Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2004 Jun;72(6):3584–3591. doi: 10.1128/IAI.72.6.3584-3591.2004

Role of HtrA in the Virulence and Competence of Streptococcus pneumoniae

Yasser Musa Ibrahim 1, Alison R Kerr 1, Jackie McCluskey 1, Tim J Mitchell 1,*
PMCID: PMC415679  PMID: 15155668

Abstract

HtrA is a major virulence factor of Streptococcus pneumoniae (the pneumococcus). Deletion of the gene for HtrA from strain D39 of the pneumococcus completely abolished its virulence in mouse models of pneumonia and bacteremia, while the virulence of a second strain (TIGR4) was dramatically reduced. HtrA-negative mutants induced much less inflammation in the lungs during pneumonia than the wild type. HtrA is involved in the ability of the pneumococcus to grow at high temperatures, to resist oxidative stress, and to undergo genetic transformation. The expression and cellular location of several known virulence factors of the pneumococcus were not affected by the lack of HtrA.


Streptococcus pneumoniae (the pneumococcus) is an important human pathogen. This organism is a major cause of a variety of diseases, such as pneumonia, bacteremia, meningitis, otitis media, and sinusitis in both adults and children all over the world (33). The high morbidity and mortality associated with pneumococcal diseases are exacerbated by the rate at which this organism is acquiring resistance to multiple antibiotics and the limitation in the clinical efficacy of current vaccines, especially for high-risk groups, such as young children and the elderly (5, 20). A more detailed understanding of S. pneumoniae virulence is likely to provide new vaccine candidates and targets for antibacterial drugs (12, 16, 38).

Pathogenic bacteria are equipped with stress response mechanisms that enable them to cope with stressful insults in their environment (e.g., the host). Heat shock proteins are a highly conserved group of proteins that are induced in bacteria when they are confronted with environmental stress conditions such as an increase in temperature. HtrA (high-temperature requirement A), also known as DegP or DO protease (32), is a heat shock-induced serine protease that was first described in Escherichia coli to be involved in the degradation of periplasmic misfolded proteins (35). HtrA has both general molecular chaperone and proteolytic activities and switches from chaperone to protease in a temperature-dependent manner (34), with the protease activity being most apparent at elevated temperatures.

Homologues of HtrA have been described for a wide range of organisms, including bacteria, yeasts, plants, and humans (13, 27, 39). Some bacteria have more than one paralogue of HtrA (26). In all cases, the evidence points to a major role for these proteases in helping organisms to survive environmental stresses such as elevated temperature, oxidative stress, and osmotic stress. HtrA is known to be involved in the virulence of many gram-negative bacteria, such as Salmonella enterica serovar Typhimurium (3), Brucella abortus (10), and Yersinia enterocolitica (24). This protease is also required for full virulence of the gram-positive bacterium Streptococcus pyogenes (18). The same workers reported the presence of homologous enzymes in Streptococcus gordonii, Streptococcus mutans, Staphylococcus aureus, and Enterococcus faecalis. An HtrA homologue has also been identified for S. pneumoniae (11) and is regulated by the CiaRH two-component system (25, 31). An S. pneumoniae strain lacking the htrA gene showed decreased fitness in a competitive model of colonization (31). HtrA was identified as a virulence factor of the pneumococcus by a signature-tagged mutagenesis screen (15). Here we report that HtrA plays a crucial role in virulence, as HtrA-deficient strains are attenuated in both pneumonia and bacteremia models of infection. HtrA is involved in resistance to temperature and oxidative stress and also in genetic competence.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

The bacterial strains used for this study are listed in Table 1. Bacteria were grown on blood agar base number 2 (Oxoid, Basingstoke, United Kingdom) supplemented with 5% (vol/vol) defibrinated horse blood (E&O Laboratories, Bonnybridge, United Kingdom) (BAB) and in brain heart infusion (BHI) broth. E. coli strains DH5α and XL-Gold ultracompetent cells (Stratagene) were grown in Luria-Bertani broth or on Luria-Bertani agar plates. When appropriate, antibiotics were added to the growth media at the following concentrations: ampicillin at 50 μg/ml and spectinomycin at 200 μg/ml for E. coli and 100 μg/ml for S. pneumoniae.

TABLE 1.

List of bacterial strains and primers used for this study

S. pneumoniae strain or primer Characteristics Reference Use for primer
Strains
    D39 Serotype 2, NCTC 7466 2
    TIGR4 Serotype 4, clinical isolate 36
    D39 ΔhtrA D39 with replacement of htrA with spectinomycin resistance cassette This work
    TIGR4 ΔhtrA TIGR4 with replacement of htrA with spectinomycin resistance cassette This work
    D39 ΔhtrA/htrA+ D39ΔhtrA complemented with pAL2HtrA This work
Primers
    HtrA for ATGAAACATCTAAAAACATT Amplification of htrA
    HtrA rev AGATTCTAAATCACCTGAAC Amplification of htrA
    HtrA inv1 GGCGCGCCTACGCTATTTTGTCTGTT Deletion of htrA
    HtrA inv2 GGCGCGCCTTGGGAATCCAGATGGTTAAT Deletion of htrA
    Spec up GGCGCGCCATCGATTTTCGTTCGTGAATA Amplification of spectinomycin resistance cassette
    Spec dn GGCGCGCCTATGCAAGGGTTTATTGTT Amplification of spectinomycin resistance cassette
    htrA C1 AGTTATAATTAAGCTAGTCAG Confirmation of chromosomal insertion of interrupted htrA
    htrA C2 TGATTCTACACTAACACATCT Confirmation of chromosomal insertion of interrupted htrA
    htrA1 CTGAATTCATAGGAGGACTATGAAACATC Cloning of htrA into pAL2 plasmid
    htrA2 CTGAATTCAGATTCTAAATCACCTGAAC Cloning of htrA into pAL2 plasmid
    pAL2y1 CGAAAATTTGTTTGCTTTTTAATGG htrA orientation in pAL2
    pAL2y2 GGATACATTTCTATTGAGACTGGAT htrA orientation in pAL2

Plasmids and primers.

The oligonucleotide primers used for this study are listed in Table 1. The PCR-Script plasmid (Stratagene) was used for cloning according to the manufacturer's recommendations. The pDL278 plasmid (23) was used as a template to amplify the AscI-generated spectinomycin resistance cassette with primers Spec up and Spec dn (Table 1). The pAL2 plasmid (4) was used for the expression of HtrA in S. pneumoniae.

DNA manipulation and transformation.

Chromosomal DNAs were prepared as described elsewhere (6). PCRs, restriction endonuclease digestion reactions, DNA ligation, and DNA electrophoresis were performed according to standard protocols (30). Kits from Qiagen were used according to the manufacturer's instructions for DNA purification and plasmid preparations. The transformation of E. coli with plasmid DNA was carried out according to the manufacturer's instructions (Stratagene). The transformation of S. pneumoniae D39 (serotype 2) and S. pneumoniae TIGR4 (serotype 4) was carried out by a modification of the method of Lacks and Hotchkiss (22). Competence-stimulating peptides (CSP-1 for D39 and CSP-2 for TIGR4) were used to induce competence in these different serotypes (29). The transformed cells were selected on BAB plates with appropriate antibiotics.

Construction of ΔhtrA mutant.

An isogenic mutant of S. pneumoniae lacking htrA was constructed to study the role played by HtrA in the virulence of this organism. The whole htrA gene was amplified from the chromosomal DNA of S. pneumoniae D39 with primers HtrA for and HtrA rev (Table 1) and was cloned into the PCR-Script plasmid. The internal primers HtrA inv1 and HtrA inv2 (Table 1) were designed to amplify the 5′ and 3′ ends of the gene together with the PCR-Script plasmid and to create an AscI site in the resulting PCR product. This PCR product was self-ligated to produce a plasmid carrying the interrupted gene. To facilitate the selection of transformants, we ligated an AscI-generated spectinomycin resistance cassette into this plasmid after digestion with AscI. The modified version of the gene was amplified with PCR and used to transform S. pneumoniae.

Construction of plasmid expressing htrA in S. pneumoniae.

htrA was expressed from pAL2 (4) under the control of the constitutive promoter of the S. pneumoniae aminopterin resistance operon (ami) (1). Primers htrA1 and htrA2 were used to amplify htrA with EcoRI sites and a gram-positive ribosome binding site. This fragment was ligated to EcoRI-digested pAL2 carrying the ami promoter to create the pAL2HtrA plasmid. The proper orientation of the htrA gene in pAL2HtrA was confirmed by a PCR using primers pAL2y1 and pAL2y2, and the htrA gene was sequenced by using the forward primer pAL2y1 and the reverse primer htrA2 for further confirmation.

In vitro stress experiments.

To compare the effect of temperature stress on the ΔhtrA mutant to that on the D39 wild type, we used the same number of viable cells (106 CFU/ml) to inoculate BHI broth that was prewarmed at 37 and 40°C. At 1-h intervals, samples were taken for measurements of optical densities at 600 nm (OD600) and for viable counts. The sensitivity of cells to H2O2 was tested by the exposure of aliquots of cultures grown to an OD of ∼0.3 to 40 mM H2O2 for 5, 10, and 15 min at room temperature. Viable cells were counted by plating them onto blood agar plates before and after the exposure to H2O2, and the results were expressed as percentages of survival (17). The effect of the redox compound methyl viologen (paraquat) was also studied. A total of 104 cells were exposed to 60 mM paraquat (Sigma) for 2 h. At intervals, samples were taken and the numbers of viable cells were determined (37). To study the role of HtrA in pH tolerance, we used equal numbers of cells of D39 and the ΔhtrA mutant to inoculate BHI broth adjusted to pHs 4, 5, 6, 7, 8, and 9. The growth was observed after an overnight incubation at 37°C (9).

Competence assay.

Competent cells of the D39 wild type and of the ΔhtrA and ΔhtrA/htrA+ mutants were made as described above and stored as 100-μl aliquots in 20% glycerol at −80°C. For a comparison of the abilities of the ΔhtrA and ΔhtrA/htrA+ mutants to take up DNA to that of wild-type D39, competent cells were thawed and diluted 1/10, and 100 ng of CSP/ml was added. Pneumococcal genomic DNA conferring kanamycin resistance (from a clpP mutant containing a kanamycin resistance cassette [8]) (0.3 μg) was then added, and the cells were incubated at 37°C for 10 min and then at 30°C for 20 min. Transformed cells were incubated on BAB without antibiotic selection for 2 h at 37°C, 250 μg of kanamycin/ml was then added, and the incubation was continued overnight. The efficiency of transformation was expressed as the percentage of transformants in the total number of cells used.

Preparation of bacterial cell protein and Western immunoblotting.

All manipulations were performed at 4°C. Cell pellets of late-log-phase cultures were collected by centrifugation at 5,000 × g for 15 min and were resuspended in 1 ml of phosphate-buffered saline (PBS). Cellular proteins were released by sonication (4 pulses of 30 s each, with 30 s of chilling on ice between pulses). The cell debris was removed by centrifugation at 13,000 × g for 10 min. The total protein concentration of the lysate was determined by the Bradford assay, with bovine serum albumin used as a standard (7). For Western blot analysis, proteins present in culture lysates were separated by sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis, electroblotted onto nitrocellulose membranes (Amersham), and reacted with specific antisera against pneumolysin, autolysin A, neuraminidase, hyaluronidase, and cbpA according to a standard protocol (30).

Mice and infections.

Female outbred MF1 mice (25 to 30 g) were purchased from Harlan Olac, Bicester, United Kingdom. They were used when they were 9 weeks old. For intranasal infections, a group of 30 mice was used for survival studies and a group of 60 mice was used for time course studies. A further group of 15 mice was used to test the effect of complementation of the htrA mutation on the survival of mice. Mice were lightly anesthetized with 1.5% (vol/vol) halothane, and the infectious dose was administered in 50-μl volumes to the nostrils of vertically held mice (19). For intravenous infections, a separate group of 20 mice was used. The infectious dose (105 CFU) was administered in a 50-μl volume injected into the lateral tail vein. Blood was taken from a separate vein immediately after injection to ensure a successful infection.

Bacteriological investigation.

At prechosen intervals after infection, groups of mice were sacrificed by cervical dislocation, ensuring intact trachea, and a blood sample was removed via a cardiac puncture. For bronchoalveolar lavage, a 16-gauge nonpyrogenic angiocatheter (F. Baker Scientific, Runcorn, United Kingdom) was inserted into the trachea and the lungs were lavaged with a total volume of 2 ml of sterile PBS. Lavaged lungs were homogenized in 5 ml of PBS with a glass handheld tissue homogenizer (Jencons, Leighton Buzzard, United Kingdom). Viable bacteria in lung and blood samples were counted by plating out serial 10-fold dilutions on BAB (21).

Histological analysis.

A group of 10 mice (5 infected with the wild type and 5 infected with the mutant) was used to investigate histological changes at 48 h postinfection. Lungs were inflated with 1 ml of 10% (vol/vol) formal saline prior to their removal. After fixation, the lungs were embedded in paraffin and blocked according to standard histological protocols. Lung blocks were sectioned into 5-mm-thick sections prior to staining with hematoxylin and eosin (BDH Laboratory Supplies, Poole, United Kingdom) (21).

Measurement of immune modulators.

A group of 30 mice was used to study the production of immune modulators at three time points postinfection. Bronchoalveolar lavage was done as described above, but the fluid was snap-frozen by immersion in liquid nitrogen. Lungs were then removed, wrapped in aluminum foil, and snap-frozen. Samples were then stored at −80°C until further processing. Upon thawing, the whole lungs were homogenized as described above. Homogenates were centrifuged at 1,600 × g for 30 min at 4°C; the supernatants were then centrifuged at 5,000 × g at 4°C, filter sterilized (0.2-μm-pore-size filter) (Gelman Sciences, Northampton, United Kingdom), and stored at −80°C. Upon thawing, the lavage fluids were centrifuged at 17,900 × g for 3 min. Interleukin-6 (IL-6) was measured by an enzyme-linked immunosorbent assay utilizing a commercially available antibody pair (clones MP5-20F3 and MP5-32C11; Pharmingen and Becton Dickinson). Tumor necrosis factor alpha (TNF-α) levels were measured by using an enzyme-linked immunosorbent assay kit for TNF-α, the OptEIA mouse TNF-α set (Pharmingen).

Statistical analysis.

Statistical analyses were performed with StatView 4.1 (Abacus Concept). Survival times and comparisons of cytokine levels were analyzed by a nonparametric Mann-Whitney U analysis. Cytokine levels are expressed as medians ± median absolute deviations (21). Bacteriology results are expressed as geometric means ± standard errors of the means (SEM). Comparisons of bacterial loads in the time course bacteriology experiment were done with an unpaired t test. We controlled for intergroup variation by ensuring that there were no statistical differences in any parameter between wild-type and ΔhtrA-infected mice immediately after infection. For all analyses, a P value of <0.05 was considered statistically significant.

RESULTS

Construction of ΔhtrA mutation in S. pneumoniae.

The htrA gene of S. pneumoniae strains D39 and TIGR4 was disrupted by the introduction of a spectinomycin resistance cassette into the gene. The mutation was confirmed by using diagnostic primers htrA C1 and htrA C2 (Table 1), flanking htrA, to amplify a PCR fragment of 1.7 kb from the chromosomal DNA of transformed cells grown on spectinomycin and a 1.2-kb fragment of the wild-type copy of htrA. The mutated PCR fragment was sequenced to further confirm that the mutation occurred at the correct position in the pneumococcal chromosome (data not shown).

In vitro phenotype of ΔhtrA mutant of strain D39.

The ΔhtrA mutant was found to grow at a rate similar to that of the wild type at 37°C (data not shown). However, the mutant grew more slowly than the D39 wild type at 40°C (Fig. 1). The ΔhtrA mutant was also more sensitive to hydrogen peroxide than the wild type (Fig. 2). There was no difference in the effect of paraquat and no significant differences in growth were found at different pHs (data not shown). The amounts of the toxin pneumolysin and the major autolytic enzyme LytA expressed at 37 and 40°C were also similar (data not shown). We also examined the distribution of three known surface proteins of the pneumococcus. We found no difference in the levels of CbpA, hyaluronidase, or neuraminidase associated with the different cell fractions, as determined by Western blotting (data not shown). There were no differences in the distribution of enzymatic activity of hyaluronidase or neuraminidase between the mutant and wild-type organisms. We also compared the transformation efficiencies of the strains. The disruption of the htrA gene caused a decrease in transformation efficiency of approximately 32-fold. This reduction could be reversed by complementation with a plasmid containing the htrA gene (Table 2).

FIG. 1.

FIG. 1.

Representative graph of in vitro growth of D39 wild type and ΔhtrA mutant at 40°C. BHI broth prewarmed at 40°C was inoculated with either bacterial strain to 106 CFU/ml. Samples were taken at 1-h intervals for measurement of the OD600. The growth of the ΔhtrA mutant was much slower than that of the wild type, but it eventually reached a maximum OD similar to that of the wild type.

FIG. 2.

FIG. 2.

H2O2 sensitivity assay for D39 wild type and ΔhtrA mutant. H2O2 (40 mM) was added to 1-ml aliquots of culture grown to an OD600 of ∼0.3. Viable counts were performed on BAB plates before and after the addition of peroxide, and the survival rates were calculated. Values are expressed as the means plus SEM of three independent experiments. *, P < 0.05 for lower survival rate of ΔhtrA mutant than that of the wild type.

TABLE 2.

Transformability of ΔhtrA mutant compared to D39 wild type

Expt no. % Transformants
D39 wild type ΔhtrA ΔhtrA/htrA+
1 0.825 0.024 0.522
2 0.394 0.017 0.321
3 0.408 0.011 0.517
Mean ± SEM 0.542 ± 0.141 0.017 ± 0.004 0.453 ± 0.066

The ΔhtrA mutant was more difficult to transform than D39 wild type (P < 0.05). This decrease in transformation efficiency was reverted in the complemented mutant ΔhtrA/htrA+ by the expression of HtrA from the pAL2HtrA plasmid. The percentages of transformants were determined by the formula (no. of kanamycin-resistant colonies per total of viable cells used) × 100.

ΔhtrA mutant is attenuated in a murine model of pneumonia.

We examined the contribution of HtrA to the virulence of the pneumococcus. Groups of mice (five mice each) were infected intranasally with either serotype 2 (strain D39) or serotype 4 (strain TIGR4) or with their ΔhtrA mutants. We chose to examine the effect of HtrA in two genetic backgrounds as it was recently shown that the genetic background can have a major influence on the role of virulence factors (6). After administering the infectious dose (106 CFU/mouse in the case of D39 and either 105 or 106 CFU/mouse in the case of TIGR4), we observed the mice and recorded the development of symptoms over a period of 8 days. Mice infected with the D39 wild type started to show symptoms of illness at 24 h postinfection, and all mice were moribund by 72 h. However, none of the D39 ΔhtrA-infected mice showed any signs of illness throughout the experiment (Fig. 3A). In the case of the TIGR4 strain, which is more virulent than D39, all mice infected with a dose of 105 CFU of TIGR4 ΔhtrA survived the experiment, while 80% of those infected with wild-type TIGR4 became moribund (Fig. 3B). With a dose of 106 CFU/mouse, mice infected with wild-type TIGR4 became moribund very rapidly (all were sacrificed by 29 h postinfection), while the first moribund case of TIGR4 ΔhtrA-infected mice was not recorded until 120 h postinfection and 60% of the animals were healthy at the end point of the experiment, at 8 days (Fig. 3C).

FIG. 3.

FIG. 3.

Survival of MF1 mice infected intranasally with 106 CFU of D39 or D39 ΔhtrA/mouse (A) or with 105 or 106 CFU of TIGR4 or TIGR4 ΔhtrA/mouse (B and C, respectively). *, P < 0.05 for longer survival times for the ΔhtrA mutant than for the wild type.

Growth of D39 wild type and ΔhtrA mutant in lungs and blood after intranasal infection.

The behavior of the ΔhtrA mutant compared to that of the D39 wild type in the lung airways, lung tissues, and blood after intranasal infection was studied 0, 6, 12, 18, 24, and 48 h after infection. In the lung airways, both the D39 wild type and the ΔhtrA mutant were cleared over time. However, the ΔhtrA mutant was cleared more rapidly. The number of ΔhtrA cells recovered was significantly lower than that of D39 wild-type cells at 6 and 12 h postinfection (P < 0.05) (Fig. 4A). In lung tissues, however, while D39 grew very well, the ΔhtrA mutant was unable to survive (Fig. 4B). Furthermore, D39 appeared in the blood at 12 h postinfection and grew dramatically, whereas the ΔhtrA mutant was never detected in the blood (Fig. 4C).

FIG. 4.

FIG. 4.

Time course of mean (± SEM) bacterial growth in lung lavage fluid (A), lung tissue (B), and blood (C) after intranasal infection with 106 CFU of D39 wild type or its ΔhtrA mutant/mouse. Horizontal dashed lines represent the limits of detection of the assay. *, P < 0.05 for lower bacterial loads for the ΔhtrA mutant than for D39.

TIGR4 ΔhtrA mutant does not cause bacteremia after intranasal infection.

The ability of the TIGR4 ΔhtrA mutant to cause bacteremia in mice after intranasal infection was also tested. Mice were bled 24 and 48 h after a challenge with 105 CFU of either the TIGR4 wild type or the ΔhtrA mutant/mouse, and the numbers of pneumococci in the blood were determined by plating of the cells onto BAB. The number of TIGR4 wild-type cells was between log 5 and log 6.8 in 60% of the mice after 24 h of infection, while no bacterial count was detected in the rest of the group. Mice with detectable bacterial counts died, and those with no count survived at least until 48 h postinfection. In contrast, the TIGR4 ΔhtrA mutant was not found in the blood of mice at any time point (Table 3).

TABLE 3.

Counts of bacteria in tail blood from MF1 mice after intranasal infection with 105 CFU of TIGR4 wild type or TIGR4 ΔhtrA mutant/mouse

Mouse no. Bacterial load (CFU/ml) at indicated time (h) postinfectiona
24
48
TIGR4 TIGR4 ΔhtrA TIGR4b TIGR4 ΔhtrA
1 6.041 ND — ND
2 6.791 ND — ND
3 ND ND ND ND
4 5.097 ND — ND
5 ND ND ND ND
a

Mice were bled at 24 and 48 h postinfection, and the viable count was determined by plating on BAB plates. TIGR4 ΔhtrA was not detected in the blood of all infected mice at either time point. P < 0.05 at 24 h postinfection. ND, none detected.

b

—, dead mouse.

Growth of D39 wild type and ΔhtrA mutant in blood after intravenous infection.

To determine if the role played by HtrA was specific to the lungs, we injected organisms directly into the bloodstream to bypass the respiratory tract (Fig. 5). Wild-type D39 grew in the blood and resulted in all injected animals becoming moribund, while the ΔhtrA mutant caused no disease and was cleared from the blood. HtrA therefore plays a critical role in the survival and growth of the pneumococcus in the vascular compartment.

FIG. 5.

FIG. 5.

Survival of MF1 mice (A) and time course of mean (± SEM) bacterial growth in blood (B) after intravenous challenge with 105 CFU of D39 wild type or its ΔhtrA mutant/mouse. *, P < 0.05 for shorter survival times for D39 than for the ΔhtrA mutant (A) and P < 0.05 for lower bacterial loads for the ΔhtrA mutant than for D39 (B).

The ΔhtrA mutant induces less IL-6 and TNF-α than does the D39 wild type.

To study the inflammatory response toward the ΔhtrA mutant compared to that toward the D39 wild type, we measured IL-6 and TNF-α levels in the lung lavage fluids and lung tissues of MF1 mice (Fig. 6). D39 induced high levels of IL-6 at 24 h postinfection which were reduced after 36 h in the lung lavage fluids and increased with time in the lung tissues. No or very low IL-6 levels were detected in both the lung lavage fluids and the lung tissues in the case of the ΔhtrA mutant. D39 caused peak TNF-α levels in the lung lavage fluids after 24 h which then declined sharply, while TNF-α concentrations increased over time in the lung tissues. In contrast, the ΔhtrA mutant induced very low TNF-α levels in the lung lavage fluids, and the levels in the lung tissues were less than those induced by D39. Although these results are complicated by the fact that the lungs contained different numbers of organisms, it is clear that ΔhtrA induces much less inflammation in the lung.

FIG. 6.

FIG. 6.

Median (plus median absolute deviation) levels of IL-6 and TNF-α induced in lung lavage fluids and lung tissues of MF1 mice infected intranasally with 106 CFU of D39 wild type or its ΔhtrA mutant/mouse. (A) Levels of IL-6 in lung lavage fluid; (B) levels of IL-6 in lung tissue; (C) levels of TNF-α in lung lavage fluid; (D) levels of TNF-α in lung tissue. *, P < 0.05 for lower cytokine levels for the ΔhtrA mutant than for D39.

Histology.

A histological examination revealed that the influx of inflammatory cells into the lungs of mice infected with wild-type bacteria was larger than that in the lungs of mice infected with the ΔhtrA mutant. At 48 h postinfection, the lungs of mice infected with D39 contained more lesions, especially at the pleural interface (Fig. 7). These areas were swollen and congested with recruited cells (the nuclear morphology indicates that the majority of cells were neutrophils). In contrast, the lungs from mice infected with the ΔhtrA mutant had few inflammatory lesions.

FIG. 7.

FIG. 7.

Lung tissue sections from MF1 mice infected with 106 CFU of D39 wild type (A) or its ΔhtrA mutant (B)/mouse. Mice were sacrificed at 48 h postinfection, and their lungs were removed, fixed, and stained with hematoxylin and eosin. The sections show a blood vessel (Bv) in close proximity to the pleural interface (Pl). The pleural interface is narrow and healthy in the lung infected with the ΔhtrA mutant but is swollen with inflammatory cells in the lung infected with D39. Inflammatory cells can also be seen moving out of the blood vessel towards the pleural interface between the two large arrowheads in panel A.

Complementation with HtrA reverts the D39 ΔhtrA mutant to full virulence.

To confirm that the attenuation of virulence in the ΔhtrA mutant was entirely due to the lack of HtrA, we complemented this mutant with the pAL2HtrA plasmid, which expresses HtrA from the gram-positive ami promoter. When the HtrA level was restored in the ΔhtrA mutant, the strain was again fully virulent in a pneumonia model of infection (Fig. 8). The virulence phenotype of the ΔhtrA mutant was therefore confirmed to be solely due to the deletion of htrA.

FIG. 8.

FIG. 8.

Effect of complementation with HtrA on virulence. The ΔhtrA strain had reduced virulence, as judged by the survival times of mice after intranasal infection with 106 CFU/mouse. Complementation with HtrA (from plasmid pAL2HtrA) reverted this strain to full virulence.

DISCUSSION

HtrA-negative mutants of S. pneumoniae have dramatically reduced virulence. We tested the effect of the deletion of htrA in two strains of the pneumococcus. For strain D39, the deletion of the gene completely attenuated the organism, while for strain TIGR4, the virulence was dramatically reduced, although the use of higher doses of the more virulent TIGR4 strain did result in some disease in the ΔhtrA group. An analysis of infections with the D39 ΔhtrA mutant showed that the mutant organism could not survive in the lungs and was cleared rapidly from the air spaces. The mutant never invaded the bloodstream from the lungs. HtrA is involved in the virulence of several gram-negative pathogens and has recently been shown to contribute to the virulence of the gram-positive pathogen S. pyogenes (18).

An analysis of the inflammatory response by the measurement of IL-6 and TNF-α showed that the ΔhtrA mutant induced markedly less inflammation than the D39 wild type. These results were complicated by the differences in the numbers of organisms present in wild-type- and mutant-infected lungs, and the lack of inflammatory cytokine production induced by the mutant may have simply been a reflection of the fact that the number of organisms present was below that needed to trigger the response. However, the numbers of organisms present in the lavage fluid at 24 h were very similar between the wild type and the mutant, but the mutant still did not induce IL-6 or TNF-α production. A histological examination of the tissues confirmed that there was an altered host response to the mutant. Lungs exposed to the mutant organism had fewer lesions of inflammatory cells at the pleural interface. These changes in the inflammatory response and tissue histology may reflect either a direct action of the serine protease on some unknown substrate or the altered expression of other virulence factors. With this in mind, we examined the expression of several known virulence factors of the pneumococcus. We found no effect of the htrA mutation on the amount of pneumolysin, autolysin, CbpA (PspC), hyaluronidase, or neuraminidase made by the organism. Recent work with Lactococcus lactis showed that in an htrA-null mutant, several surface proteins failed to be properly processed (28). We therefore examined the distribution and activity of several pneumococcal surface proteins in the ΔhtrA mutant. Cellular fractionation and Western blotting showed that there was no difference in the distribution of CbpA, hyaluronidase, and neuraminidase between the wild type and the ΔhtrA mutant (data not shown). Moreover, there was no difference between the wild type and the ΔhtrA mutant in the amounts of neuraminidase and hyaluronidase enzymatic activity associated with the different cell fractions. HtrA therefore does not appear to play a role in cell surface protein locations and activities, at least for the proteins that we examined. The HtrA homologue in S. pyogenes was also shown to not affect cell surface protein expression (18).

An analysis in vitro indicated that HtrA plays a role in resistance to temperature and oxidative stresses. However, the effect of the lack of HtrA at a high temperature was to slow growth rather than prevent it, and mutant organisms still reached the same final OD. The effect of HtrA on protection from oxidative stress was observed for hydrogen peroxide but not for paraquat. Paraquat is taken up by bacterial cells and generates superoxides within the cytoplasm (14). This suggests that HtrA provides resistance to hydrogen peroxide but not to superoxide. Resistance to oxidative stress is known to be mediated in part through the Mn2+ ABC transport system encoded by the psa operon (37). This operon is known to control the level of expression of superoxide dismutase and NADH oxidase (37) and to be involved in virulence. Whether there is an interaction between HtrA and the psa proteins remains to be determined.

HtrA also plays a role in the transformation of the pneumococcus. The deletion of the gene for HtrA resulted in an approximately 32-fold decrease in transformation efficiency which could be restored by the expression of HtrA from a plasmid. The possibility raised by Sebert and coworkers (31) that HtrA plays a role in the competence pathway was therefore confirmed. However, the presence of HtrA seems to be required for transformation rather than for the inhibition of competence. HtrA may be required for the correct folding of one of the protein components of the competence pathway.

In summary, HtrA is a major virulence factor of S. pneumoniae. HtrA plays a role in resistance to temperature and oxidative stresses and is involved in genetic transformation. The exact function of HtrA remains to be determined and is the subject of ongoing studies.

Acknowledgments

Yasser Musa Ibrahim received a scholarship from the Egyptian government.

We thank V. Salisbury (University of the West of England) for providing plasmid pAL2.

Editor: V. J. DiRita

REFERENCES

  • 1.Alloing, G., M. C. Trombe, and J. P. Claverys. 1990. The ami locus of the gram-positive bacterium Streptococcus pneumoniae is similar to binding protein-dependent transport operons of gram-negative bacteria. Mol. Microbiol. 4:633-644. [DOI] [PubMed] [Google Scholar]
  • 2.Avery, O. T., C. M. Macleod, and M. McCarty. 1944. Studies on the chemical nature of the substance inducing transformation of pneumococcal types: induction of transformation by deoxyribonucleic acid fraction isolated from pneumococcus type III. J. Exp. Med. 79:137-158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Baumler, A. J., J. G. Kusters, I. Stojiljkovic, and F. Heffron. 1994. Salmonella typhimurium loci involved in survival within macrophages. Infect. Immun. 62:1623-1630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Beard, S. J., V. Salisbury, R. J. Lewis, J. A. Sharpe, and A. P. MacGowan. 2002. Expression of lux genes in a clinical isolate of Streptococcus pneumoniae: using bioluminescence to monitor gemifloxacin activity. Antimicrob. Agents Chemother. 46:538-542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Black, S., H. Shinefield, B. Fireman, et al. 2000. Efficacy, safety, and immunogenicity of heptavalent pneumococcal conjugate vaccine in children. Pediatr. Infect. Dis. J. 19:187-195. [DOI] [PubMed] [Google Scholar]
  • 6.Blue, C. E., and T. J. Mitchell. 2003. Contribution of a response regulator to the virulence of Streptococcus pneumoniae is strain dependent. Infect. Immun. 71:4405-4413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254. [DOI] [PubMed] [Google Scholar]
  • 8.Chastanet, A., M. Prudhomme, J. P. Claverys, and T. Msadek. 2001. Regulation of Streptococcus pneumoniae clp genes and their role in competence development and stress survival. J. Bacteriol. 183:7295-7307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Diaz-Torres, M. L., and R. R. Russell. 2001. HtrA protease and processing of extracellular proteins of Streptococcus mutans. FEMS Microbiol. Lett. 204:23-28. [DOI] [PubMed] [Google Scholar]
  • 10.Elzer, P. H., R. W. Phillips, G. T. Robertson, and R. M. Roop II. 1996. The HtrA stress response protease contributes to resistance of Brucella abortus to killing by murine phagocytes. Infect. Immun. 64:4838-4841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gasc, A. M., P. Giammarinaro, S. Richter, and M. Sicard. 1998. Organization around the dnaA gene of Streptococcus pneumoniae. Microbiology 144:433-439. [DOI] [PubMed] [Google Scholar]
  • 12.Glass, J. I., A. E. Belanger, and G. T. Robertson. 2002. Streptococcus pneumoniae as a genomics platform for broad-spectrum antibiotic discovery. Curr. Opin. Microbiol. 5:338-342. [DOI] [PubMed] [Google Scholar]
  • 13.Gray, C. W., R. V. Ward, E. Karran, S. Turconi, A. Rowles, D. Viglienghi, C. Southan, A. Barton, K. G. Fantom, A. West, J. Savopoulos, N. J. Hassan, H. Clinkenbeard, C. Hanning, B. Amegadzie, J. B. Davis, C. Dingwall, G. P. Livi, and C. L. Creasy. 2000. Characterization of human HtrA2, a novel serine protease involved in the mammalian cellular stress response. Eur. J. Biochem. 267:5699-5710. [DOI] [PubMed] [Google Scholar]
  • 14.Hassett, D. J., B. E. Britigan, T. Svendsen, G. M. Rosen, and M. S. Cohen. 1987. Bacteria form intracellular free radicals in response to paraquat and streptonigrin. Demonstration of the potency of hydroxyl radical. J. Biol. Chem. 262:13404-13408. [PubMed] [Google Scholar]
  • 15.Hava, D. L., and A. Camilli. 2002. Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors. Mol. Microbiol. 45:1389-1406. [PMC free article] [PubMed] [Google Scholar]
  • 16.Hoffman, S. L., W. O. Rogers, D. J. Carucci, and J. C. Venter. 1998. From genomics to vaccines: malaria as a model system. Nat. Med. 4:1351-1353. [DOI] [PubMed] [Google Scholar]
  • 17.Johnson, S. R., B. M. Steiner, D. D. Cruce, G. H. Perkins, and R. J. Arko. 1993. Characterization of a catalase-deficient strain of Neisseria gonorrhoeae: evidence for the significance of catalase in the biology of N. gonorrhoeae. Infect. Immun. 61:1232-1238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Jones, C. H., T. C. Bolken, K. F. Jones, G. O. Zeller, and D. E. Hruby. 2001. Conserved DegP protease in gram-positive bacteria is essential for thermal and oxidative tolerance and full virulence in Streptococcus pyogenes. Infect. Immun. 69:5538-5545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kadioglu, A., N. A. Gingles, K. Grattan, A. Kerr, T. J. Mitchell, and P. W. Andrew. 2000. Host cellular immune response to pneumococcal lung infection in mice. Infect. Immun. 68:492-501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kaplan, S. L., and E. O. Mason, Jr. 1998. Management of infections due to antibiotic-resistant Streptococcus pneumoniae. Clin. Microbiol. Rev. 11:628-644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kerr, A. R., J. J. Irvine, J. J. Search, N. A. Gingles, A. Kadioglu, P. W. Andrew, W. L. McPheat, C. G. Booth, and T. J. Mitchell. 2002. Role of inflammatory mediators in resistance and susceptibility to pneumococcal infection. Infect. Immun. 70:1547-1557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Lacks, S., and R. D. Hotchkiss. 1960. A study of the genetic material determining an enzyme activity in the pneumococcus. Biochem. Biophys. Acta 39:508-517. [DOI] [PubMed] [Google Scholar]
  • 23.LeBlanc, D. J., L. N. Lee, and A. Abu-Al-Jaibat. 1992. Molecular, genetic, and functional analysis of the basic replicon of pVA380-1, a plasmid of oral streptococcal origin. Plasmid 28:130-145. [DOI] [PubMed] [Google Scholar]
  • 24.Li, S. R., N. Dorrell, P. H. Everest, G. Dougan, and B. W. Wren. 1996. Construction and characterization of a Yersinia enterocolitica O:8 high-temperature requirement (htrA) isogenic mutant. Infect. Immun. 64:2088-2094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Mascher, T., D. Zahner, M. Merai, N. Balmelle, A. B. de Saizieu, and R. Hakenbeck. 2003. The Streptococcus pneumoniae cia regulon: CiaR target sites and transcription profile analysis. J. Bacteriol. 185:60-70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Noone, D., A. Howell, R. Collery, and K. M. Devine. 2001. YkdA and YvtA, HtrA-like serine proteases in Bacillus subtilis, engage in negative autoregulation and reciprocal cross-regulation of ykdA and yvtA gene expression. J. Bacteriol. 183:654-663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Ponting, C. P. 1997. Evidence for PDZ domains in bacteria, yeast, and plants. Protein Sci. 6:464-468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Poquet, I., V. Saint, E. Seznec, N. Simoes, A. Bolotin, and A. Gruss. 2000. HtrA is the unique surface housekeeping protease in Lactococcus lactis and is required for natural protein processing. Mol. Microbiol. 35:1042-1051. [DOI] [PubMed] [Google Scholar]
  • 29.Pozzi, G., L. Masala, F. Iannelli, R. Manganelli, L. S. Havarstein, L. Piccoli, D. Simon, and D. A. Morrison. 1996. Competence for genetic transformation in encapsulated strains of Streptococcus pneumoniae: two allelic variants of the peptide pheromone. J. Bacteriol. 178:6087-6090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • 31.Sebert, M. E., L. M. Palmer, M. Rosenberg, and J. N. Weiser. 2002. Microarray-based identification of htrA, a Streptococcus pneumoniae gene that is regulated by the CiaRH two-component system and contributes to nasopharyngeal colonization. Infect. Immun. 70:4059-4067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Seol, J. H., S. K. Woo, E. M. Jung, S. J. Yoo, C. S. Lee, K. J. Kim, K. Tanaka, A. Ichihara, D. B. Ha, and C. H. Chung. 1991. Protease Do is essential for survival of Escherichia coli at high temperature: its identity with the htrA gene product. Biochem. Biophys. Res. Commun. 176:730-736. [DOI] [PubMed] [Google Scholar]
  • 33.Siber, G. R. 1994. Pneumococcal disease: prospects for a new generation of vaccines. Science 265:1385-1387. [DOI] [PubMed] [Google Scholar]
  • 34.Spiess, C., A. Beil, and M. Ehrmann. 1999. A temperature-dependent switch from chaperone to protease in a widely conserved heat shock protein. Cell 97:339-347. [DOI] [PubMed] [Google Scholar]
  • 35.Strauch, K. L., K. Johnson, and J. Beckwith. 1989. Characterization of degP, a gene required for proteolysis in the cell envelope and essential for growth of Escherichia coli at high temperature. J. Bacteriol. 171:2689-2696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Tettelin, H., K. E. Nelson, I. T. Paulsen, J. A. Eisen, T. D. Read, S. Peterson, J. Heidelberg, R. T. DeBoy, D. H. Haft, R. J. Dodson, A. S. Durkin, M. Gwinn, J. F. Kolonay, W. C. Nelson, J. D. Peterson, L. A. Umayam, O. White, S. L. Salzberg, M. R. Lewis, D. Radune, E. Holtzapple, H. Khouri, A. M. Wolf, T. R. Utterback, C. L. Hansen, L. A. McDonald, T. V. Feldblyum, S. Angiuoli, T. Dickinson, E. K. Hickey, I. E. Holt, B. J. Loftus, F. Yang, H. O. Smith, J. C. Venter, B. A. Dougherty, D. A. Morrison, S. K. Hollingshead, and C. M. Fraser. 2001. Complete genome sequence of a virulent isolate of Streptococcus pneumoniae. Science 293:498-506. [DOI] [PubMed] [Google Scholar]
  • 37.Tseng, H. J., A. G. McEwan, J. C. Paton, and M. P. Jennings. 2002. Virulence of Streptococcus pneumoniae: PsaA mutants are hypersensitive to oxidative stress. Infect. Immun. 70:1635-1639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wizemann, T. M., J. H. Heinrichs, J. E. Adamou, A. L. Erwin, C. Kunsch, G. H. Choi, S. C. Barash, C. A. Rosen, H. R. Masure, E. Tuomanen, A. Gayle, Y. A. Brewah, W. Walsh, P. Barren, R. Lathigra, M. Hanson, S. Langermann, S. Johnson, and S. Koenig. 2001. Use of a whole genome approach to identify vaccine molecules affording protection against Streptococcus pneumoniae infection. Infect. Immun. 69:1593-1598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Zumbrunn, J., and B. Trueb. 1996. Primary structure of a putative serine protease specific for IGF-binding proteins. FEBS Lett. 398:187-192. [DOI] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES