cDNA immunoglobulin heavy chain 6, antigen binding N/A 88 100 GXP_1236446
Supv3l1 338359 suppressor of var1, 3-like 1 DNA binding; DNA helicase activity, DNA duplex unwinding kidney 301 313 GXP_115349
Zfp108 54678 Zinc finger protein 108 Interacting selectively and noncovalently with any metal ion N/A 409 421 GXP_1466602
Tex9 21778 testis expressed 9 expressed in adult mouse testes kidney 182 194 GXP_276197
Ubp1 22221 upstream binding protein 1 transcription factor activity, angiogenesis ureter 169 181 GXP_712

Gene list was generated by Genomatix Program with zero mismatches. The start position and end position of binding are relative to the inspecting sequence of Genomatix Program. Some of the genes in the list may have more than one binding sites; only one binding site is presented.

Fig. 5.

Fig. 5.

Pax2 mRNA and protein are suppressed in the medulla of salt-stressed Bdkrb2−/− mice. A: RNA was isolated from the medulla of P1 salt-stressed BdkrB2+/+ and Bdkrb2−/− kidneys. Pax2 and GAPDH mRNA were measured by real-time quantitative RT-PCR for the genes indicated. B: immunofluorescence staining of Pax2 in P1 kidney sections from postnatal day (P) 1 Bdkrb2+/+ and Bdkrb2−/− pups subjected to gestational high salt. AQP2 staining was used to mark the collecting ducts.

Gestational salt stress represses Pax2-driven reporter expression in mutant but not in wild-type mice.

To determine whether the reduction in Pax2 expression is mediated transcriptionally and is sensitive to gestational gene-environment interactions, we monitored GFP fluorescence as a surrogate of Pax2 promoter activity in vivo in salt-stressed Pax2-GFP;Bdkrb2−/− mice. At E12.5 and E14.5, GFP reporter activity was detected in the UB and its branches and in the metanephric mesenchyme, thus mimicking endogenous Pax2 gene expression. This expression pattern is similar in both genotypes, i.e., Bdkrb2+/+ and BdkrB2−/− embryos. However, GFP fluorescence is markedly lower in Bdkrb2−/− than Bdkrb2+/+ kidneys (Fig. 6, A and C). Quantitative real-time RT-PCR demonstrated that GFP mRNA is significantly lower in mutant than wild-type kidneys at E12.5 and E14.5 (Fig. 6, B and D).

Fig. 6.

Fig. 6.

Pax2 promoter-driven reporter activity is reduced in salt-stressed Bdkrb2−/− metanephroi. A, C: E12.5 and E14.5 metanephroi were harvested from genetic crosses of Bdkrb2−/−;Pax2-GFP mice subjected to gestational high salt. Photographs of GFP fluorescence (a surrogate of Pax2 promoter activity) were captured at the time of harvest. GFP fluorescence is visibly lower in Bdkrb2−/− than Bdkrb2+/+ metanephroi. B, D: GFP mRNA was measured by real-time quantitative RT-PCR in E12.5 and E14.5 Bdkrb2−/− and Bdkrb2+/+ metanephroi (n = 4–5/group).

Removal of the salt stressor fails to restore Pax2 reporter activity in ex vivo cultured BdkrB2 mutant explants.

To determine whether Pax2 gene repression is reversible upon removal of the intrauterine stress, salt-stressed E12.5 Pax2-GFP;Bdkrb2−/−, Bdkrb2+/−, and Bdkrb2+/+ metanephroi were grown in culture for 2 days, and the intensity of GFP recorded over time. As noted in Fig. 7A, at 0 h, GFP fluorescence intensity is higher in wild-type and heterozygous than mutant kidneys. More importantly, over the ensuing 48 h, although growth in size is observed in the three genotypes, GFP intensity remains low in the homozygous null mutants compared with wild-type and heterozygous kidneys. Measurement of GFP pixel intensity, shown in Fig. 7B, confirms that at E12.5, GFP fluorescence intensity is significantly lower in both heterozygous and homozygous Bdkrb2 mutants than wild-type controls.

Fig. 7.

Fig. 7.

Ex vivo culture of salt-stressed Bdkrb2−/− metanephroi. A: E12.5 metanephroi were harvested from Pax2-GFP;Bdkrb2+/+, Pax2-GFP;Bdkrb2+/−, and Pax2-GFP;Bdkrb2−/− littermates and grown in culture (n = 12–18/group). The intensity of GFP fluorescence, a surrogate of Pax2 promoter activity and expression, was recorded at times 0, 24, and 48 h. Bdkrb2−/− metanephroi are smaller than the heterozygous and homozygous null mutants and maintain lower GFP fluorescence intensity ex vivo. B: quantitative measurement of GFP fluorescence reveals that although GFP pixel intensity increases in all groups during 24–48 h in the absence of the intrauterine salt stressor, the reduction in GFP intensity remains significantly lower in the Bdkrb2−/− metanephroi.

DISCUSSION

We reported previously that BdkrB2−/− mice are predisposed to renal dysgenesis in the presence of embryonic salt stress (14, 17). This mouse model of a human disease offers a unique opportunity to uncover the genetic and epigenetic mechanisms underlying gene-environment interactions in congenital renal disease. The present study demonstrates that BdkrB2 mutant kidneys from salt-stressed embryos manifest gene expression changes involving transcription factors, Wnt, cell survival, and cell-matrix pathways. Moreover, we found that Pax2 gene expression is repressed in collecting ducts of salt-stressed Bdkrb2−/− embryos. Lastly, utilizing genetic crosses between Bdkrb2−/− mice and BAC transgenic mice carrying a Pax2-GFP reporter cassette, we show that Pax2 transcriptional activity is repressed in salt-stressed Bdkrb2−/− embryonic kidneys. To our knowledge, this is the first demonstration of a renal developmental regulator that is sensitive to gene-environment interactions.

Clinical studies have demonstrated that mutations in genes encoding renal developmental regulators account for a relatively small fraction of congenital abnormalities in renal and urinary tract development (22, 36). Examples of these genes include Pax2, Eya1, Six1, Sall1, HNF1β, Ret, Robo, WT1, and Notch. The etiology of the remaining cases is unknown, but it is possible that mutations in other developmental genes will be identified in the future. It is also conceivable that gestational exposure to environmental factors (e.g., drugs, toxins) or gene-environment interactions account for a significant proportion of sporadic renal dysgenesis.

The gene-environment interaction model implies that an inherited germline mutation is phenotypically silent, presumably because it is compensated for by genes with overlapping functions. The homeostatic function of the mutant gene is revealed following exposure to a stressor that overwhelms the capacity of compensatory mechanisms. An example of genetic susceptibility is a patient with a bleeding disorder who is asymptomatic but bleeds when exposed to a stressor that impairs hemostasis, such as an antiplatelet drug or physical trauma. In our animal model, renal dysgenesis is produced by defined gene-environment interactions (13, 14). Mice harboring a homozygous deletion of the Bdkrb2 are developmentally normal and fertile. However, Bdkrb2−/− embryos exposed to gestational salt stress via the maternal diet develop renal dysgenesis due to impaired collecting duct growth and differentiation (12, 14, 17, 19). Interestingly, adult Bdkrb2 mutants develop hypertension if fed a high-salt diet (1, 8, 25).

The combination of Bdkrb2 inactivation and embryonic salt stress results in transcriptional activation of proapoptotic and repression of terminal differentiation genes (17, 19). Germline deletion of p53 from the genome of Bdkrb2−/− mice protects against apoptosis (19). Since p53 is sensor and a hub for multiple intracellular pathways (15, 16, 40), it was important to determine the cellular and molecular pathways that are altered at the onset of renal dysgenesis. Our microarray analysis revealed that while apoptosis is one of the top 10 pathways that are altered in mutant kidneys, other important pathways included Wnt signaling, calcium signaling, extracellular matrix organization, and cell communication. The following discussion focuses on the major genetic networks downstream of gene-environment interactions and how they might affect kidney development.

Intracellular calcium signaling.

Several gene products involved in intracellular calcium removal (ATP2B2, decreased), sarcoplasmic calcium release (ryanodine receptor RYR1, increased), or calcium entry/release into the cell (bradykinin receptor type 1 BdkrB1, increased) suggest that salt-stressed BdkrB2−/− cells accumulate excess intracellular calcium. The latter effect may have significant effects on membrane protein function, cell shape and mobility, gene expression, and activation of apoptosis (33).

Extracellular matrix metabolism.

Enhanced expression of fibulin 5 (Fbln5), a secreted extracellular matrix protein, and lysyl oxidase (Lox), which catalyzes cross-linking of collagen fibers, is observed in dysplastic BdkrB2−/− kidneys, which manifest expanded interstitium. Mutations in Fbln5 and Lox are implicated in various vasculopathies and inherited musculoskeletal disorders.

Regulation of cellular communication and signaling.

Several key cell membrane-associated or cell surface protein-encoding genes, e.g., small G protein binding and Rho-dependent signaling (ARHGEF1), cell-matrix signaling (integrin B3, ITGB3), and ephrin B2 (EPHB2) are downregulated, whereas genes involved in TGF-β (activin A type 1B receptor, ACVR1B) and NF-κB (IKBKG) signaling are upregulated. This imbalance may contribute to cellular injury in the dysplastic BdkrB2 null kidneys.

Pattern specification process.

Several Homeobox genes (HoxB4, HoxC8, HoxA6, and HoxD11) are downregulated in salt-stressed BdkrB2 mutant kidneys. Hox genes are known to play a key role in anterio-posterior axis specification (26), and within the kidney they may play a role in defining the segmental specification of the nephron (29, 44). Hoxd11 paralogs and Pbx2 genes are expressed in the kidney and their mutations cause renal dysgenesis.

Wnt receptor signaling.

Both canonical and noncanonical Wnts play important roles in kidney development (39). BdkrB2−/− exhibit reduced expression of Wnt6, Dvl2, and Axin1 and upregulation of the soluble receptor for Wnt, Sfrp4, suggesting impaired Wnt signaling.

Apoptosis.

Enhanced cell death is a prominent feature in BdkrB2−/− mutant kidneys (19). This is partly mediated by p53 activation via Chk1-mediated serine 23 phosphorylation. Indeed, multiple proapoptotic genes in the tumor necrosis factor pathway (TNFRSF21, LTA, EIF5A), caspase 12, and mitochondrial membrane protein Mtch1 are dysregulated in BdkrB2 null kidneys.

Downregulation of Pax2.

The present study demonstrates reduced Pax2 protein and mRNA abundance in embryonic and newborn kidneys of salt-stressed Bdkrb2−/− mice and reduced reporter (GFP) expression in kidneys of Bdkrb2−/− mice carrying a BAC Pax2-GFP transgene. Pax2 is a transcription factor that is highly expressed in proliferating epithelial progenitors and is rapidly downregulated during terminal differentiation (2, 11, 41). Pax2 plays multiple and sequential roles in renal development, including specification of the metanephric blastema, and survival and differentiation of nephron progenitors and collecting ducts (5, 6, 9, 11, 27, 34, 42). Deregulated expression of Pax2 results in cystic kidneys (10, 28), whereas Pax2 gene dosage reduction causes renal hypoplasia in humans and mice (31, 32, 37). Based on these data, we suggest that reduced Pax2 activity in salt-stressed BdkrB2−/− mice is an important contributing factor in the pathogenesis of the renal phenotype. Interestingly, allowing metanephric growth ex vivo failed to normalize Pax2 reporter activity, suggesting that the Pax2 promoter retains a repressive memory even after removal of the embryonic stressor or that a longer period outside the intrauterine environment may be necessary to reverse the repression. Epigenetic therapy that favors a permissive chromatin environment (e.g., HDAC or Dnmt inhibitors) may be of therapeutic benefit.

In summary, the present study demonstrates that gestational gene-environment interactions alter the metanephric transcriptome prior to the onset of the renal phenotype. Moreover, the Pax2 gene is sensitive to gestational gene-environment interactions.

GRANTS

This work was supported by National Institutes of Health Grants DK-56264 and Center Of Biomedical Research Excellence 1P20 RR-017659.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).

AUTHOR CONTRIBUTIONS

Author contributions: L.Y., X.Y., and D.B. performed experiments; L.Y., D.B., Z.S., and S.S.E.-D. analyzed data; L.Y., D.B., Z.S., and S.S.E.-D. interpreted results of experiments; L.Y. prepared figures; L.Y. drafted manuscript; L.Y., X.Y., D.B., Z.S., and S.S.E.-D. approved final version of manuscript; Z.S. and S.S.E.-D. edited and revised manuscript; S.S.E.-D. conception and design of research.

ACKNOWLEDGMENTS

We thank Dr. Maxime Bouchard for the BAC Pax2-GFP transgenic mice and the Tulane Renal and Hypertension Center and Tulane Center for Stem Cell Research and Regenerative Medicine for the use of molecular and imaging cores.

REFERENCES

  • 1.Alfie ME, Sigmon DH, Pomposiello SI, Carretero OA. Effect of high salt intake in mutant mice lacking bradykinin-B2 receptors. Hypertension 29: 483–487, 1997 [DOI] [PubMed] [Google Scholar]
  • 2.Bates CM. Kidney development: regulatory molecules crucial to both mice and men. Mol Genet Metab 71: 391–396, 2000 [DOI] [PubMed] [Google Scholar]
  • 3.Batourina E, Gim S, Bello N, Shy M, Clagett-Dame M, Srinivas S, Costantini F, Mendelsohn C. Vitamin A controls epithelial/mesenchymal interactions through Ret expression. Nat Genet 27: 74–78, 2001 [DOI] [PubMed] [Google Scholar]
  • 4.Borkowski JA, Ransom RW, Seabrook GR, Trumbauer M, Chen H, Hill RG, Strader CD, Hess JF. Targeted disruption of a B2 bradykinin receptor gene in mice eliminates bradykinin action in smooth muscle and neurons. J Biol Chem 270: 13706–13710, 1995 [DOI] [PubMed] [Google Scholar]
  • 5.Bouchard M, Souabni A, Mandler M, Neubuser A, Busslinger M. Nephric lineage specification by Pax2 and Pax8. Genes Dev 16: 2958–2970, 2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Brophy PD, Ostrom L, Lang KM, Dressler GR. Regulation of ureteric bud outgrowth by Pax2-dependent activation of the glial derived neurotrophic factor gene. Development 128: 4747–4756, 2001 [DOI] [PubMed] [Google Scholar]
  • 7.Burrow CR. Retinoids and renal development. Exp Nephrol 8: 219–225, 2000 [DOI] [PubMed] [Google Scholar]
  • 8.Cervenka L, Harrison-Bernard LM, Dipp S, Primrose G, Imig JD, El-Dahr SS. Early onset salt-sensitive hypertension in bradykinin B(2) receptor null mice. Hypertension 34: 176–180, 1999 [DOI] [PubMed] [Google Scholar]
  • 9.Dressler GR. Epigenetics, development, and the kidney. J Am Soc Nephrol 19: 2060–2067, 2008 [DOI] [PubMed] [Google Scholar]
  • 10.Dressler GR, Wilkinson JE, Rothenpieler UW, Patterson LT, Williams-Simons L, Westphal H. Deregulation of Pax-2 expression in transgenic mice generates severe kidney abnormalities. Nature 362: 65–67, 1993 [DOI] [PubMed] [Google Scholar]
  • 11.Eccles MR, He S, Legge M, Kumar R, Fox J, Zhou C, French M, Tsai RW. PAX genes in development and disease: the role of PAX2 in urogenital tract development. Int J Dev Biol 46: 535–544, 2002 [PubMed] [Google Scholar]
  • 12.El-Dahr SS, Aboudehen K, Dipp S. Bradykinin B2 receptor null mice harboring a Ser23-to-Ala substitution in the p53 gene are protected from renal dysgenesis. Am J Physiol Renal Physiol 295: F1404–F1413, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.El-Dahr SS, Dipp S, Meleg-Smith S, Pinna-Parpaglia P, Madeddu P. Fetal ontogeny and role of metanephric bradykinin B2 receptors. Pediatr Nephrol 14: 288–296, 2000 [DOI] [PubMed] [Google Scholar]
  • 14.El-Dahr SS, Harrison-Bernard LM, Dipp S, Yosipiv IV, Meleg-Smith S. Bradykinin B2 null mice are prone to renal dysplasia: gene-environment interactions in kidney development. Physiol Genomics 3: 121–131, 2000 [DOI] [PubMed] [Google Scholar]
  • 15.El-Dahr S, Hilliard S, Aboudehen K, Saifudeen Z. The MDM2-p53 pathway: multiple roles in kidney development. Pediatr Nephrol 29: 621–627, 2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.El-Dahr SS, Saifudeen Z. Interactions between BdkrB2 and p53 genes in the developing kidney. Biol Chem 394: 347–351, 2013 [DOI] [PubMed] [Google Scholar]
  • 17.Fan H, Harrell JR, Dipp S, Saifudeen Z, El-Dahr SS. A novel pathological role of p53 in kidney development revealed by gene-environment interactions. Am J Physiol Renal Physiol 288: F98–F107, 2005 [DOI] [PubMed] [Google Scholar]
  • 19.Fan H, Stefkova J, El-Dahr SS. Susceptibility to metanephric apoptosis in bradykinin B2 receptor null mice via the p53-Bax pathway. Am J Physiol Renal Physiol 291: F670–F682, 2006 [DOI] [PubMed] [Google Scholar]
  • 21.Harrison-Bernard LM, Dipp S, El-Dahr SS. Renal and blood pressure phenotype in 18-mo-old bradykinin B2R(-/-)CRD mice. Am J Physiol Regul Integr Comp Physiol 285: R782–R790, 2003 [DOI] [PubMed] [Google Scholar]
  • 22.Kerecuk L, Schreuder MF, Woolf AS. Renal tract malformations: perspectives for nephrologists. Nat Clin Pract Nephrol 4: 312–325, 2008 [DOI] [PubMed] [Google Scholar]
  • 23.Latham KE, Sapienza C, Engel N. The epigenetic lorax: gene-environment interactions in human health. Epigenomics 4: 383–402, 2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Lelievre-Pegorier M, Vilar J, Ferrier ML, Moreau E, Freund N, Gilbert T, Merlet-Benichou C. Mild vitamin A deficiency leads to inborn nephron deficit in the rat. Kidney Int 54: 1455–1462, 1998 [DOI] [PubMed] [Google Scholar]
  • 25.Madeddu P, Emanueli C, El-Dahr S. Mechanisms of disease: the tissue kallikrein-kinin system in hypertension and vascular remodeling. Nat Clin Pract Nephrol 3: 208–221, 2007 [DOI] [PubMed] [Google Scholar]
  • 26.Mallo M, Wellik DM, Deschamps J. Hox genes and regional patterning of the vertebrate body plan. Dev Biol 344: 7–15, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Narlis M, Grote D, Gaitan Y, Boualia SK, Bouchard M. Pax2 and pax8 regulate branching morphogenesis and nephron differentiation in the developing kidney. J Am Soc Nephrol 18: 1121–1129, 2007 [DOI] [PubMed] [Google Scholar]
  • 28.Ostrom L, Tang MJ, Gruss P, Dressler GR. Reduced Pax2 gene dosage increases apoptosis and slows the progression of renal cystic disease. Dev Biol 219: 250–258, 2000 [DOI] [PubMed] [Google Scholar]
  • 29.Patterson LT, Potter SS. Hox genes and kidney patterning. Curr Opin Nephrol Hypertens 12: 19–23, 2003 [DOI] [PubMed] [Google Scholar]
  • 30.Pfeffer PL, Payer B, Reim G, di Magliano MP, Busslinger M. The activation and maintenance of Pax2 expression at the mid-hindbrain boundary is controlled by separate enhancers. Development 129: 307–318, 2002 [DOI] [PubMed] [Google Scholar]
  • 31.Porteous S, Torban E, Cho NP, Cunliffe H, Chua L, McNoe L, Ward T, Souza C, Gus P, Giugliani R, Sato T, Yun K, Favor J, Sicotte M, Goodyer P, Eccles M. Primary renal hypoplasia in humans and mice with PAX2 mutations: evidence of increased apoptosis in fetal kidneys of Pax2(1Neu) +/- mutant mice. Hum Mol Genet 9: 1–11, 2000 [DOI] [PubMed] [Google Scholar]
  • 32.Quinlan J, Lemire M, Hudson T, Qu H, Benjamin A, Roy A, Pascuet E, Goodyer M, Raju C, Zhang Z, Houghton F, Goodyer P. A common variant of the PAX2 gene is associated with reduced newborn kidney size. J Am Soc Nephrol 18: 1915–1921, 2007 [DOI] [PubMed] [Google Scholar]
  • 33.Rao A. Signaling to gene expression: calcium, calcineurin and NFAT. Nat Immunol 10: 3–5, 2009 [DOI] [PubMed] [Google Scholar]
  • 34.Reidy KJ, Rosenblum ND. Cell and molecular biology of kidney development. Sem Nephrol 29: 321–337, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Saifudeen Z, Dipp S, Stefkova J, Yao X, Lookabaugh S, El-Dahr SS. p53 regulates metanephric development. J Am Soc Nephrol 20: 2328–2337, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Saisawat P, Tasic V, Vega-Warner V, Kehinde EO, Gunther B, Airik R, Innis JW, Hoskins BE, Hoefele J, Otto EA, Hildebrandt F. Identification of two novel CAKUT-causing genes by massively parallel exon resequencing of candidate genes in patients with unilateral renal agenesis. Kidney Int 81: 196–200, 2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Salomon R, Tellier AL, Attie-Bitach T, Amiel J, Vekemans M, Lyonnet S, Dureau P, Niaudet P, Gubler MC, Broyer M. PAX2 mutations in oligomeganephronia. Kidney Int 59: 457–462, 2001 [DOI] [PubMed] [Google Scholar]
  • 38.Schedl A. Renal abnormalities and their developmental origin. Nat Rev Genet 8: 791–802, 2007 [DOI] [PubMed] [Google Scholar]
  • 39.Schmidt-Ott KM, Barasch J. WNT/beta-catenin signaling in nephron progenitors and their epithelial progeny. Kidney Int 74: 1004–1008, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Sen N, Satija YK, Das S. p53 and metabolism: old player in a new game. Transcription 3: 119–123, 2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Terzic J, Muller C, Gajovic S, Saraga-Babic M. Expression of PAX2 gene during human development. Int J Dev Biol 42: 701–707, 1998 [PubMed] [Google Scholar]
  • 42.Torban E, Eccles MR, Favor J, Goodyer PR. PAX2 suppresses apoptosis in renal collecting duct cells. Am J Pathol 157: 833–842, 2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Weber S, Moriniere V, Knuppel T, Charbit M, Dusek J, Ghiggeri GM, Jankauskiene A, Mir S, Montini G, Peco-Antic A, Wuhl E, Zurowska AM, Mehls O, Antignac C, Schaefer F, Salomon R. Prevalence of mutations in renal developmental genes in children with renal hypodysplasia: results of the ESCAPE study. J Am Soc Nephrol 17: 2864–2870, 2006 [DOI] [PubMed] [Google Scholar]
  • 44.Wellik DM. Hox genes and kidney development. Pediatr Nephrol 26: 1559–1565, 2011 [DOI] [PubMed] [Google Scholar]
  • 45.Woods LL, Ingelfinger JR, Nyengaard JR, Rasch R. Maternal protein restriction suppresses the newborn renin-angiotensin system and programs adult hypertension in rats. Pediatr Res 49: 460–467, 2001 [DOI] [PubMed] [Google Scholar]
  • 46.Woods LL, Rasch R. Perinatal ANG II programs adult blood pressure, glomerular number, and renal function in rats. Am J Physiol Regul Integr Comp Physiol 275: R1593–R1599, 1998 [DOI] [PubMed] [Google Scholar]
  • 47.Woolf AS, Price KL, Scambler PJ, Winyard PJ. Evolving concepts in human renal dysplasia. J Am Soc Nephrol 15: 998–1007, 2004 [DOI] [PubMed] [Google Scholar]

Articles from Physiological Genomics are provided here courtesy of American Physiological Society

RESOURCES