Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2004 Jun;72(6):3336–3343. doi: 10.1128/IAI.72.6.3336-3343.2004

Recombinant Mycobacterium bovis BCG Expressing the Sm14 Antigen of Schistosoma mansoni Protects Mice from Cercarial Challenge

Paula B Varaldo 1, Luciana C C Leite 1,*, Waldely O Dias 1, Eliane N Miyaji 1, Fabio I G Torres 1, Vera C Gebara 1, Geraldo R G Armôa 2, Adriano S Campos 2, Denise C S Matos 2, Nathalie Winter 3, Brigitte Gicquel 3,4, Mônica M Vilar 5, Johnjoe McFadden 6, Marilia S Almeida 7, Miriam Tendler 5,*, Douglas McIntosh 2,†
PMCID: PMC415698  PMID: 15155638

Abstract

The Sm14 antigen of Schistosoma mansoni was cloned and expressed in Mycobacterium bovis BCG as a fusion with the Mycobacterium fortuitum β-lactamase protein under the control of its promoter, pBlaF*; the protein was localized in the bacterial cell wall. The rBCG-Sm14 strain was shown to be relatively stable in cultured murine and bovine monocytes in terms of infectivity, bacterial persistence, and plasmid stability. The immunization of mice with rBCG-Sm14 showed no induction of anti-Sm14 antibodies; however, splenocytes of immunized mice released increased levels of gamma interferon upon stimulation with recombinant Sm14 (rSm14), indicating an induction of a Th1-predominant cellular response against Sm14. Mice immunized with one or two doses of rBCG-Sm14 and challenged with live S. mansoni cercaria showed a 48% reduction in worm burden, which was comparable to that obtained by immunization with three doses of rSm14 purified from Escherichia coli. The data presented here further enhance the status of Sm14 as a promising candidate antigen for the control of schistosomiasis and indicate that a one-dose regimen of rBCG-Sm14 could be considered a convenient means to overcome many of the practical problems associated with the successful implementation of a multiple-dose vaccine schedule in developing countries.


Schistosome infections, caused primarily by Schistosoma mansoni, Schistosoma haematobium, and Schistosoma japonicum, affect over 200 million people, mainly in the developing world, resulting in severe morbidity and mortality. In most cases the disease can be successfully treated by chemotherapy, but rapid reinfection rates for patients in endemic areas require repeated treatment, sometimes as often as once a year. Thus, there is a need for complementary long-term control measures, such as a vaccine (5, 6). Protection levels as high as 90% have been reported for the use of irradiated cercaria for immunization of a variety of animal models, ranging from rodents to nonhuman primates (11, 27). However, delivery problems, the need for a standardized product, and safety considerations combine to make this approach impractical for human use.

Extensive research on the biology of the parasite has identified six candidate antigens, which are currently included in a World Health Organization-sponsored program to develop a vaccine for the improved control of schistosomiasis (5, 6). Among these antigens is the fatty-acid-binding protein Sm14 of S. mansoni (23). This antigen, when produced as a recombinant protein by Escherichia coli, has been shown to form the basis for a dual-purpose antihelminth vaccine that is capable of conferring protection in outbred mice and rabbits against infection by S. mansoni and the ruminant helminth Fasciola hepatica (26, 30). The latter parasite is the causative agent of fascioliasis, an economically important disease of cattle and sheep in Europe, the Americas, and Australasia (12). The rationale for developing a schistosomiasis vaccine is multifactorial (6), but a key aspect is that a reduction in morbidity, rather than sterile immunity, is the target. Thus, a partially protective vaccine would be effective.

The bacillus Calmette-Guérin (BCG), a live attenuated Mycobacterium bovis strain that has been used for the prevention of human tuberculosis for decades, is considered a promising candidate for the development of live vector systems for the delivery of foreign antigens to the immune system (16, 25). Several advantages are associated with the use of BCG as an antigen-presenting system, including its known adjuvant properties, its ability to elicit humoral or cellular immune responses toward heterologous antigens, its thermostability, which eliminates the need for a cold chain, and most importantly, the possibility of obtaining an efficient immune response by using a single dose. During the last 10 years, expression systems have been developed for the production of a variety of bacterial, parasitic, and viral antigens by BCG, and the capacity of these recombinant systems to induce both cellular and humoral immune responses in various experimental models is well documented (2, 17, 20, 25). Furthermore, it has been demonstrated that recombinant BCG strains can induce protective immunity in animal models (1, 24, 29).

Recombinant BCG technology has previously been employed in the development of experimental schistosomiasis vaccines based on the enzyme glutathione S-transferase from S. mansoni (19) and S. haematobium (18). Both vaccines were found to elicit significant humoral immune responses toward the recombinant antigen when they were administered by a variety of routes, although no information is available about the potential protective capacities of these constructs.

For the present study, we developed a recombinant BCG strain which expresses the Sm14 antigen on the surface of the bacterium. Thereafter, the stability of the construct was evaluated in murine and bovine monocyte cultures. Immunization of mice with this strain induced an Sm14-specific Th1-based immune response, which paralleled a significant reduction in the worm burden in outbred Swiss mice challenged with S. mansoni cercaria.

MATERIALS AND METHODS

Bacterial strains, growth conditions, and vaccine preparation.

All cloning steps were performed with E. coli DH5α grown in Luria-Bertani medium supplemented with ampicillin (100 μg/ml) or kanamycin (20 μg/ml). The M. bovis BCG Pasteur strain 1172P2 was used to generate recombinant BCG (rBCG) strains. Liquid cultures of BCG strains were routinely grown in Middlebrook 7H9 medium supplemented with an albumin-dextrose-catalase enrichment (MB7H9; Difco, Detroit, Mich.), with or without kanamycin (20 μg/ml), in stationary 25-cm2 tissue culture flasks at 37°C in a humidified 5% CO2 atmosphere. The rBCG strains were cultured in Ungar's medium for heterologous protein localization assays. BCG was transformed by electroporation as previously described (25a) and plated onto Middlebrook 7H10 agar plates supplemented with an oleic acid-albumin-dextrose-catalase enrichment (MB7H10; Difco) containing kanamycin (20 μg/ml). Plates were incubated at 37°C for 3 weeks before expansion of the transformed colonies in liquid medium. rBCG vaccines were prepared from mid-log-phase liquid cultures of selected clones. The liquid cultures were centrifuged at 4,000 × g, resuspended in 10% glycerol, and maintained frozen at −80°C until use. Immediately before immunization, cells were thawed and diluted in saline to reach appropriate concentrations. Alternatively, for challenge assays, mice were immunized with fresh cultures of exponentially growing mycobacteria, with the actual vaccine dose calculated retrospectively by plating to determine viable numbers.

Plasmid vectors.

pGEMEX-sm14 (containing the sm14 gene (31), pGEM-T Easy (Promega), and the mycobacterial expression vectors pLA71, pLA73 (22), and pMIP12 (21) were used. The mycobacterial expression vectors contain the E. coli and mycobacterial origins of replication, a kanamycin resistance gene, the up-regulated Mycobacterium fortuitum promoter pBlaF*, its ATG initiation codon, and a multicloning site which places the heterologous gene in fusion with the signal sequence or the whole β-lactamase-encoding gene in pLA71 and pLA73, respectively. pMIP12 has a conserved mycobacterial Shine-Dalgarno sequence that may elevate antigen expression, and the native gene is expressed.

Construction of sm14 expression vector.

The 402-bp fragment containing the sm14 gene was amplified by PCR from pGEMEX-sm14, using the following primers: 5′TAGGGTACCCTGTAGTTTCTTGGGAAAGTGGAA3′ (a KpnI site is underlined) and 5′TAGGGTACCGCGGCCGCGATATCTTAGGATAGTCGTTTATAATTGC3′ (a KpnI site is underlined, an EcoRV site is in italics, and a NotI site is in bold) for insertion in pLA71 and pLA73 and 5′TAGGGATCCTCTAGTTTCTTGGGAAAGTG3′ (a BamHI site is in italics) and 5′TAGGGTACCTTAGGATAGTCGTTTATAATTGC3′ (a KpnI site is underlined) for insertion in pMIP12. PCR fragments were cloned into pGEM-T Easy and then subcloned into the mycobacterial expression vectors, generating pPL71-sm14, pPL73-sm14, and pPL12-sm14, respectively (Fig. 1).

FIG. 1.

FIG. 1.

Schematic representation of promoter and antigen regions of shuttle vectors pPL71-sm14, pPL73-sm14, and pPL12-sm14. All vectors contain E. coli and mycobacterial origins of replication, a kanamycin resistance gene (aph), pBlaF*, and sm14. pPL71-sm14 has the β-lactamase signal sequence (ssBlam) and pPL73-sm14 has the complete β-lactamase sequence (Blam) fused to the sm14 sequence, while pPL12-sm14 has a conserved mycobacterial Shine-Dalgarno sequence (Mega SD).

Western blotting and localization of heterologous proteins in rBCG.

A Western blot analysis of individual kanamycin-resistant BCG transformants was performed by using a previously reported protocol (20), with the following modifications: sodium dodecyl sulfate-polyacrylamide gel electrophoresis employed 12% resolving gels and the presence of Sm14 was detected by use of a mouse polyclonal antiserum (1:1,000) raised against rSm14 (recombinant Sm14 purified from E. coli) as a primary antibody. Clones of rBCG expressing the heterologous protein (as determined by Western blotting) were grown in 30-ml cultures of Ungar's medium supplemented with kanamycin. Cells were harvested by centrifugation, and the culture supernatant and cell pellet were processed and analyzed as described previously (20).

In vitro stability of rBCG.

Frozen aliquots of rBCG vaccine preparations were diluted (1/100 [vol/vol]) in MB7H9 medium and grown to an optical density at 594 nm of 0.8. A 1/100 dilution of this starting culture was further grown under the same conditions. Both cultures were used as inocula at suitable dilutions for plates of MB7H10 agar with or without kanamycin (20 μg/ml). The numbers of CFU recovered on kanamycin- versus non-kanamycin-containing plates were compared to estimate the functional plasmid stability.

Preparation of bovine and murine monocyte cultures.

Blood (150 ml) from the jugular veins of two animals from a certified tuberculin-negative cattle herd held at the Rural University of Rio de Janeiro was collected into heparin-coated Vacutainers (Greiner). Blood was diluted in an equal volume of phosphate-buffered saline (PBS) (pH 7.2) and subjected to Ficoll gradient centrifugation. The coat containing white blood cells was collected, washed twice in PBS, and resuspended in culture medium (RPMI 1640, 2% fetal calf serum [FCS], 2 mM l-glutamine, 10 mM HEPES) (Gibco). Each suspension was divided between four tissue culture flasks and incubated for 7 days at 37°C in a humidified 5% CO2 atmosphere. The medium was changed after 3 days, and at day 7, the remaining nonadherent cells were removed by two washes with PBS, after which the adhered cells from each flask were gently scraped into 3 ml of PBS, pooled, and sedimented by centrifugation. Cells were resuspended in culture medium containing 10% FCS, plated on 24-well tissue culture plates (5 × 104 cells per well), and then incubated for a further 48 h prior to being used in infection experiments. Nearly confluent monolayers of the established murine macrophage cell line RAW 264.7 were produced from frozen stocks over a period of 4 days. The monolayers were washed once with PBS, scraped, and plated on 24-well plates (5 × 104 cells per well) 18 h prior to their use in infection experiments. The culture medium was the same as that used for the bovine cells, except for the FCS concentration, which was 1%.

Infection of monocyte cultures with BCG and rBCG.

Cultures of BCG and rBCG (10 ml) were grown in tissue culture flasks to a density of ∼108 cells/ml. For the production of homogeneous cell suspensions, cultures were transferred to centrifuge tubes, vortexed for 1 min, and then left standing for 15 min to allow the settlement of large clumps. The upper 8 ml of each suspension was carefully transferred to a new tube, and the bacteria were pelleted by centrifugation, washed twice in PBS, and finally resuspended in 10 ml of complete RPMI culture medium. Total cell counts were performed by direct counting, cell densities were adjusted to 106 bacteria/ml in complete RPMI medium, and 500 μl of the culture was added to each well containing bovine or murine cells, to achieve a theoretical multiplicity of infection (MOI) of 10 bacteria/macrophage. The actual number of viable cells in each bacterial suspension was determined by preparing serial dilutions and plating them on MB7H10 agar. As such, the true MOI was determined retrospectively. In general, the number of viable cells was 20 to 50% lower than the value determined by microscopy, resulting in MOI values which ranged from 5 to 8 bacteria per macrophage, for four separate infection experiments. The bacteria were left in contact with the macrophages for 3 h, and then the monolayers were washed twice with 2 ml of PBS to remove the bulk of the nonphagocytosed bacteria. Thereafter, a sample comprising six wells from each plate of infected cells was processed to determine the infective capacity of rBCG compared to that of wild-type BCG. Briefly, monocytes/macrophages in six individual wells were lysed by incubation for 5 min in 0.2 ml of 0.05% Tween 80. The lysates were pooled, and the wells were then washed by the passage of a 0.8-ml volume of PBS from well to well, which was combined with the lysates. The lysate-washing mixtures were centrifuged at 10,000 × g for 10 min to sediment the released bacteria, the supernatants were removed by aspiration, the pellets were resuspended in 100 μl of MB7H9 medium and serially diluted to 10−4, and triplicate 20-μl drops of each dilution were plated on MB7H10 agar, with or without kanamycin. Complete cell culture medium containing gentamicin (50 μg/ml) was added to the remaining 18 wells of each plate in order to kill extracellular bacteria that were not removed by washing. Sampling of the remaining infected cells was performed at 24 h and at 4 and 7 days as described above in order to provide data on the kinetics of persistence and the degree of plasmid maintenance by rBCG, as determined by a comparison of the bacterial numbers recovered on MB7H10 agar with or without kanamycin.

Evaluation of vector structural stability.

Five individual colonies of rBCG(pPL73-sm14), recovered from infected monocytes and sampled at 4 days postinfection, were used to transform E. coli DH5α by electroduction (4). Plasmid DNAs were purified from two individual transformants by use of a Flexiprep kit (Pharmacia) and were subsequently digested with the restriction endonucleases EcoRI and HindIII. Digested vectors were subjected to electrophoresis in 1% agarose gels, and the restriction pattern of this material was compared to that generated by digestion of the original vector with the same enzymes.

Animals and analysis of humoral immune response.

Female 4-week-old BALB/c or Swiss mice (Instituto Butantan) were used for evaluations of the immune response against the rBCG strains. Mice were immunized intraperitoneally with 106 CFU/0.5 ml of BCG or an rBCG strain expressing Sm14. Positive and negative controls were three doses of 10 μg of rSm14 in alum per animal and three doses of saline, respectively. The animals were bled 4 weeks after the first dose. Animals received a booster dose 5 weeks after priming and a subimmunizing rSm14 dose (1 μg per animal) 7 weeks after priming. Antibody responses to Sm14 in pooled sera of immunized mice were quantified by enzyme-linked immunosorbent assays (ELISAs) using rSm14 (2 μg/ml in bicarbonate-carbonate buffer, pH 9.6, incubated at 4°C overnight) as the coating antigen. Thereafter, plates were processed as previously reported (24).

Preparation of spleen cells from immunized animals and lymphokine assays.

Spleens were removed from two BALB/c or Swiss mice 4 weeks after immunization with rBCG(pPL73-Sm14) or the saline, BCG, and rSm14 controls. Splenocyte cultures were prepared as previously described (24) and incubated with rSm14 (1 μg/ml) as the antigen-specific stimulation and concanavalin A (5 μg/ml; Sigma) as a positive control for cell reactivity. Control cells were incubated in complete medium only, without antigen. Cultures were incubated for 3 days in a humidified 5% CO2 incubator at 37°C. The culture supernatants were harvested at 24, 48, and 72 h in order to determine the optimal time for lymphokine secretion and were stored at −20°C until further quantification of gamma interferon (IFN-γ) and interleukin-4 (IL-4). IFN-γ and IL-4 levels in the supernatants of stimulated cells were quantified by ELISAs, as described elsewhere (24). Sample concentrations from standard curves were obtained by nonlinear regression analysis (Graph Pad Prism, version 2.0).

Challenge experiments.

Two separate vaccine trials were established, with a gap of 1 month between their initiations. Each trial employed seven duplicate experimental groups (Table 1), with each group comprising 15 female 4-week old Swiss mice. The efficacy of vaccination with rBCG(pPL73-sm14) was compared to that achieved by the administration of three doses of rSm14 (10 μg in alum) in the foot pad. Liquid cultures of BCG and rBCG for use as vaccines were grown and evaluated for viability as described above, except that inocula were prepared in PBS rather than culture medium. Mice were immunized intraperitoneally with 106 CFU of BCG or rBCG(pPL73-sm14) in 0.1 ml of PBS, in single or duplicate doses. The viable number in each vaccine preparation was determined retrospectively as described above. For assays of protection, mice were challenged subcutaneously with 100 S. mansoni cercaria 60 days after the booster doses of BCG or rBCG and were perfused 45 days after the infective challenge. Since the results of the two trials were no more than 20% different, they were combined. Worm loads and protection levels for the different challenge groups were calculated as described previously (30). Statistical significance was evaluated by the standard Student t test.

TABLE 1.

Imunization regimen employed to examine the capacity of rBCG-Sm14 to confer protection against challenge with S. mansoni cercaria

Vaccine trial Content of immunizationa
Primary (day 0) Secondary (day 45)
Negative control Saline in alum None
BCG BCG None
BCG BCG
rBCG-Sm14 rBCG-Sm14 None
rBCG-Sm14 rBCG-Sm14
rBCG-Sm14 rSm14 (10 μg) in alum
Positive control rSm14 (10 μg) in alum three doses 1 week apart)
a

The numbers of viable cells administered were as follows. Doses for trial 1: BCG primary dose, 8.4 × 105; secondary dose, 9.0 × 105; rBCG-Sm14 primary dose, 7.3 × 105; secondary dose, 8.5 × 105. Doses for trial 2: BCG primary dose, 6.3 × 105; secondary dose, 7.6 × 105; rBCG-Sm14 primary dose, 6.8 × 105; secondary dose, 1.0 × 106.

RESULTS

Expression and localization of recombinant Sm14 in BCG.

Three mycobacterial expression vectors were constructed, based on the pBlaF* promoter, in which the sm14 gene was or was not placed in fusion with different fragments of the β-lactamase gene (Fig. 1). Competent BCG Pasteur 1172P2 cells were transformed with these constructs, and the resulting recombinant clones were analyzed by immunoblotting using polyclonal anti-rSm14 antisera. All clones of rBCG(pPL73-sm14) were found to express a protein with a molecular mass of approximately 45 kDa, which corresponds to the expected molecular mass of the fusion product of the whole β-lactamase protein (31 kDa) and Sm14 (14 kDa) (Fig. 2a). The positive control containing 1 μg of purified rSm14 was seen at ∼14 kDa. No degradation products were observed, indicating that the fusion protein was probably relatively stable. This protein was not detected in nontransformed BCG or BCG transformed with the empty vector, pLA73. Attempts to demonstrate the production of recombinant Sm14 by using chromogen-based detection (BCIP/NBT [5-bromo-4-chloro-3-indolylphosphate-nitroblue tetrazolium] in combination with alkaline phosphatase-labeled secondary antibodies) were unsuccessful, indicating that the level of expression was low. The use of constructs designed to express recombinant Sm14 in its native form (pPL12-sm14) or in fusion with only the β-lactamase signal sequence (pPL71-sm14) did not result in the recovery of any transformants expressing detectable levels of Sm14 (data not shown).

FIG. 2.

FIG. 2.

Expression of Sm14 in rBCG. (a) Total cell extracts of BCG (50 μg) were analyzed by Western blotting using anti-rSm14 antiserum. Lanes: 1, BCG; 2, rBCG(pPL71-sm14); 3, rBCG(pPL73-sm14); 4, rBCG(pPL12-sm14); 5, control rSm14 (1 μg). (b) Localization of heterologous protein in rBCG(pPL73-sm14). Fractions of the extract of rBCG were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblotting using anti-rSm14 antiserum. Lanes: 1, total extract; 2, membrane; 3, cytosol; 4, cell wall. Molecular masses are indicated to the left.

Cellular extracts of rBCG(pPL73-sm14) were fractionated by detergent phase partitioning with Triton X-114. A subsequent analysis of the subcellular fractions by Western blotting revealed that the Sm14 fusion protein was detected almost exclusively in the mycobacterial cell wall (Fig. 2b).

Behavior of rBCG(pPL73-sm14) in monocyte cultures.

The infectivity, bacterial persistence, and plasmid stability of the rBCG(pPL73-sm14) strain were evaluated in both murine and bovine monocyte cultures. A total of four separate infection experiments were conducted, using adherent monocytes cultured from either the established murine cell line RAW 264.7 or two tuberculin-negative bovines. In terms of infectivity, we observed that between 5 and 10% of the bacterial inocula (BCG and rBCG) was taken up by the monocytes and recovered in the initial samples collected 3 h after contact with macrophages (Fig. 3). Regarding persistence, there was a gradual decline (as much as 2 log in one experiment, but more often a single log) in the numbers of BCG and rBCG recovered from RAW 264.7 cells over the 7-day experimental period (Fig. 3a). In the case of the bovine macrophage cultures, an increased decline in the numbers of BCG and rBCG was observed (routinely 2 log and exceptionally as much as 3 log) (Fig. 3b), indicating that these cells represent a more hostile environment than that presented by murine cells.

FIG. 3.

FIG. 3.

Evaluation of infectivity, persistence, and plasmid maintenance of BCG and rBCG(pPL73-sm14) within murine (RAW 264.7) (a) and bovine (b) monocyte cultures. CFU are shown in log10 units. Time zero samples represent the total numbers of viable cells that were added to six wells (of a 24-well plate), i.e., the starting inocula. At each sample point, six wells were lysed and the number of CFU recovered on medium with and without kanamycin was recorded. Values recorded at 3 h represent the numbers of bacteria which had been internalized after 3 h of contact with the monocytes. As such, they provide a value for the infectivity of BCG and rBCG for each culture. The values recorded at 24 h and at 4 and 7 days give an indication of the persistence of each strain for the experimental period.

The issue of segregational vector stability (as measured in terms of loss of resistance to kanamycin) was assessed by comparing the number of CFU recovered on medium with and without kanamycin at each sampling point. We observed that at all points from 24 h onwards, approximately 10% of the cells recovered from both bovine and murine intracellular environments failed to grow on medium containing kanamycin (Fig. 3), suggesting that there had been a limited degree of plasmid loss. Interestingly, the pPL73-sm14 construct showed 100% stability for 7 days in the absence of selective pressure when grown in complete MB7H9 medium (data not shown), indicating that the observed plasmid loss in the macrophage cultures was in response to host factors which would likely exert a similar influence in vivo. In terms of structural vector stability, no gross modifications or rearrangements were observed for plasmids isolated from rBCG recovered after 4 days from macrophages of either species.

Immune response induced by rBCG expressing Sm14.

In order to determine if rBCG(pPL73-sm14) could induce a humoral immune response against Sm14, we immunized BALB/c mice with rBCG-Sm14 or the positive and negative controls. A booster dose of rBCG-Sm14 and its negative controls was administered under the same conditions at 6 weeks. Sera were collected every 2 weeks and analyzed by ELISA for the formation of anti-Sm14 antibodies. No anti-Sm14 antibodies were detected in any of the groups, up to 4 weeks after the booster, except for the animals immunized with E. coli-derived rSm14 (results not shown). In order to determine if the rBCG-Sm14-immunized animals had been primed to respond to the antigen, a previously defined subimmunizing dose of rSm14 (1 μg/animal) was administered 2 weeks after the booster. However, even then, no anti-Sm14 antibodies were detectable after 2 and 4 weeks. These results indicate that rBCG-Sm14 does not induce a detectable humoral immune response against the antigen in BALB/c mice.

For an examination of cellular immune responses, BALB/c (or Swiss) mice were administered rBCG-Sm14, saline, or BCG (as described above). After 4 weeks, splenocytes were isolated for the quantification of Sm14-specific IFN-γ and IL-4 production. Splenocytes from mice immunized with rBCG-Sm14 consistently showed the most responsiveness to stimulation with rSm14, as shown in Fig. 4. As previously demonstrated, BCG-immunized animals also showed a nonspecific increase in IFN-γ production, although at consistently lower levels. IL-4 secretion in rBCG-Sm14-immunized mice was not significantly different from that in control groups (results not shown).

FIG. 4.

FIG. 4.

Cellular response induced by immunization with rBCG-Sm14. The data show IFN-γ production by rSm14-stimulated splenocyte cultures from BALB/c mice immunized with BCG or rBCG(pPL73-sm14) (106 CFU). The cytokine content was estimated as described in Materials and Methods. The error bars indicate standard deviations.

rBCG-Sm14 provides protection against cercarial infection.

Groups of Swiss mice received one or two doses of rBCG-Sm14 (at an interval of 45 days). Another group received one dose of rBCG-Sm14 and one dose of rSm14, also after 45 days. Negative controls received one or two doses of BCG or three doses of saline, and the positive control group received three doses of rSm14. Sera were collected the day before each booster and 60 days after the last. Confirming the data obtained with BALB/c mice, neither one nor two doses of rBCG-Sm14 induced detectable levels of anti-Sm14 antibodies. However, one dose of rBCG-Sm14 followed by a full dose of rSm14 induced a low level of anti-Sm14 antibodies, with titer units of 1:320. This contrasts with the case seen for three doses of rSm14, with titer units reaching 1:2,560 but declining to a level of 1:640 before the challenge. Immunized animals were challenged subcutaneously with 100 live S. mansoni cercaria 60 days after the last immunization, and cercaria were recovered from the liver after 45 days by perfusion. Two trials were conducted 1 month apart, and the worm burden data were combined. The data presented in Fig. 5 and Table 2 demonstrate that a single dose of rBCG-Sm14 provided significant protection (∼48%) for outbred Swiss mice, as measured by the reduction of the worm burden compared to that in nonvaccinated controls. The protection obtained was comparable to that achieved by using the standard three-dose schedule for rSm14 (Table 2). Interestingly, we observed that a booster dose of rBCG did not result in a significant enhancement of the protection obtained with a single dose (Table 2). Similarly, no improvement in protection was observed when a single booster dose of rSm14 was given 45 days after the primary immunization with rBCG-Sm14. Finally, the effect of either a single dose or duplicate doses of nontransformed BCG upon the worm burden was markedly lower (∼26%) and most likely reflects a nonspecific adjuvant effect associated with BCG.

FIG. 5.

FIG. 5.

Scattergram of worm burden in mice immunized with rBCG(pPL73-sm14) according to the immunization schedule shown in Table 1.

TABLE 2.

Protection induced by rBCG-Sm14 against S. mansoni cercarial challenge

Immunization groupa Worm burden (no. of worms recovered after challenge with 100 worms) Protection (%) Significance (P)b
Saline 23.4
Single dose of BCG 17.2 26 0.006
Two doses of BCG 20.9 11 0.25
Single dose of rBCG Sm14 12.2 48 1 × 10−6
Two doses of rBCG Sm14 12.2 48 1 × 10−6
Single dose of rBCG Sm14 boosted with single dose of rSm14 (10 μg in alum) 11.9 49 2 × 10−7
Three doses of rSm14 (10 μg in alum) 12.7 46 5 × 10−6
a

Immunizations are described further in Table 1.

b

By Student's t test.

DISCUSSION

We have obtained expression of the S. mansoni antigen Sm14 in M. bovis BCG as a stable fusion with the whole M. fortuitum β-lactamase protein. It is noteworthy that vectors designed to express Sm14 that was not fused or was fused only with the β-lactamase signal sequence showed no detectable expression of the antigen. This observation mirrors the results of a previous study, in which the level of expression of the S1 subunit of pertussis toxin was markedly higher when this antigen was produced as a fusion with the entire β-lactamase protein rather than just the exportation peptide (24). This reinforces the hypothesis that some heterologous proteins need a transcription or translation start site from a mycobacterial protein in order to be expressed in BCG. On the other hand, a difference in codon usage could also hinder expression. Improved expression was a beneficial secondary effect of the fusion with the β-lactamase protein; however, the primary motive for employing this strategy was to obtain exportation of the antigen. Fractionation of the bacterium's cellular compartments into cytosol, membrane, cell wall, and extracellular media showed that the antigen was localized predominantly in the cell wall-enriched fraction. Once again these findings parallel previous results with the S1 subunit of pertussis toxin, for which neither a fusion with only the β-lactamase signal sequence nor a fusion with the whole β-lactamase protein resulted in complete exportation (24). We consider it unlikely that the size of the fusion protein (45 kDa) was responsible for the failure to attain secretion, given that BCG secretes a number of proteins with molecular masses of >45 kDa. Instead, our results further support the concept that size is not the only factor that influences the ability of such fusion molecules to translocate across the mycobacterial cell wall; additional characteristics of the heterologous protein should also play an important role.

In spite of promising results from numerous studies (reviewed in reference 25), no rBCG vaccine is currently licensed for use in either humans or animals. Indeed, only a single candidate rBCG vaccine, based on the expression of the OspA antigen from Borrelia burgdorferi (29), has been evaluated in a phase I human clinical trial (13). Surprisingly, this vaccine failed to induce immunity in humans, despite having being shown to be highly immunogenic and protective in various strains of mice (29). The reasons for this phenomenon remain unresolved, but they highlight the requirement for model systems with which to assess candidate rBCG vaccines in terms of their ability to infect, persist, and stably maintain their expression systems under conditions which resemble those encountered in the species for which the vaccine is being developed, or even as a preliminary step before embarking on costly small-animal experimentation. In this context, ex vivo macrophage cultures are commonly employed for the study of microbial (including mycobacterial) pathogenicity and host-pathogen interactions within intracellular environments (3, 28). Thus, we chose to evaluate the Sm14-expressing rBCG construct within macrophage cultures of both murine (our small-animal model) and bovine (an intended end user species, along with humans) origins, with the objective of detecting any major problems which might compromise its usefulness as a vaccine. Our results showed that the persistence of either BCG or rBCG declined with time in both murine, and more pronouncedly, bovine cells. Data from the study of Aldwell et al. (3) demonstrated that BCG Pasteur 1173P2 is capable of persistence, but not replication, in both bovine alveolar macrophages and murine peritoneal macrophages, although they did not observe the marked decrease in CFU recorded in the present study. It is possible that the stronger mycobactericidal activity observed for the bovine macrophages used in our study may have resulted from the cattle having been sensitized by natural exposure to environmental mycobacteria, although they had negative test results for tuberculin. This phenomenon has been suggested as a probable explanation for the highly variable efficacy of BCG vaccination in both humans (7) and cattle (10). In the bovine study, BCG vaccination was seen to be moderately effective in protecting cows against tuberculosis in two experimental trials but was ineffective in a third trial using cattle that were accredited as being tuberculosis-free. However, these cattle had high-level IFN-γ responses to purified protein derivative from Mycobacterium avium. The reduced capacity for BCG to persist in these animals compared to that in nonsensitized cattle was implicated as a factor in the failure of the vaccine.

The pPL73-sm14 construct transfected into BCG showed a high level of stability in the absence of selective pressure in vitro (100%) or in the hostile environment of mammalian macrophages (90%). The latter value is similar to the levels of segregational instability seen in mice inoculated with the related construct, pNL71-S1PT (86%) (24), an observation which supports the use of cultured macrophages as a model with which to investigate bacterial and plasmid stability in end-user species. The structural vector stability was also shown to be satisfactory, insofar as no gross modifications were detected in plasmids recovered from rBCG cultured from macrophage lysates. Taken together, these data provided a positive indication that the pPL73-sm14 construct was suitable for use in subsequent experiments with mice and should be able to stably maintain the expression vector if used as a vaccine for cattle.

In contrast to rSm14, which induced high levels of anti-Sm14 antibodies, rBCG-Sm14 induced little, if any, humoral immune response against Sm14. This was in agreement with the low levels of Sm-14-specific IL-4 secretion observed for splenocytes of immunized animals. Furthermore, the same splenocytes showed a marked increase in the production of IFN-γ upon stimulation with rSm14, indicating the induction of a strong Th1-driven cellular immune response. The marked differences noted for the two types of recombinant vaccines based on Sm14, in terms of the ability to stimulate humoral immunity, were not entirely unexpected given that they would be processed by and presented to the immune system by different mechanisms. In this context, it should be noted that the subcellular location of the recombinant antigen has been reported to influence both the quantity and quality of the immune response to a number of antigens produced by rBCG (15, 17, 29). Yet there are numerous examples of rBCG-based vaccines which are capable of inducing strong humoral immune responses to a variety of antigens (25). This reinforces the notion that the immune response induced against heterologous antigens expressed in rBCG is largely dependent on the antigen.

It is worth emphasizing that due to the well-known immune evasion mechanisms utilized by S. mansoni, the immune responses necessary for protection may differ from those generated during a natural infection, and therefore the importance of identifying immunological markers to anticipate vaccine efficacy should not be underestimated. In this context, the immunological basis for the protection against S. mansoni associated with rSm14 has been investigated in mice, but to date no concrete evidence has been presented to explain the mechanisms by which this molecule induces protection. An alternative approach for investigating this issue involved a characterization of the immune responses toward Sm14 in human populations living in areas of Brazil where schistosomiasis is endemic. A study conducted in an area of Minas Gerais State where schistosomiasis is endemic demonstrated that CD4+ T cells from individuals considered to be naturally resistant to schistosomiasis produced IFN-γ and tumor necrosis factor alpha in response to rSm14 (8). Additionally, the anti-Sm14 serum antibody isotype profile of schistosomiasis patients predominantly comprised the immunoglobulin G1 (IgG1) and IgG3 subclasses, with only low levels of IgM, IgA, or IgE being present (9).

It is very interesting that both the induction of a strong humoral immune response against Sm14, such as that seen for the recombinant protein, and the induction of a predominantly cellular immune response, such as that observed for immunization with rBCG-Sm14, were able to reduce the worm burden and protect mice from a challenge with S. mansoni cercaria. However, it is worth considering that the absence of significant levels of IgG in response to rBCG-Sm14 may not truly reflect the role of the humoral immune response in the observed protection, since IgE and IgA isotypes have been suggested to have key roles in protection against schistosomal infections of humans in areas of endemicity, including Brazil (5). Future experiments with the rBCG-Sm14 strain should investigate this aspect in the mouse model.

In previous studies (26, 30), the rSm14 vaccine induced protection levels of up to 65% in outbred mice who received three doses of 10 μg each, and a level of 89% protection was recorded for rabbits immunized with three doses of 80 μg each (30). These results were highly encouraging, but it would be desirable to have a standardized recombinant vaccine which could achieve similar levels of protection when given as a single dose. Such a strategy would reduce the overall expense of any large-scale application of the vaccine and would counter the issue of noncompliance or the inability to adhere to a multidose vaccination schedule. In this context, the results of the present study are encouraging and further research on this topic would be worthwhile.

It is worth pointing out that BCG can be administered orally or intranasally. Interestingly, it has been reported (18) that the intranasal administration of an rBCG vaccine based on the expression of glutathione S-transferase from S. haematobium induces strong systemic and mucosal immune responses, including the production of anti-glutathione antibodies in the lung. It will be valuable to investigate this route of administration in future studies with the rBCG-Sm14 vaccine. This is particularly relevant since shortly after penetration of the skin of the mammalian host, the schistosomula migrate to the lungs and reside there for several days before they reach the liver, where they develop into sexually mature worms that then begin egg deposition. The Sm14 antigen is expressed from the somula to the adult phase, and effective anti-Sm14 immunity in the lungs could help to eliminate the infection at the earliest stage after parasitic invasion.

The data presented here further enhance the status of Sm14 as a promising candidate antigen for use in the control of schistosomiasis and show that the use of rBCG can be considered to represent a convenient means by which to overcome many of the practical problems associated with the successful implementation of a multiple dose vaccine schedule in developing countries.

Acknowledgments

This research was supported by funding from the INCO-DEV (International Cooperation with Developing Countries) program of the European Community (project ICA4 CT-2000-30032). P.B.V. and E.N.M. were FAPESP fellows.

We are grateful to Maria Cristina Vidal Pessolani, Department of Tropical Medicine, Fiocruz, Brazil, for providing cultures of RAW 264.7 cells and to the staff of the Rural University of Rio de Janeiro, Brazil, for providing access to experimental animals and assistance in the collection of blood samples. We also thank Celso R. R. Ramos and Paulo Lee Ho (Instituto Butantan, Butantan, Brazil) for providing rSm14.

Editor: D. L. Burns

REFERENCES

  • 1.Abdelhak, S., H. Louzir, J. Timm, L. Blel, Z. Benlasfar, M. Lagranderie, M. Gheorghiu, K. Dellagi, and B. Gicquel. 1995. Recombinant BCG expressing the leishmania surface antigen Gp63 induces protective immunity against Leishmania major infection in BALB/c mice. Microbiology 141:1585-1592. [DOI] [PubMed] [Google Scholar]
  • 2.Aldovini, A., and R. A. Young. 1991. Humoral and cell-mediated immune responses to live recombinant BCG-HIV vaccines. Nature 351:479-482. [DOI] [PubMed] [Google Scholar]
  • 3.Aldwell, F. E., D. N. Wedlock, L. J. Slobbe, J. F. Griffin, B. M. Buddle, and G. S. Buchan. 2001. In vitro control of Mycobacterium bovis by macrophages. Tuberculosis (Edinburgh) 81:115-123. [DOI] [PubMed] [Google Scholar]
  • 4.Baulard, A., C. Jourdan, A. Mercenier, and C. Locht. 1992. Rapid mycobacterial plasmid analysis by electroduction between Mycobacterium spp. and Escherichia coli. Nucleic Acids Res. 20:4105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bergquist, N. R. 1998. Schistosomiasis vaccine development: progress and prospects. Mem. Inst. Oswaldo Cruz 93(Suppl. 1):95-101. [DOI] [PubMed] [Google Scholar]
  • 6.Bergquist, N. R. 2002. Schistosomiasis: from risk assessment to control. Trends Parasitol. 18:309-314. [DOI] [PubMed] [Google Scholar]
  • 7.Brandt, L., J. Feino Cunha, A. Weinreich Olsen, B. Chilima, P. Hirsch, R. Appelberg, and P. Andersen. 2002. Failure of the Mycobacterium bovis BCG vaccine: some species of environmental mycobacteria block multiplication of BCG and induction of protective immunity to tuberculosis. Infect. Immun. 70:672-678. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Brito, C. F., I. R. Caldas, P. Coura Filho, R. Correa-Oliveira, and S. C. Oliveira. 2000. CD4+ T cells of schistosomiasis naturally resistant individuals living in an endemic area produce interferon-gamma and tumour necrosis factor-alpha in response to the recombinant 14kDa Schistosoma mansoni fatty acid-binding protein. Scand. J. Immunol. 51:595-601. [DOI] [PubMed] [Google Scholar]
  • 9.Brito, C. F., C. T. Fonseca, A. M. Goes, V. Azevedo, A. J. Simpson, and S. C. Oliveira. 2000. Human IgG1 and IgG3 recognition of Schistosoma mansoni 14kDa fatty acid-binding recombinant protein. Parasite Immunol. 22:41-48. [PubMed] [Google Scholar]
  • 10.Buddle, B. M., B. J. Wards, F. E. Aldwell, D. M. Collins, and G. W. de Lisle. 2002. Influence of sensitisation to environmental mycobacteria on subsequent vaccination against bovine tuberculosis. Vaccine 20:1126-1133. [DOI] [PubMed] [Google Scholar]
  • 11.Coulson, P. S., and R. A. Wilson. 1997. Recruitment of lymphocytes to the lung through vaccination enhances the immunity of mice exposed to irradiated schistosomes. Infect. Immun. 65:42-48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Dalton, J. P., S. McGonigle, T. P. Rolph, and S. J. Andrews. 1996. Induction of protective immunity in cattle against infection with Fasciola hepatica by vaccination with cathepsin L proteinases and with hemoglobin. Infect. Immun. 64:5066-5074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Edelman, R., K. Palmer, K. G. Russ, H. P. Secrest, J. A. Becker, S. A. Bodison, J. G. Perry, A. R. Sills, A. G. Barbour, C. J. Luke, M. S. Hanson, C. K. Stover, J. E. Burlein, G. P. Bansal, E. M. Connor, and S. Koenig. 1999. Safety and immunogenicity of recombinant bacille Calmette-Guerin (rBCG) expressing Borrelia burgdorferi outer surface protein A (OspA) lipoprotein in adult volunteers: a candidate Lyme disease vaccine. Vaccine 17:904-914. [DOI] [PubMed] [Google Scholar]
  • 14.Gebara, V. C., V. L. Petricevich, I. Raw, and W. D. da Silva. 1995. Effect of saponin from Quillaja saponaria (molina) on antibody, tumour necrosis factor and interferon-gamma production. Biotechnol. Appl. Biochem. 22:31-37. [PubMed] [Google Scholar]
  • 15.Grode, L., M. Kursar, J. Fensterle, S. H. Kaufmann, and J. Hess. 2002. Cell-mediated immunity induced by recombinant Mycobacterium bovis bacille Calmette-Guerin strains against an intracellular bacterial pathogen: importance of antigen secretion or membrane-targeted antigen display as lipoprotein for vaccine efficacy. J. Immunol. 168:1869-1876. [DOI] [PubMed] [Google Scholar]
  • 16.Hanson, M. S., C. V. Lapcevich, and S. L. Haun. 1995. Progress on development of the live BCG recombinant vaccine vehicle for combined vaccine delivery. Ann. N. Y. Acad. Sci. 754:214-221. [DOI] [PubMed] [Google Scholar]
  • 17.Himmelrich, H., R. Lo-Man, N. Winter, P. Guermonprez, C. Sedlik, M. Rojas, D. Monnaie, M. Gheorghiu, M. Lagranderie, M. Hofnung, B. Gicquel, J. M. Clement, and C. Leclerc. 2000. Immune responses induced by recombinant BCG strains according to level of production of a foreign antigen: malE. Vaccine 18:2636-2647. [DOI] [PubMed] [Google Scholar]
  • 18.Kremer, L., L. Dupre, G. Riveau, A. Capron, and C. Locht. 1998. Systemic and mucosal immune responses after intranasal administration of recombinant Mycobacterium bovis bacillus Calmette-Guerin expressing glutathione S-transferase from Schistosoma haematobium. Infect. Immun. 66:5669-5676. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kremer, L., G. Riveau, A. Baulard, A. Capron, and C. Locht. 1996. Neutralizing antibody responses elicited in mice immunized with recombinant bacillus Calmette-Guerin producing the Schistosoma mansoni glutathione S-transferase. J. Immunol. 156:4309-4317. [PubMed] [Google Scholar]
  • 20.Lagranderie, M., R. Lo-Man, E. Deriaud, B. Gicquel, M. Gheorghiu, and C. Leclerc. 1997. Genetic control of antibody responses induced by recombinant Mycobacterium bovis BCG expressing a foreign antigen. Infect. Immun. 65:3057-3064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Le Dantec, C., N. Winter, B. Gicquel, V. Vincent, and M. Picardeau. 2001. Genomic sequence and transcriptional analysis of a 23-kilobase mycobacterial linear plasmid: evidence for horizontal transfer and identification of plasmid maintenance systems. J. Bacteriol. 183:2157-2164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Lim, E. M., J. Rauzier, J. Timm, G. Torrea, A. Murray, B. Gicquel, and D. Portnoi. 1995. Identification of Mycobacterium tuberculosis DNA sequences encoding exported proteins by using phoA gene fusions. J. Bacteriol. 177:59-65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Moser, D., M. Tendler, G. Griffiths, and M. Q. Klinkert. 1991. A 14-kDa Schistosoma mansoni polypeptide is homologous to a gene family of fatty acid binding proteins. J. Biol. Chem. 266:8447-8454. [PubMed] [Google Scholar]
  • 24.Nascimento, I. P., W. O. Dias, R. P. Mazzantini, E. N. Miyaji, M. Gamberini, W. Quintilio, V. C. Gebara, D. F. Cardoso, P. L. Ho, I. Raw, N. Winter, B. Gicquel, R. Rappuoli, and L. C. Leite. 2000. Recombinant Mycobacterium bovis BCG expressing pertussis toxin subunit S1 induces protection against an intracerebral challenge with live Bordetella pertussis in mice. Infect. Immun. 68:4877-4883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ohara, N., and T. Yamada. 2001. Recombinant BCG vaccines. Vaccine 19:4089-4098. [DOI] [PubMed] [Google Scholar]
  • 25a.Parish, T., and N. G. Stoker. 1995. Electroporation of mycobacteria. Methods Mol. Biol. 47:237-252. [DOI] [PubMed] [Google Scholar]
  • 26.Ramos, C. R., M. M. Vilar, A. L. Nascimento, P. L. Ho, N. Thaumaturgo, R. Edelenyi, M. Almeida, W. O. Dias, C. M. Diogo, and M. Tendler. 2001. r-Sm14—pRSETA efficacy in experimental animals. Mem. Inst. Oswaldo Cruz 96(Suppl. 1):131-135. [DOI] [PubMed] [Google Scholar]
  • 27.Richter, D., R. N. Incani, and D. A. Harn. 1993. Isotype responses to candidate vaccine antigens in protective sera obtained from mice vaccinated with irradiated cercariae of Schistosoma mansoni. Infect. Immun. 61:3003-3011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Stich, R. W., L. K. Shoda, M. Dreewes, B. Adler, T. W. Jungi, and W. C. Brown. 1998. Stimulation of nitric oxide production in macrophages by Babesia bovis. Infect. Immun. 66:4130-4136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Stover, C. K., G. P. Bansal, M. S. Hanson, J. E. Burlein, S. R. Palaszynski, J. F. Young, S. Koenig, D. B. Young, A. Sadziene, and A. G. Barbour. 1993. Protective immunity elicited by recombinant bacille Calmette-Guerin (BCG) expressing outer surface protein A (OspA) lipoprotein: a candidate Lyme disease vaccine. J. Exp. Med. 178:197-209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Tendler, M., C. A. Brito, M. M. Vilar, N. Serra-Freire, C. M. Diogo, M. S. Almeida, A. C. Delbem, J. F. Da Silva, W. Savino, R. C. Garratt, N. Katz, and A. S. Simpson. 1996. A Schistosoma mansoni fatty acid-binding protein, Sm14, is the potential basis of a dual-purpose anti-helminth vaccine. Proc. Natl. Acad. Sci. USA 93:269-273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Tendler, M., M. M. Vilar, C. A. Brito, N. M. Freire, N. Katz, and A. Simpson. 1995. Vaccination against schistosomiasis and fascioliasis with the new recombinant antigen Sm14: potential basis of a multi-valent anti-helminth vaccine? Mem. Inst. Oswaldo Cruz 90:255-256. [DOI] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES