Crystallization and preliminary X-ray diffraction analysis of Xaa-Pro dipeptidase from Xanthomonas campestris

The expression, purification and crystallization of Xaa-Pro dipeptidase from X. campestris (GenBank accession No. NP_637763) and its preliminary X-ray diffraction analysis to 1.83 Å resolution are reported.

Abstract

Xaa-Pro dipeptidase (XPD; prolidase; EC 3.4.13.9) specifically hydrolyzes dipeptides with a prolyl residue at the carboxy-terminus. Xanthomonas spp. possess two different isoforms of XPD (48 and 43 kDa) which share ∼24% sequence identity. The XPD of 43 kDa in size (XPD43) from Xanthomonas spp. is unusual as it lacks the strictly conserved tyrosine residue (equivalent to Tyr387 in Escherichia coli aminopeptidase P) that is suggested to be important in the proton-shuttle transfer required for catalysis in the M24B (MEROPS) family. Here, the crystallization and preliminary X-ray analysis of XPD43 from X. campestris (GenBank accession No. NP_637763) are reported. Recombinant XPD43 was crystallized using the microbatch-under-oil technique. Diffraction data were collected on the recently commissioned protein crystallography beamline (PX-BL21) at the Indian synchrotron (Indus-2, 2.5 GeV) to 1.83 Å resolution with 100% completeness. The crystal belonged to space group P2₁2₁2₁, with unit-cell parameters a = 84.32, b = 105.51, c = 111.35 Å. Two monomers are expected to be present in the asymmetric unit of the crystal, corresponding to a solvent content of 58%. Structural analysis of XPD43 will provide new insights into the role of the conserved residues in catalysis in the M24B family.

1. Introduction  

Xaa-Pro dipeptidase (XPD; EC 3.4.13.9) specifically cleaves a trans Xaa-Pro peptide bond in a dipeptide with a prolyl residue at the carboxy-terminus (MEROPS database; Rawlings et al., 2014 ▶). The enzyme is also referred to as proline dipeptidase, prolidase or peptidase-Q (PepQ). XPD belongs to the M24B family of metallo­enzymes, which also includes aminopeptidase P, which is capable of hydrolyzing a trans Xaa-Pro peptide bond at the N-terminus of a polypeptide. XPD is ubiquitous in nature and has been isolated from mammals, bacteria and archaea (Theriot et al., 2009 ▶). In archaea and bacteria, although the function of XPD has not been well elucidated, it has been suggested to be involved in the recycling of proline (Ghosh et al., 1998 ▶). On the other hand, in humans the role of XPD in different pathophysiological conditions has been well established. For instance, the enzyme has been shown to be involved in the final stages of the degradation of dietary as well as endogenous proteins, particularly collagen. Moreover, mutations in the XPD gene in humans causes a rare autosomal recessive disorder, prolidase deficiency (PD), which exhibits phenotypes such as skin ulceration, mental retardation and recurrent infections (Endo et al., 1982 ▶; Forlino et al., 2002 ▶). The enzyme is also important commercially in the food and dairy industries for improving the flavour and texture of food (Theriot et al., 2009 ▶). For example, during cheese ripening the action of this enzyme on proline dipeptides leads to a reduction in the bitterness of the product. In addition to the peptidase activity, XPD and the other peptidases of the M24B family display fortuitous activity against toxic organophosphorus (OP) compounds, which include pesticides and nerve agents, by cleaving P—F and P—O bonds (Cheng et al., 1993 ▶). Thus, it has huge potential applications in detoxifying OP nerve agents and in biosensors for the detection of OP compounds.

Genome analysis of X. campestris showed the presence of three different genes encoding peptidases of the M24B family; two of them are annotated as XPD, while the third is annotated as aminopeptidase P. The sizes of the polypeptides encoded by the two XPD genes are 441 (48.25 kDa; XPD48; GenBank accession No. NP_638603) and 399 (42.80 kDa; XPD43; GenBank accession No. NP_637763) residues, and the proteins share ∼24% sequence identity. It was further shown that individual orthologues of all three genes are also present in other Xanthomonas spp. as well as in some families of gammaproteobacteria, which include many pathogenic bacteria. In the case of XPD48 orthologues, detailed structural and functional studies have only been reported for the enzyme from the gammaproteobacterium Alteromonas sp. strain JD6.5 (PDB entry 3l24; Vyas et al., 2010 ▶), while the orthologues from Escherichia coli and X. maltophilia have also been functionally characterized (Park et al., 2004 ▶; Suga et al., 1995 ▶). Structural and functional characterization of XPD43 orthologues has only been reported for the enzymes from the archaea Pyrococcus furiosus and P. horikoshii (PDB entries 1pv9 and 2how; Maher et al., 2004 ▶; Jeyakanthan et al., 2009 ▶). Although the structures of XPD43 orthologues from the eubacteria Mycobacterium ulcerans, Bacillus anthracis and Thermotoga maritima (PDB entries 4ege, 3q6d and 2zsg) have been deposited in the PDB by structural genomics consortia, none of these enzymes have been functionally characterized so far. Moreover, detailed information on both the structural and functional aspects of XPD43 proteins from the entire proteobacteria phylum is lacking. The closest sequence homologues of the XPD48 and XPD43 proteins of X. campestris in the PDB are the XPDs from Alteromonas sp. strain JD6.5 (PDB entry 3l24; 47% identity) and Thermococcus sibiricus (PDB entry 4fkc; 29% identity; Trofimov et al., 2012 ▶), respectively.

A bioinformatics analysis showed that XPD43 from Xanthomonas spp. is quite unique among the M24B family of peptidases owing to a change of the strictly conserved glycine and tyrosine (Gly385 and Tyr387; numbering according to E. coli aminopeptidase P) to methionine and valine, respectively (Fig. 1 ▶). In aminopeptidase P from E. coli Tyr387 has been proposed to be involved in the conserved hydrogen-bond network in the Asp260–Arg404–Tyr387 motif, which is able to shuttle a proton from the bulk solvent to the leaving peptide (Jao et al., 2006 ▶). Moreover, it was also suggested that Tyr387, Arg404 and His350 are important residues for proline specificity (Wilce et al., 1998 ▶; Graham et al., 2006 ▶). Site-directed mutagenesis of Tyr387 and Arg404 resulted in a severalfold reduction in the activity of aminopeptidase P from E. coli (Jao et al., 2006 ▶). From this viewpioint, structural and functional characterization of XPD43 from X. campestris is necessary. Structural analysis of XPD43 will provide new insights into the role of the conserved residues in catalysis. Further structure–function analysis may shed light on the significance of the two isoforms of XPD in Xanthomonas spp. and other members of the gammaproteobacteria.

Figure 1.

Multiple sequence alignment of peptidases from the M24B (MEROPS) family (only relevant blocks of sequence are shown). UniProt accession numbers are given. The conserved residues important in the hydrogen-bonding network and in proline specificity are marked in boxes. The substitutions in XPD43 (UniProt accession No. Q8P839) are marked by arrows. The numbering at the top is for E. coli aminopeptidase P (UniProt accession No. P15034)

2. Materials and methods  

2.1. Macromolecule production  

The coding DNA sequence (CDS) region of the gene encoding the XPD43 protein (GenBank accession No. NP_637763) was from the genomic DNA of X. campestris ATCC 33913 (NCBI taxonomy ID 190485). This CDS region was PCR-amplified by thermostable Pfu DNA polymerase and was cloned into a T7-promoter-based expression plasmid (Tan et al., 2005 ▶) to form an in-frame translational fusion protein with a Strep-tag II–hexahistidine–Tobacco etch virus protease site (STRHISTEV) tag (Table 1 ▶). The construct was verified by restriction-digestion analysis and DNA sequencing using T7 and T7-terminator oligos. The clone expressing the gene was grown in 3 l 2×TY broth at 310 K to an OD₆₀₀ of ∼0.4; the culture was then shifted to a lower temperature (291 K) for further growth. Subsequently, it was induced at an OD₆₀₀ of ∼0.8 for 18 h by the addition of 0.2 mM isopropyl β-d-1-thiogalactopyranoside (IPTG). The culture was harvested at 7000 rev min⁻¹ (Sorvall GSA rotor) at ambient temperature. The cell pellet was suspended in P300 buffer (50 mM sodium phosphate pH 7.0, 300 mM NaCl) and the desired protein was purified from the soluble fraction of the cell lysate using Ni metal-ion affinity and gel-filtration chromatography techniques. Typically, the soluble lysate containing the desired protein (STRHISTEV-XPD43) was incubated with 3 ml pre-equilibrated (P300 containing 20 mM imidazole) Ni Sepharose resin (GE Healthcare) and the bound protein was eluted with P300 buffer containing 500 mM imidazole by the batch method at 277 K. The eluted protein STRHISTEV-XPD43 was subsequently subjected to digestion by Tobacco etch virus protease (TEV; 1:50 molar ratio) at 293 K for 24 h while dialyzing against T200 buffer (20 mM Tris–HCl pH 8.0, 200 mM NaCl). The desired protein (XPD43) was separated from the STRHISTEV peptide and undigested protein (STRHISTEV-XPD43) using a 5 ml HisTrap column on an ÄKTA system (GE Healthcare) at room temperature. The protein was concentrated to ∼15 mg ml⁻¹ using a 10 kDa cutoff ultrafiltration unit (Sartorius). Glycerol was added to 20%(v/v) to the protein solution, which was then stored at 203 K until further use.

Table 1. Macromolecule-production information.

Source organism	X. campestris
DNA source	Genomic DNA
Forward primer†	CGTGGATCCAGCACGCAGATCGGCGGGATG
Reverse primer‡	CGTAAGCTTATGCAAACGGTTGATCGATCGCCAC
Cloning vector	None
Expression vector	pST50Tr
Expression host	E. coli BL21(DE3)pLysS
Complete amino-acid sequence of the construct produced	MASWSHPQFEKGSSHHHHHHSSGSGGGGGENLYFQGSSTQIGGMSLDQARTQLAPWTQRAAPIGADEYQQRIERARVLMRAQGVDALLIGAGTSLRYFSGVPWGASERLVALLLTTEGDPVLICPAFEEGSLDAVLQLPVRKRLWEEHEDPYALVVQAMDEQHAHALALDPGIAFAVHTGLRAHLGTAIRDAGAIIDGCRMCKSPAELALMQQACDMTLLVQRLAAGIAHEGIGTDQLVRFIDEAHRALGADNGSTFCIVQFGHATAFPHGIPGVQHLRAGELVLIDTGCTVQGYHSDITRTWIYGTPSDAQQRIWELELAAQAAAFAAVRPGVACEAVDQAARAVLQAAGLGPDYRLPGLPHRTGHGCGLAIHEAPYLVRGNRQPLQPGMCASNEPMIVVPGAFGVRLEDHFYVTDTGAQWFTPPSVAIDQPFA

^†The BamHI site is underlined.

^‡The HindIII site is underlined.

2.2. Crystallization  

For crystallization, the required amount of XPD43 protein was retrieved from the freezer at 203 K and subjected to size-exclusion column chromatography. A Superdex 200 10/300 GL (GE Healthcare) column was used with T200 buffer to remove impurities and heterogeneity and also for buffer equilibration (Fig. 2 ▶). The eluted protein was concentrated to ∼12 mg ml⁻¹ and was used for setting up crystallization at 294 K employing the microbatch-under-oil method (Chayen et al., 1992 ▶). Typically, 2 µl protein solution was mixed with 2 µl crystallization solution in a 96-well U-bottom plate and was overlaid with 50 µl Al’s oil (Hampton Research). Initial crystallization screening was performed using the Index (Hampton Research) and JCSG-plus (Molecular Dimensions) crystal screens. Crystal hits were observed in several conditions of the JCSG-plus and Index screens, but all of them were restricted to pH ≤ 5. One of the crystallization conditions was subsequently optimized to produce crystals suitable for diffraction studies (Table 2 ▶).

Figure 2.

Size-exclusion chromatography profile of purified XPD43 (marked by an arrow) on pre-calibrated Superdex 200 using an ÄKTA system (GE Healthcare) with 20 mM Tris–HCl pH 8.0, 200 mM NaCl. Inset, a 15% SDS–PAGE showing molecular-mass markers (lane 1; labelled in kDa) and purified XPD43 (lane 2).

Table 2. Crystallization.

Method	Microbatch-under-oil
Plate type	96-well U-bottom plate
Temperature (K)	293
Protein concentration (mg ml−1)	∼12
Buffer composition of protein solution	20 mM Tris–HCl pH 8.0, 200 mM NaCl
Composition of reservoir solution	40 mM KH2PO4, 15% glycerol, 12%(w/v) polyethylene glycol (PEG) 8000
Volume and ratio of drop	4 µl (1:1)
Volume of reservoir	0 (microbatch)

2.3. Data collection and processing  

The crystals were directly cooled in liquid nitrogen without any additional cryoprotectant. Single-crystal diffraction experiments were carried out on the protein crystals on the recently commissioned bending-magnet protein crystallography beamline (PX-BL21) at the 2.5 GeV Indus-2 synchrotron (India). Diffraction images were collected from a cryocooled crystal (100 K) with an oscillation of 1° at a wavelength of 0.97947 Å using a MAR225 CCD (Rayonix) detector. The data were collected to 1.83 Å resolution with a completeness of 100%. The data were indexed and integrated using XDS (Kabsch, 2010 ▶) and subsequently scaled using AIMLESS (CCP4; Winn et al., 2011 ▶). The data statistics are summarized in Table 3 ▶.

Table 3. Data-collection and processing statistics.

Values in parentheses are for the outer shell.

Diffraction source	PX-BL21, Indus-2, India
Wavelength (Å)	0.97947
Temperature (K)	100
Detector	MAR225 CCD
Resolution (Å)	48–1.83 (1.86–1.83)
Space group	P212121
Unit-cell parameters (Å, °)	a = 84.32, b = 105.51, c = 111.35, α = β = γ = 90
Total No. of reflections	617282 (19163)
No. of unique reflections	88109 (4412)
Multiplicity	7.0 (4.3)
〈I/σ(I)〉	18.2 (2.1)
Completeness (%)	99.9 (98.8)
R meas †	8 (72)
Overall B factor from Wilson plot (Å2)	16

^† R _meas = .

3. Results and discussion  

The typical yield of recombinant XPD43 was found to be ∼90 mg from 3 l bacterial culture. The purified protein showed a single symmetrical peak at a molecular weight corresponding to ∼70 kDa on size-exclusion chromatography (Fig. 2 ▶), while the expected monomeric mass of the molecule deduced from the sequence is 42.8 kDa. This suggests that XPD43 exists as a dimer under the given conditions. The protein peak eluted somewhat later than the expected elution time, possibly owing to a more compact and globular nature of the dimer or owing to weak interaction of the protein with the Superdex 200 column. The recombinant protein was active and showed peptidase activity on several Xaa-Pro dipeptides (unpublished results). The initial crystallization screening produced crystal hits in more than ten different crystallization conditions containing different salts and precipitants at pH ≤ 5.5. However, the best diffraction-quality crystals were grown from the crystallization condition 40 mM KH₂PO₄, 15% glycerol, 12%(w/v) polyethylene glycol (PEG) 8000. These crystals were rod-shaped and typically grew to dimensions of about 0.1 × 0.1 × 0.5 mm in 45 d (Fig. 3 ▶, inset). One of the crystals diffracted to 1.83 Å resolution (Fig. 3 ▶) on the recently installed PX-BL21 beamline at the Indus-2 synchrotron. It belonged to space group P2₁2₁2₁, with unit-cell parameters a = 84.32, b = 105.51, c = 111.35 Å (Table 3 ▶). The Matthews coefficient (V _M; Matthews, 1968 ▶) was calculated to be 2.9 ų Da⁻¹, with a corresponding solvent content of 58%. Two monomers were expected to be present in the asymmetric unit of the cell. A model based on the monomer of PDB entry 4fkc was used for molecular replacement using Phaser (McCoy et al., 2007 ▶) in the CCP4 suite (Winn et al., 2011 ▶). A convincing molecular-replacement solution with a final log-likelihood gain (LLG) score of 191 and with two monomers in the asymmetric unit was obtained. Initial structure refinement carried out using PHENIX (Adams et al., 2010 ▶) resulted in a model with an R _work and R _free of 26 and 30%, respectively. Further model building and structure refinement are in progress. Detailed structural analysis of XPD43 will provide new insights into the role of the conserved residues in catalysis in the M24B family of peptidases.

Figure 3.

Diffraction pattern recorded on PX-BL21 at Indus-2 from a XPD43 crystal (inset) with an exposure time of 30 s and 1° oscillation. The crystal was grown in 45 d at 294 K from a microbatch drop made by mixing 2 µl each of crystallization solution (40 mM KH₂PO₄, 15% glycerol, 12% PEG 8000) and protein solution (12 mg ml⁻¹ XPD43 in 20 mM Tris–HCl pH 8.0, 200 mM NaCl).