Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2014 Jul 18;289(36):25306–25316. doi: 10.1074/jbc.M114.557546

The Intestinal Epithelial Cell Differentiation Marker Intestinal Alkaline Phosphatase (ALPi) Is Selectively Induced by Histone Deacetylase Inhibitors (HDACi) in Colon Cancer Cells in a Kruppel-like Factor 5 (KLF5)-dependent Manner*

Joongho Shin ‡,1, Azadeh Carr ‡,1, Georgia A Corner §, Lars Tögel §, Mercedes Dávaos-Salas §,2, Hoanh Tran §, Anderly C Chueh §, Sheren Al-Obaidi §, Fiona Chionh §, Naseem Ahmed ‡, Daniel D Buchanan , Joanne P Young , Madhu S Malo ‖, Richard A Hodin ‖, Diego Arango **, Oliver M Sieber ‡‡, Leonard H Augenlicht ‡, Amardeep S Dhillon §§, Thomas K Weber ¶¶, John M Mariadason ‡,§,3
PMCID: PMC4155692  PMID: 25037223

Background: Differentiation induction represents a potential cancer treatment strategy.

Results: Colon cancer cell lines respond differentially to HDACi-mediated induction of the differentiation marker ALPi. HDACi induction of ALPi is KLF5-dependent.

Conclusion: HDACi induce ALPi in a subset of colon cancer cell lines in a KLF5-dependent manner.

Significance: Colon cancer cell lines are differentially responsive to HDACi-induced differentiation.

Keywords: Colon Cancer, Differentiation, DNA Methylation, Histone Deacetylase Inhibitor (HDAC Inhibitor) (HDI), Kruppel-like Factor (KLF), CIMP, HDAC

Abstract

The histone deacetylase inhibitor (HDACi) sodium butyrate promotes differentiation of colon cancer cells as evidenced by induced expression and enzyme activity of the differentiation marker intestinal alkaline phosphatase (ALPi). Screening of a panel of 33 colon cancer cell lines identified cell lines sensitive (42%) and resistant (58%) to butyrate induction of ALP activity. This differential sensitivity was similarly evident following treatment with the structurally distinct HDACi, MS-275. Resistant cell lines were significantly enriched for those harboring the CpG island methylator phenotype (p = 0.036, Chi square test), and resistant cell lines harbored methylation of the ALPi promoter, particularly of a CpG site within a critical KLF/Sp regulatory element required for butyrate induction of ALPi promoter activity. However, butyrate induction of an exogenous ALPi promoter-reporter paralleled up-regulation of endogenous ALPi expression across the cell lines, suggesting the presence or absence of a key transcriptional regulator is the major determinant of ALPi induction. Through microarray profiling of sensitive and resistant cell lines, we identified KLF5 to be both basally more highly expressed as well as preferentially induced by butyrate in sensitive cell lines. KLF5 overexpression induced ALPi promoter-reporter activity in resistant cell lines, KLF5 knockdown attenuated butyrate induction of ALPi expression in sensitive lines, and butyrate selectively enhanced KLF5 binding to the ALPi promoter in sensitive cells. These findings demonstrate that butyrate induction of the cell differentiation marker ALPi is mediated through KLF5 and identifies subsets of colon cancer cell lines responsive and refractory to this effect.

Introduction

The short chain fatty acid sodium butyrate is a potent inhibitor of histone deacetylase (HDAC)4 activity. Through this mechanism, butyrate induces a number of anti-tumor effects on colon cancer cells, including growth arrest, apoptosis, and cellular differentiation (1).

Differentiation therapy represents a potential treatment strategy for cancer (2). The value of this approach is underscored by the efficacy of all-trans-retinoic acid in the treatment of acute promyelocytic leukemia, which induces the differentiation of acute promyelocytic leukemia cells into granulocytes (3). Differentiation of colon cancer cells in response to butyrate treatment is evident by the improved barrier function of colon cancer cell monolayers (4), the formation of dome-like structures that are a feature of vectorial water transport (4), and by the increased expression of intestinal alkaline phosphatase (ALPi) (4).

ALPi is found in high concentrations in the brush border of intestinal epithelial cells, primarily in the small intestine, and catalyzes the hydrolysis of phosphomonoesters with release of inorganic phosphate and alcohol (5). ALPi is also found in surfactant-like particles, which are produced by enterocytes and secreted in two directions, toward the intestinal lumen and toward the bloodstream, suggesting a role in regulating the rate of lipid absorption (6). Coincident with such a role, ALPi levels are elevated in the serum following lipid consumption (6, 7), and mice lacking ALPi gain more weight when fed a high fat diet due to accelerated lipid absorption (8). Recently, a role for ALPi in the detoxification of lipopolysaccharide and prevention of bacterial invasion across the gut mucosal barrier has also been demonstrated (9).

The mechanism by which sodium butyrate induces ALPi gene expression has been investigated in detail in colon cancer cells (10–12) and shown to occur at the level of transcription, to require new protein synthesis, and to be dependent on a KLF/Sp-related cis regulatory element located 76 bp upstream of the transcription start site (10). Although multiple candidate transcription factors that regulate basal ALPi expression have been identified, including members of the Sp transcription factor family (10), KLF4 (13), ZBP89 (14), and Cdx-1 (15), the transcription factor or factors that drive ALPi induction in response to butyrate treatment remain unknown.

The aim of this study was to further elucidate the mechanism by which the HDACi, sodium butyrate, induces ALPi expression in colon cancer cells and to determine whether colon cancer cell lines sensitive and resistant to differentiation induction could be identified. Screening of a panel of 33 colon cancer cell lines identified 19 lines (58%) in which butyrate failed to induce ALP enzyme activity. These refractory lines were significantly enriched for those harboring the CIMP phenotype. Furthermore, through gene expression profiling and direct functional studies, we identified KLF5 as a key regulator of butyrate induction of ALPi in colon cancer cells.

EXPERIMENTAL PROCEDURES

Cell Culture

The source of the colon cancer cell lines utilized has been described previously (16). Cells were maintained in minimal essential media supplemented with 10% FBS, 1% HEPES buffer, and penicillin-streptomycin (50 units/ml and 50 μg/ml, respectively) at 37 °C with 5% CO2.

Western Blotting

Antibodies used in Western blot analysis were anti-KLF5 (07-1580, Millipore), anti-ALPi (ab97532, Abcam), and anti-β-actin (Sigma, A5316).

Quantitative Real-time PCR

Total RNA was extracted from untreated or HDACi treated cells using the RNeasy mini Plus kit (Qiagen). Five micrograms of total RNA were reverse transcribed using oligo(dT) primers and Superscript III (Invitrogen) and normalized to actin mRNA levels. Expression of ALPi was determined by quantitative real-time PCR using the TaqMan assay Hs00897935_gH (Applied Biosystems, Foster City, CA). Expression of a second butyrate target gene, sodium-dependent inorganic phosphate cotransporter, member 7 (SLC17A7), was determined using SYBR green with the following primers: CTACGGGGTCTTTGCTTCTG (forward) and GGCTGAAATGTGCTGTGTGT (reverse) and normalized for actin expression (CACCTTCACCGTTCCAGTTT (forward) and GATGAGATTGGCATGGCTTT (reverse)).

ALP Enzyme Activity Assays

ALP activity was determined on lysed cell pellets by colorimetric assay as described by Young et al. (17) using p-nitrophenyl phosphate as substrate. ALP activity was expressed relative to total cellular protein quantified using the Bradford assay (18). ALP activity was also determined immunocytochemically using the Vector red alkaline phosphatase substrate kit I (Vector Laboratories, Burlingame, CA) according to the manufacturer's instructions.

ALPi Promoter Reporter Assays

ALPi promoter luciferase constructs have been described previously (14). The KLF/Sp site in the pFRL7-IAP-1 construct (renamed pFRL7-ALPi-1 in this work) was mutated by site-directed mutagenesis using the QuikChange II site-directed mutagenesis kit from Stratagene (La Jolla, CA). Cells were transiently transfected with ALPi promoter-reporter constructs using the Lipofectamine 2000 transfection reagent (Invitrogen) and treated with sodium butyrate for 24 h. Reporter activity was measured using the Dual-Luciferase reporter assay kit from Promega (Madison, WI) and normalized for induction of the control pFRL7 vector and total cellular protein.

Bisulfite Conversion and Sequencing

The methylation status of the ALPi promoter was determined by isolation of genomic DNA from each cell line using Qiagen's DNA extraction kit (Qiagen, Valenica, CA), and bisulfite converted using the Qiagen Epitect Bisulfite conversion kit (Qiagen). For each cell line, triplicate PCR amplifications were performed using Platinum TaqDNA High Fidelity Polymerase (Invitrogen). Primer sequences used to amplify ALPi were as follows: GGAAGATTTAGTTTAGGTTTGGTTGA (forward) and ACCCAAAACCCCTACATATCTTAAA (reverse). PCR products were pooled and ligated into the pCR2.1 TOPO TA vector (Invitrogen), and 1 μl of each ligation used to transform TOP10F′ competent cells. Clones were assessed for the presence of insert by restriction digestion and positive clones directly sequenced using the M13 primer. Sequence chromatograms were visually inspected then aligned with reference sequences to calculate the percent methylation at each CpG site using BiQ Analyzer (19) and JalView (20). A minimum of 10 clones were analyzed for each cell line.

Sequenom Assay

For assessment of ALPi gene promoter methylation using the Sequenom assay, 1.0 μg of genomic DNA was bisulfite-treated using the Zymo Research EZ DNA Methylation kit with several changes as recommended for Sequenom processing. Two regions of the ALPi promoter were amplified using the following primers created using the Epidesigner program (F1, TTTGGTTTTAGGTTATAGGATTGGG; R1, AAACAAACCTTACTCACTCACCATC; F2, GGAAGATTTAGTTTAGGTTTGGTTGA; R2, ACCCAAAACCCCTACATATCTTAAA). Forward primers were synthesized with a 10-mer tag (5′-AGGAAGAGAG-3′ gene-specific sequence). All reverse primers were created with a T7 promoter tag (5′-CAGTAATACGACTCACTATAGGGAGAAGGCT-3′ gene-specific sequence). PCR products were analyzed using the MASSARRAY platform, and data were analyzed using the EpiTYPER program.

CIMP Status

CIMP status was determined using the MethyLight assay for the five markers RUNX3, CACNA1G, SOCS1, NEUROG1, and IGF2 (21). As a control, we used a non-methylation-dependent reaction designed for a consensus Alu repetitive element sequence (21), which is a sensitive measure of very low amounts of DNA and is less prone to quantitation errors introduced by gene copy anomalies. A CIMP marker was considered methylation-positive by the presence of an amplification product for the methylation marker and the Alu reference control probe. Markers were considered methylation negative if no marker-specific probe amplification was detected in the presence of amplification of the Alu reference probe, with a Ct value of <25. Cell lines were classified as CIMP-positive when three or more markers were positive for methylation (21).

Chromatin Immunoprecipitation (ChIP)

ChIP analysis was performed as described previously (22). Antibodies used were KLF5 (AF3758, R&D Systems), AcH3 (06-599, Millipore), H3K4Me3 (Ab8580, Abcam), and histone H3 (sc8564, Santa Cruz Biotechnology) or IgG control. The ALPi promoter region comprising the KLF5/Sp site was amplified by qRT-PCR and the mean enrichment relative to input computed. Primers used to amplify the ALPi promoter were 5′-GCCACACCCAGTCCCTTCCC-3′ (forward) and 5′-CTGTAAATGCTCCACGTCCC-3′ (reverse).

Microarray Analyses

Colon cancer cell lines were treated with 5 mm sodium butyrate for 72 h. Total RNA was extracted, and gene expression changes were determined using Affymetrix U133 Plus microarrays (version 2.0) using standard protocols. For each cell line, experiments were performed on two independent occasions. The mean expression value was computed for each gene and utilized in subsequent analyses.

Statistical Analyses

Unpaired Student's t tests were used to compare groups and were two-sided unless stated otherwise. Chi square tests were used to compare associations between ALP induction and CIMP and microsatellite instability status. Values shown are mean ± S.E., unless otherwise stated.

RESULTS

Identification of Colon Cancer Cell Lines Sensitive and Resistant to Butyrate Induction of ALPi

Sodium butyrate has been shown to induce expression and activity of the marker of absorptive cell differentiation ALPi in colon cancer cells (23). To determine the distribution of this effect across multiple colon cancer cell lines, we screened a panel of 33 cell lines for butyrate induction of ALP activity over a 144-h time course. Butyrate induced ALP activity >10-fold (for at least one time point) in 14 of the 33 lines (Fig. 1A, supplemental Table 1). Surprisingly, we also identified a second group of 19 cell lines (58%), which were largely resistant to butyrate induction of ALP activity (defined as <10-fold induction at all time points) (Fig. 1B and supplemental Table 1). The differential induction of ALP enzyme activity was confirmed at the protein level (Fig. 1C) and by immunocytochemical staining (Fig. 1D).

FIGURE 1.

FIGURE 1.

A and B, identification of colon cancer cell lines sensitive and resistant to butyrate induction of ALP activity. Colon cancer cell lines were treated with 5 mm sodium butyrate for 12–144 h, and ALP activity was determined spectrophotometrically. Cell lines in which ALP enzyme activity was induced >10-fold in at least one time point are shown in A and those in which it was not are shown in B. C, butyrate induction of ALPi protein expression in a sensitive and resistant cell line. D, immunocytochemical detection of ALP activity (red staining) in a representative sensitive (T84) and resistant (RKO) cell line. E, butyrate induction of ALPi mRNA expression in four representative sensitive and resistant colon cancer cell lines. Each cell line was treated with 5 mm butyrate for 72 h, and induction of ALPi was assessed by qRT-PCR using a TaqMan assay. Values shown are mean ± S.E. from a representative experiment performed in triplicate. F, breakdown of sensitive and resistant cell lines according to microsatellite instability status. MSS, microsatellite stable; MSI, microsatellite instability. G, breakdown of sensitive and resistant cell lines according to CIMP status. Groups were compared using a Chi square test.

To determine whether the differential induction of ALP enzyme activity corresponded with differential induction of ALPi mRNA expression, four sensitive and four resistant cell lines were treated with butyrate for 72 h, and ALPi mRNA induction determined by quantitative real time PCR. Consistent with the induction of ALP enzyme activity, butyrate induced ALPi mRNA expression to significantly higher levels in sensitive (185.0 × 10−4 ± 101.0 × 10−4 mean ± S.E.) compared with resistant cell lines (1.0 × 10−4 ± 1.0 × 10−4, p = 0.0146 unpaired t test) (Fig. 1E).

We next determined whether sensitivity or resistance to butyrate induction of ALPi was linked to known colon cancer subtypes. Of the sensitive lines, 64% were microsatellite stable and 71% were CIMP low. In contrast, among the butyrate-resistant lines, 58% exhibited microsatellite instability (p = 0.30, Chi square test) and 68% were CIMP high (p = 0.036, Chi square test) (Fig. 1, F and G).

We also confirmed the differential induction of ALPi mRNA in a sensitive and resistant cell line over an extended time course. As shown in Fig. 2A, butyrate induction of ALPi mRNA in the sensitive T84 cell line was first evident 24–48 h post-treatment and increased progressively through 120 h. Conversely, in the resistant RKO line, minimal induction of ALPi mRNA was evident at each time point examined (Fig. 2A). Notably, expression of an independent HDACi target gene, SLC17A7, was robustly induced in both T84 and RKO cells, indicating the failure to induce ALPi expression in RKO cells was specific to this gene and not a reflection of a general resistance of this line to butyrate (Fig. 2B).

FIGURE 2.

FIGURE 2.

Butyrate induction of ALPi and SLC17A7 in a representative sensitive and resistant colon cancer cell line. Butyrate-sensitive T84 cells and butyrate-resistant RKO cells were treated with 5 mm butyrate for 12–144 h. Changes in ALPi (A) and a second butyrate target gene SLC17A7 (B) were examined by qRT-PCR.

Finally, we sought to determine whether the differential response of colon cancer cell lines to butyrate induction of ALPi was also consistent for other structurally distinct HDACi. To test this, the four sensitive and resistant cell lines were treated for 72 h with MS275, a representative of the benzamide class of HDACi. Similar to the effects induced by butyrate, induction of ALPi in response to MS275 was significantly higher in the sensitive compared with the resistant cell lines (51.0 × 10−4 ± 16.0 × 10−4 versus 6.0 × 10−4 ± 4.0 × 10−4 means ± S.E., p = 0.036, unpaired t test) (Fig. 3A). As observed for butyrate, MS275 induced expression of SLC17A7 to a similar extent in sensitive and resistant lines, indicating the failure to induce ALPi expression was specific to this gene (Fig. 3B).

FIGURE 3.

FIGURE 3.

MS275 induction of ALPi and SLC17A7 mRNA expression in the four representative sensitive and four resistant colon cancer cell lines. Each cell line was treated with MS275 (2.5 μm) for 72 h and induction of ALPi (A) or SLC17A7 (B) assessed by qRT-PCR. Values shown are mean ± S.D. from a representative experiment performed in triplicate.

Butyrate Induction of ALPi Promoter Activity Is Dependent on a KLF/Sp Regulatory Element in the ALPi Promoter

Butyrate induction of ALPi gene expression has been shown to be transcriptionally mediated and dependent on a KLF/Sp-related cis regulatory element located 76 bp upstream of the transcription start site (10). To confirm this finding using promoter reporter assays, we transiently transfected butyrate responsive T84 cells with a series of 10 ALPi promoter reporter deletion constructs (14) and determined the effect of butyrate treatment on ALPi reporter activity. As shown in Fig. 4A, butyrate induced activity of all constructs (10.7- to 20.1-fold), however pFRL7-ALPi-10 which lacks the KLF/Sp regulatory element, was only induced 4.3-fold. To further confirm this finding, we performed site-directed mutagenesis of the KLF/Sp element, whereby the central GGC sequence was converted to GGA, GAA, or AAA. In comparison with the WT promoter that was induced 15.3-fold by butyrate, activity was induced 12.6-, 3.4-, and 3.7-fold upon introduction of the GGC to GGA, GGC to GAA, and GGC to AAA mutations, respectively (Fig. 4B). These results confirm the previous findings implicating a critical role for the KLF/Sp element in butyrate induction of ALPi promoter activity.

FIGURE 4.

FIGURE 4.

A, butyrate induction of ALPi promoter activity is dependent on a KLF/Sp-binding site. T84 cells were transiently transfected with a series of ALPi promoter-reporter constructs and treated with 5 mm butyrate for 24 h. Reporter activity was determined by measurement of luciferase activity and normalized for total cellular protein. B, butyrate induction of WT ALPi promoter activity and of constructs in which the KLF/Sp binding site has been mutated. ***, p < 0.0005, two-sided unpaired t test.

The KLF/Sp-binding Site in the ALPi Promoter Is Selectively Methylated in Resistant Colon Cancer Cell Lines

Although the ALPi promoter does not harbor a bona fide CpG island, the presence of a CpG dinucleotide within the critical KLF/Sp regulatory element (GGGCGGG) and the association between CIMP-high status of colon cancer cell lines and resistance to butyrate induction of ALPi prompted us to examine whether methylation of this site and surrounding region could be the basis for resistance. To address this, genomic DNA was isolated and bisulfite converted from the four sensitive and four resistant cell lines. Two fragments of the ALPi promoter, one spanning the KLF/Sp site, were PCR-amplified and subjected to direct sequencing. Consistent methylation of a number of CpG sites, including the KLF/Sp site, was evident in all four resistant cell lines (Fig. 5, A and B). Conversely, these same sites were largely unmethylated in the four sensitive lines (Fig. 5, A and B). Notably, the differential methylation between sensitive and resistant cells was most prominent at the KLF/Sp site (−76 bp), where the average percentage methylation was 93.0 ± 6.0 in the four resistant lines compared with 17.8 ± 6.0 in the four sensitive lines (n = 4, p < 0.00005, unpaired t test). To confirm this finding using an independent assay, DNA from these same cell lines was again bisulfite-converted and methylation status interrogated using the Sequenom assay. Consistent with the direct sequencing results, significantly higher methylation of multiple CpG sites within the ALPi promoter, including the KLF/Sp site, was observed in the refractory cell lines (Fig. 5, C and D).

FIGURE 5.

FIGURE 5.

Differential methylation of the ALPi promoter in colon cancer cell lines. A, the methylation status of the ALPi promoter was determined by bisulfite conversion and direct sequencing of the four sensitive (blue symbols) and four resistant cell lines (red symbols). B, representative chromatograms showing differential methylation of the KLF/Sp site (GGGCGGG) in cell lines sensitive and resistant to butyrate induction of ALP activity. C, assessment of ALPi promoter methylation in four sensitive and four resistant colon cancer cell lines using the Sequenom assay. D, quantitation of the sequenom data. *, p < 0.05, two-sided unpaired t test.

Butyrate Induction of Exogenous ALPi Promoter Activity Parallels Induction of Endogenous ALP Expression in Colon Cancer Cell Lines

Although these findings demonstrate an association between ALPi promoter methylation status and the lack of inducibility of ALPi mRNA by butyrate, they do not directly establish methylation as the primary determinant for the failure to induce ALPi. To investigate this further, we transiently transfected an ALPi promoter reporter construct (pFRL7-ALPi-9) into the four butyrate sensitive and resistant cell lines and determined the change in promoter reporter activity in response to butyrate treatment. Butyrate induction of ALPi promoter activity was significantly higher in the four sensitive cell lines at all three concentrations tested, paralleling induction of the endogenous ALPi gene (Fig. 6). These findings suggest that although endogenous ALPi promoter methylation status was associated with inducibility, it may not be the primary determinant of this effect. Instead, these data suggest that butyrate induction of endogenous ALPi gene expression may be dependent on the presence or absence of specific transcriptional regulators.

FIGURE 6.

FIGURE 6.

Butyrate induction of ALPi promoter activity in sensitive and resistant cell lines. The four sensitive and resistant cell lines were transiently transfected with the ALPi promoter-reporter construct (pFRL7-ALPi-9) or pFRL7. Cells were treated with or without 5 mm sodium butyrate for 24 h, and luciferase reporter activity was determined using the Promega luciferase assay. Butyrate (But) induction of pFRL7-ALPi-9 luciferase activity was normalized to corresponding induction of pFRL7 activity (empty vector control) and to total cellular protein. Values shown are the mean ± S.E. fold induction of the four sensitive and resistant lines from a single experiment, with each cell line assayed in triplicate. The entire experiment was repeated on two independent occasions, and similar results were obtained. *, p < 0.05; **, p < 0.005 two-sided unpaired t test.

Identification of Transcription Factors Differentially Expressed between ALP-sensitive and -resistant Cell Lines

To identify this putative transcription factor or factors, we treated the four ALP-sensitive and -resistant cell lines with 0 or 5 mm butyrate for 72 h and identified genes altered in expression using Affymetrix microarrays. Each cell line was profiled in duplicate. In addition, we used an existing in-house Affymetrix microarray database to identify transcription factors with basal differential expression between butyrate-sensitive and -resistant colon cancer cell lines. We applied the criteria that the candidate transcription factor(s) should be (1) selectively induced by butyrate in sensitive cell lines and/or (2) basally differentially expressed between sensitive and resistant cell lines. Furthermore, we focused specifically on those transcription factors known to bind KLF/Sp response elements, as this was an essential regulatory element required for butyrate induction of ALPi. The transcription factor that satisfied the first of these criteria with the strongest statistical significance was KLF5 (Fig. 7A). KLF5 mRNA expression was significantly induced following butyrate treatment in the four sensitive cell lines (p = 0.01) but not the resistant lines (p = 0.49) (Fig. 7A). The preferential induction of KLF5 by butyrate was independently confirmed by qRT-PCR and Western blotting in a time course analysis in two sensitive (T84, SKCO1) and two resistant (LIM2405, RKO) cell lines (Fig. 7, B and C). Furthermore, as shown in Fig. 7D, basal KLF5 expression was significantly higher in sensitive lines (p = 0.004, unpaired t test).

FIGURE 7.

FIGURE 7.

A–C, KLF5 is preferentially induced by butyrate in sensitive cell lines. A, the four representative sensitive and resistant cell lines were treated with 5 mm butyrate for 72 h, and global gene expression levels pre- and post-treatment were determined using Affymetrix microarrays. KLF5 mRNA was found to be selectively induced by butyrate in the sensitive lines. B and C, butyrate induction of KLF5 mRNA and protein expression in two sensitive and two resistant cell lines. Cells were treated with 5 mm butyrate for 8–72 h, and KLF5 mRNA expression was determined by quantitative real-time PCR (B) and Western blotting (C). Con, control; B5, butyrate 5 mm. D, basal KLF5 mRNA expression in sensitive and resistant colon cancer cell lines. KLF5 mRNA levels were determined by Affymetrix microarray profiling of n = 13 sensitive (Sens.) and n = 17 resistant (Res.) cell lines for which microarray data were available. *, p = 0.004, two-sided unpaired t test.

KLF5 Overexpression Induces ALPi Promoter Activity

To determine whether KLF5 can induce ALPi promoter activity, we co-transfected the butyrate-resistant RKO cell line with a KLF5 expression vector in combination with an ALPi promoter reporter construct. As shown in Fig. 8A, KLF5 overexpression induced a 2-fold increase of ALPi promoter activity in RKO cells.

FIGURE 8.

FIGURE 8.

A, KLF5 overexpression induces ALPi promoter activity. RKO cells were transiently transfected with a KLF5 expression vector or empty vector (EV) control along with the control reporter construct (pFRL7) or the ALPi promoter reporter, pFRL7-ALPi-9. Promoter reporter activity was determined using the dual luciferase reporter assay 48 h post transfection. Values shown are the mean ± S.D. from a representative experiment. The experiment was performed on two independent occasions with similar findings observed on both occasions. B, ChIP analysis demonstrating enhanced binding of KLF5 to the endogenous ALPi promoter in response to butyrate treatment in sensitive T84 cells but not resistant RKO cells. Parallel induction of the active transcription marks H3Ac and H3K4Me3 was observed in T84 cells. **, p < 0.005 two-sided t test; #, p < 0.05, one-sided t test. Con, control; B5, butyrate 5 mm.

To determine whether KLF5 physically interacted with the KLF/Sp binding site in the ALPi promoter following butyrate treatment, we performed ChIP analysis in the butyrate sensitive T84 cell line. Consistent with induction of ALPi mRNA expression in this cell line, we observed a 27- ± 6-fold increase in KLF5 occupancy of the ALPi promoter following butyrate treatment. We also observed a parallel increase in the active transcription marks AcH3 and H3K4Me3 following butyrate treatment. In contrast, no increase in KLF5 occupancy or of the active transcription marks H3Ac and H3K4Me3 were observed in the resistant RKO cell line following butyrate treatment (Fig. 8B).

Knockdown of KLF5 Attenuates Butyrate Induction of ALPi Gene Expression

To further determine whether KLF5 is directly required for butyrate induction of ALPi gene expression, we knocked down KLF in T84 cells using a pool of KLF5-targeting siRNAs. Transfection with this siRNA pool resulted in a 45% down-regulation of KLF5 mRNA expression. To reduce the possibility of off-target effects, we also transfected T84 cells with the four individual siRNAs comprising the siRNA pool and identified siRNAs KLF5.2, KLF5.3, and KLF5.4 as able to inhibit KLF5 expression, whereas KLF5.1 was found to be non-functional (Fig. 9A). Transfection of T84 cells with the KLF5 siRNA pool, or siRNAs KLF5.2, 5.3, and 5.4 but not KLF5.1, significantly attenuated basal and butyrate induction of ALPi mRNA and protein expression (Fig. 9, B and C) and butyrate induction of ALP enzyme activity (Fig. 9, D and E). No effect on basal ALP enzyme activity was observed (Fig. 9D), possibly due to the contribution of other ALP isoforms (tissue-nonspecific (liver/bone/kidney) alkaline phosphatase, placental alkaline phosphatase, and placental-like alkaline phosphatase) to ALP activity. Collectively, these findings demonstrate that butyrate induction of the differentiation marker ALPi is dependent on induction of KLF5 and occurs in a subset of colon cancer cell lines.

FIGURE 9.

FIGURE 9.

KLF5 knockdown attenuates butyrate induction of ALPi expression. T84 cells were transiently transfected with a non-targeting (NT) control siRNA, a pool of four KLF5 targeting siRNAs, or individual members of the pool, followed by butyrate treatment for 72 h. A, knockdown efficiency of basal KLF5 mRNA expression. B–E, effect of KLF5 knockdown on butyrate induction of ALPi mRNA expression (B), ALPi protein expression (C), and ALP enzyme activity (D and E). *, p < 0.05; #, p < 0.005, two-sided unpaired t test. mU, milliunits.

DISCUSSION

ALPi is a widely used marker of absorptive intestinal epithelial cell differentiation (4). Here, we report that induction of ALPi mRNA and enzyme activity in response to butyrate treatment is heterogeneous among colon cancer cell lines, with sensitive and resistant cell lines readily identifiable.

The differential sensitivity of colon cancer cell lines to butyrate induction of ALP was also evident for the structurally distinct HDACi, MS-275, indicating butyrate induction of ALPi is most likely a consequence of HDAC inhibition. This finding is also important because although the clinical utility of butyrate is limited by its rapid metabolism, MS-275 (entinostat) is undergoing clinical testing for anti-tumor activity and was recently shown to improve overall survival in post-menopausal women with ER+ advanced breast cancer, when combined with the aromatase inhibitor exemestane (24).

Notably, cell lines resistant to butyrate induction of ALPi were significantly enriched for those harboring the CpG island methylator phenotype (CIMP), which manifests as the co-ordinate methylation of multiple loci (25). CIMP high colon cancers have a number of distinct clinicopathologic features, including preponderance in females, higher frequencies of BRAF mutations, microsatellite instability, and location of tumors within the proximal colon (26). The current findings demonstrate that an additional feature of this subset of colon cancers is increased resistance to differentiation induction by HDACi. Notably, CIMP high colon cancers are also associated with mucinous and poorly differentiated histology (26), raising the possibility that failure to undergo HDACi-induced differentiation may be linked to the poorly differentiated basal state of these tumors.

Consistent with the association with CIMP status, we also observed that resistant cell lines had significantly higher levels of ALPi promoter methylation, particularly of a CpG dinucleotide located within the key KLF/Sp regulatory element. However, butyrate induction of an exogenous ALPi promoter reporter paralleled induction of the endogenous gene across the cell line panel, suggesting the presence or absence of a key transcriptional regulator is likely to be the key determinant of butyrate induction of ALPi.

Butyrate-induction of ALPi mRNA is dependent on new protein synthesis and a key KLF/Sp regulatory element within the ALPi promoter (27). We therefore sought to identify transcription factors capable of binding this site, which were either selectively induced by butyrate in sensitive cells or which were basally differentially expressed between sensitive and resistant cell lines. This screen identified the C2H2 zinc finger transcription factor KLF5 as both preferentially induced by butyrate and basally more highly expressed in sensitive cell lines. Consistent with ALPi being a direct target of KLF5, KLF5 overexpression induced ALPi promoter activity, KLF5 knockdown inhibited endogenous ALPi expression, and KLF5 was localized to the ALPi promoter following butyrate treatment.

A role for KLF5 in regulating expression of ALPi is consistent with its high level of expression in the intestinal tract (28) and animal studies demonstrating its requirement for normal intestinal cell differentiation (29, 30). Specifically, variegated deletion of KLF5 in the intestinal tract results in loss of expression of the differentiation regulators Cdx-1 and Cdx-2, aberrant localization of differentiated cells along the crypt-villus axis, and impaired barrier function (29). Similarly, a more recent study demonstrated that deletion of KLF5 in the fetal intestinal epithelium reduced expression of several regulators of intestinal cell differentiation (Elf3, Atoh1, Ascl2, Neurog3, HNF4α, and Cdx1), impaired villus morphogenesis, and resulted in loss of the apical brush border characteristic of differentiated enterocytes (30). These findings highlight a key role for KLF5 in the regulation of intestinal cell differentiation, a role that has also been ascribed to KLF5 in adipocytes (31) and leukemic cells (32).

It is important to note, however, that KLF5 expression is maximal in the crypt base (33), more consistent with a role in cell proliferation. In agreement with such a role, intestine-specific inactivation of KLF5 resulted in neonatal lethality due to an absence of epithelial cell proliferation (29), and a recent study in which KLF5 was specifically deleted in LGR5+ stem cells also demonstrated reduced intestinal cell proliferation (33). Collectively, these findings demonstrate that the role of KLF5 in the intestinal epithelium is complex, with roles in both proliferation and differentiation.

The mechanistic basis for the differential induction of KLF5 among colon cancer cell lines remains unknown. Notably, the KLF5 promoter is GC-rich, and its basal expression has been shown to be Sp1-dependent (34). Furthermore, methylation of the KLF5 promoter has been reported in acute myelogenous leukemia (32, 35) and medulloblastoma (36). However, our examination of the methylation status of the KLF5 promoter in resistant colon cancer cell lines did not identify any evidence of methylation (data not shown), suggesting other mechanisms such as loss of key transcriptional regulators may be responsible.

Our finding that methylation of the ALPi promoter is linked to CIMP high status of colon cancer cells may provide some insight into the manifestation of the CIMP phenotype. The molecular basis for CIMP is currently unknown, although potential mechanisms, including overexpression and aberrant targeting of DNA methyltransferases, have been suggested (25). In the current study, we observed that the basal levels of KLF5 expression were significantly lower in resistant cell lines. This raises the interesting possibility that the reduced levels of KLF5 in resistant cell lines may predispose its target genes (ALPi) for methylation due to reduced occupancy of the promoter. Extending this further is the possibility that the CIMP phenotype could at least in part, manifest due to loss of transcription factors such as KLF5, which results in the coordinate predisposition of their binding sites to promoter methylation. This model is supported by several previous studies, which demonstrate that transcription factors can play an important role in protecting against promoter methylation (37). First, in colon cancers, a role for Sp1/Sp3 binding sites in methylation protection was recently suggested in a genome-wide ChIP on chip screen (38), as well as a locus specific study interrogating the RIL gene, where the presence of a 12-bp polymorphic sequence containing a Sp1/Sp3-binding site was linked to reduced methylation (39). Second, it has been shown that transient transfection of exogenously methylated DNA fragments containing Sp1 sites resulted in rapid demethylation in ES cells, whereas methylated fragments in which the Sp1 site was mutated remained methylated (40, 41). Finally, several epigenetically silenced regions identified in prostate cancer comprise coordinately regulated gene families, including the Hox, metallothionein, keratin, and SERPINB families (42). Whether the coordinate methylation of these gene families is primarily mediated by their genomic proximity or linked to their coordinate transcriptional regulation is worthy of investigation.

In summary, we demonstrate that ALPi is selectively induced by HDACi in a subset of colon cancer cell lines. In particular, resistant cell lines were enriched for those with the CIMP high phenotype. Although we observed consistent methylation of the ALPi promoter in resistant cell lines, we also established a direct role for the transcription factor KLF5 in butyrate induction of ALPi and observed preferential induction of KLF5 by butyrate in sensitive cell lines. A possibility raised by these observations is that the methylation of ALPi may be a consequence of the absence of KLF5, which may have implications for understanding the manifestation of the CIMP phenotype in colon cancer.

Supplementary Material

Supplemental Data
*

This work was supported in part by the Operational Infrastructure Support Program (Victorian government, Australia), Spanish Ministry for Economy and Competitiveness Grants CP05/00256, TRA2009-0093, SAF2008-00789, PI12/03112, and PI12/01095, the Association for International Cancer Research Grant AICR13-0245, Agència de Gestió d'Ajuts Universitaris i de Recerca SGR 157 (to D. A.), and Australian Research Council Future Fellowship FT0992234 and National Health and Medical Research Council Senior Research Fellowship 1046092 (to J. M. M.).

Inline graphic

This article contains supplemental Table 1.

4
The abbreviations used are:
HDAC
histone deacetylase
ALPi
intestinal alkaline phosphatase
KLF
Kruppel-like factor
CIMP
CpG Island methylator phenotype.

REFERENCES

  • 1. Mariadason J. M., Rickard K. L., Barkla D. H., Augenlicht L. H., Gibson P. R. (2000) Divergent phenotypic patterns and commitment to apoptosis of Caco-2 cells during spontaneous and butyrate-induced differentiation. J. Cell. Physiol. 183, 347–354 [DOI] [PubMed] [Google Scholar]
  • 2. Pettersson F., Miller W. H., Jr., Nervi C., Gronemeyer H. J., Licht J., Tallman M. S., Waxman S. (2011) The 12th international conference on differentiation therapy: targeting the aberrant growth, differentiation and cell death programs of cancer cells. Cell Death Differ. 18, 1231–1233 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. de Thé H., Chen Z. (2010) Acute promyelocytic leukaemia: novel insights into the mechanisms of cure. Nat. Rev. Cancer 10, 775–783 [DOI] [PubMed] [Google Scholar]
  • 4. Mariadason J. M., Barkla D. H., Gibson P. R. (1997) Effect of short-chain fatty acids on paracellular permeability in Caco-2 intestinal epithelium model. Am. J. Physiol. 272, G705-G712 [DOI] [PubMed] [Google Scholar]
  • 5. McComb R. B., Bowers G. N., Posen S. (eds) (1979) Alkaline Phosphatase, pp. 865–902, Plenum Press, New York, NY [Google Scholar]
  • 6. Mahmood A., Shao J. S., Alpers D. H. (2003) Rat enterocytes secrete SLPs containing alkaline phosphatase and cubilin in response to corn oil feeding. Am. J. Physiol. Gastrointest. Liver Physiol. 285, G433–G441 [DOI] [PubMed] [Google Scholar]
  • 7. Nguyen H. T., Amine A. B., Lafitte D., Waheed A. A., Nicoletti C., Villard C., Létisse M., Deyris V., Rozière M., Tchiakpe L., Danielle C. D., Comeau L., Hiol A. (2006) Proteomic characterization of lipid rafts markers from the rat intestinal brush border. Biochem. Biophys. Res. Commun. 342, 236–244 [DOI] [PubMed] [Google Scholar]
  • 8. Narisawa S., Huang L., Iwasaki A., Hasegawa H., Alpers D. H., Millán J. L. (2003) Accelerated fat absorption in intestinal alkaline phosphatase knockout mice. Mol. Cell. Biol. 23, 7525–7530 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Goldberg R. F., Austen W. G., Jr., Zhang X., Munene G., Mostafa G., Biswas S., McCormack M., Eberlin K. R., Nguyen J. T., Tatlidede H. S., Warren H. S., Narisawa S., Millán J. L., Hodin R. A. (2008) Intestinal alkaline phosphatase is a gut mucosal defense factor maintained by enteral nutrition. Proc. Natl. Acad. Sci. U.S.A. 105, 3551–3556 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Kim J. H., Meng S., Shei A., Hodin R. A. (1999) A novel Sp1-related cis element involved in intestinal alkaline phosphatase gene transcription. Am. J. Physiol. 276, G800–G807 [DOI] [PubMed] [Google Scholar]
  • 11. Hinnebusch B. F., Henderson J. W., Siddique A., Malo M. S., Zhang W., Abedrapo M. A., Hodin R. A. (2003) Transcriptional activation of the enterocyte differentiation marker intestinal alkaline phosphatase is associated with changes in the acetylation state of histone H3 at a specific site within its promoter region in vitro. J. Gastrointest. Surg. 7, 237–244; discussion 244–235 [DOI] [PubMed] [Google Scholar]
  • 12. Meng S., Wu J. T., Archer S. Y., Hodin R. A. (1999) Short-chain fatty acids and thyroid hormone interact in regulating enterocyte gene transcription. Surgery 126, 293–298 [PubMed] [Google Scholar]
  • 13. Hinnebusch B. F., Siddique A., Henderson J. W., Malo M. S., Zhang W., Athaide C. P., Abedrapo M. A., Chen X., Yang V. W., Hodin R. A. (2004) Enterocyte differentiation marker intestinal alkaline phosphatase is a target gene of the gut-enriched Kruppel-like factor. Am. J. Physiol. Gastrointest. Liver Physiol. 286, G23–G30 [DOI] [PubMed] [Google Scholar]
  • 14. Malo M. S., Mozumder M., Zhang X. B., Biswas S., Chen A., Bai L. C., Merchant J. L., Hodin R. A. (2006) Intestinal alkaline phosphatase gene expression is activated by ZBP-89. Am. J. Physiol. Gastrointest. Liver Physiol. 290, G737–G746 [DOI] [PubMed] [Google Scholar]
  • 15. Alkhoury F., Malo M. S., Mozumder M., Mostafa G., Hodin R. A. (2005) Differential regulation of intestinal alkaline phosphatase gene expression by Cdx1 and Cdx2. Am. J. Physiol. Gastrointest. Liver Physiol. 289, G285–G290 [DOI] [PubMed] [Google Scholar]
  • 16. Mariadason J. M., Arango D., Shi Q., Wilson A. J., Corner G. A., Nicholas C., Aranes M. J., Lesser M., Schwartz E. L., Augenlicht L. H. (2003) Gene expression profiling-based prediction of response of colon carcinoma cells to 5-fluorouracil and camptothecin. Cancer Res. 63, 8791–8812 [PubMed] [Google Scholar]
  • 17. Young G. P., Rose I. S., Cropper S., Seetharam S., Alpers D. H. (1984) Hepatic clearance of rat plasma intestinal alkaline phosphatase. Am. J. Physiol. 247, G419–G426 [DOI] [PubMed] [Google Scholar]
  • 18. Bradford M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal. Biochem. 72, 248–254 [DOI] [PubMed] [Google Scholar]
  • 19. Bock C., Reither S., Mikeska T., Paulsen M., Walter J., Lengauer T. (2005) BiQ Analyzer: visualization and quality control for DNA methylation data from bisulfite sequencing. Bioinformatics 21, 4067–4068 [DOI] [PubMed] [Google Scholar]
  • 20. Waterhouse A. M., Procter J. B., Martin D. M., Clamp M., Barton G. J. (2009) Jalview Version 2–a multiple sequence alignment editor and analysis workbench. Bioinformatics 25, 1189–1191 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Weisenberger D. J., Siegmund K. D., Campan M., Young J., Long T. I., Faasse M. A., Kang G. H., Widschwendter M., Weener D., Buchanan D., Koh H., Simms L., Barker M., Leggett B., Levine J., Kim M., French A. J., Thibodeau S. N., Jass J., Haile R., Laird P. W. (2006) CpG island methylator phenotype underlies sporadic microsatellite instability and is tightly associated with BRAF mutation in colorectal cancer. Nat. Genet. 38, 787–793 [DOI] [PubMed] [Google Scholar]
  • 22. Wilson A. J., Byun D. S., Nasser S., Murray L. B., Ayyanar K., Arango D., Figueroa M., Melnick A., Kao G. D., Augenlicht L. H., Mariadason J. M. (2008) HDAC4 Promotes Growth of Colon Cancer Cells via Repression of p21. Mol. Biol. Cell 19, 4062–4075 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Ito F., Chou J. Y. (1984) Induction of placental alkaline phosphatase biosynthesis by sodium butyrate. J. Biol. Chem. 259, 2526–2530 [PubMed] [Google Scholar]
  • 24. Yardley D. A., Ismail-Khan R. R., Melichar B., Lichinitser M., Munster P. N., Klein P. M., Cruickshank S., Miller K. D., Lee M. J., Trepel J. B. (2013) Randomized phase II, double-blind, placebo-controlled study of exemestane with or without entinostat in postmenopausal women with locally recurrent or metastatic estrogen receptor-positive breast cancer progressing on treatment with a nonsteroidal aromatase inhibitor. J. Clin. Oncol. 31, 2128–2135 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Teodoridis J. M., Hardie C., Brown R. (2008) CpG island methylator phenotype (CIMP) in cancer: causes and implications. Cancer Lett 268, 177–186 [DOI] [PubMed] [Google Scholar]
  • 26. Toyota M., Ahuja N., Ohe-Toyota M., Herman J. G., Baylin S. B., Issa J. P. (1999) CpG island methylator phenotype in colorectal cancer. Proc. Natl. Acad. Sci. U.S.A. 96, 8681–8686 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Hodin R. A., Meng S., Archer S., Tang R. (1996) Cellular growth state differentially regulates enterocyte gene expression in butyrate-treated HT-29 cells. Cell Growth Differ. 7, 647–653 [PubMed] [Google Scholar]
  • 28. Ghaleb A. M., Yang V. W. (2008) The pathobiology of Kruppel-like factors in colorectal cancer. Curr. Colorectal Cancer Rep. 4, 59–64 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. McConnell B. B., Kim S. S., Yu K., Ghaleb A. M., Takeda N., Manabe I., Nusrat A., Nagai R., Yang V. W. (2011) Kruppel-like factor 5 is important for maintenance of crypt architecture and barrier function in mouse intestine. Gastroenterology 141, 1302–1313, e1301–e1306 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Bell S. M., Zhang L., Xu Y., Besnard V., Wert S. E., Shroyer N., Whitsett J. A. (2013) Kruppel-like factor 5 controls villus formation and initiation of cytodifferentiation in the embryonic intestinal epithelium. Dev. Biol. 375, 128–139 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Oishi Y., Manabe I., Tobe K., Tsushima K., Shindo T., Fujiu K., Nishimura G., Maemura K., Yamauchi T., Kubota N., Suzuki R., Kitamura T., Akira S., Kadowaki T., Nagai R. (2005) Kruppel-like transcription factor KLF5 is a key regulator of adipocyte differentiation. Cell Metab. 1, 27–39 [DOI] [PubMed] [Google Scholar]
  • 32. Diakiw S. M., Kok C. H., To L. B., Lewis I. D., Brown A. L., D'Andrea R. J. (2012) The granulocyte-associated transcription factor Kruppel-like factor 5 is silenced by hypermethylation in acute myeloid leukemia. Leuk. Res. 36, 110–116 [DOI] [PubMed] [Google Scholar]
  • 33. Nakaya T., Ogawa S., Manabe I., Tanaka M., Sanada M., Sato T., Taketo M. M., Nakao K., Clevers H., Fukayama M., Kuroda M., Nagai R. (2014) KLF5 regulates the integrity and oncogenicity of intestinal stem cells. Cancer Res. 74, 2882–2891 [DOI] [PubMed] [Google Scholar]
  • 34. Chen C., Zhou Y., Zhou Z., Sun X., Otto K. B., Uht R. M., Dong J. T. (2004) Regulation of KLF5 involves the Sp1 transcription factor in human epithelial cells. Gene 330, 133–142 [DOI] [PubMed] [Google Scholar]
  • 35. Gebhard C., Schwarzfischer L., Pham T. H., Schilling E., Klug M., Andreesen R., Rehli M. (2006) Genome-wide profiling of CpG methylation identifies novel targets of aberrant hypermethylation in myeloid leukemia. Cancer Res. 66, 6118–6128 [DOI] [PubMed] [Google Scholar]
  • 36. Potapova A., Hasemeier B., Römermann D., Metzig K., Göhring G., Schlegelberger B., Länger F., Kreipe H., Lehmann U. (2010) Epigenetic inactivation of tumour suppressor gene KLF11 in myelodysplastic syndromes*. Eur. J. Haematol. 84, 298–303 [DOI] [PubMed] [Google Scholar]
  • 37. Lao V. V., Grady W. M. (2011) Epigenetics and colorectal cancer. Nat. Rev. Gastroenterol. Hepatol. 8, 686–700 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Gebhard C., Benner C., Ehrich M., Schwarzfischer L., Schilling E., Klug M., Dietmaier W., Thiede C., Holler E., Andreesen R., Rehli M. (2010) General transcription factor binding at CpG islands in normal cells correlates with resistance to de novo DNA methylation in cancer cells. Cancer Res. 70, 1398–1407 [DOI] [PubMed] [Google Scholar]
  • 39. Boumber Y. A., Kondo Y., Chen X., Shen L., Guo Y., Tellez C., Estécio M. R., Ahmed S., Issa J. P. (2008) An Sp1/Sp3 binding polymorphism confers methylation protection. PLoS Genet. 4, e1000162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Brandeis M., Frank D., Keshet I., Siegfried Z., Mendelsohn M., Nemes A., Temper V., Razin A., Cedar H. (1994) Sp1 elements protect a CpG island from de novo methylation. Nature 371, 435–438 [DOI] [PubMed] [Google Scholar]
  • 41. Silke J., Rother K. I., Georgiev O., Schaffner W., Matsuo K. (1995) Complex demethylation patterns at Sp1 binding sites in F9 embryonal carcinoma cells. FEBS Lett. 370, 170–174 [DOI] [PubMed] [Google Scholar]
  • 42. Coolen M. W., Stirzaker C., Song J. Z., Statham A. L., Kassir Z., Moreno C. S., Young A. N., Varma V., Speed T. P., Cowley M., Lacaze P., Kaplan W., Robinson M. D., Clark S. J. (2010) Consolidation of the cancer genome into domains of repressive chromatin by long-range epigenetic silencing (LRES) reduces transcriptional plasticity. Nature cell biology 12, 235–246 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Data

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES