Skip to main content
Brazilian Journal of Microbiology logoLink to Brazilian Journal of Microbiology
. 2014 Aug 29;45(2):509–514. doi: 10.1590/s1517-83822014000200019

Phylogenetic grouping and pathotypic comparison of urine and fecal Escherichia coli isolates from children with urinary tract infection

Masoumeh Navidinia 1, Shahin Najar Peerayeh 1,✉, Fatemeh Fallah 3, Bita Bakhshi 1, Raheleh Sadat Sajadinia 2
PMCID: PMC4166276  PMID: 25242935

Abstract

The aim of this study was to investigate the phylogenetic background and to assess hlyD (involved in the secretion of haemolysin A) and intI1 (encoding a class 1 integrase) in Escherichia coli isolates derived from urinary and fecal specimens. A total of 200 E. coli isolates was collected from patients presenting with urinary tract infection (UTI) during September 2009 to September 2010 and screened for hlyD and intI1 genes by polymerase chain reaction (PCR). Phylogenetic analysis showed that E. coli is composed of four main phylogenetic groups (A, B1, B2 and D) and that uropathogenic E. coli (UPEC) isolates mainly belong to groups B2 (54%) and D (34%) whereas group A (44%) and D (26%) are predominant among commensal E. coli isolates. In this study, hlyD was present in 26% of UPEC and 2% of commensal E. coli isolates. However, hemolytic activity was detected for 42% of UPEC and 6% of commensal E. coli isolates (p < 0.05). intI1 gene was more frequently expressed in UPEC (24%) in comparison with commensal E. coli isolates (12%). Resistance to aztreonam, co-trimoxazole and cefpodoxime were frequently found among UPEC isolates whereas commensal E. coli isolates were commonly resistant to co-trimoxazole, nalidixic acid and cefotaxime. Concluding, a considerable difference between UPEC and commensal E. coli isolates was observed regarding their phylogenetic groups, presence of class 1 integron and hlyD gene, hemolysin activity and resistance pattern. The detection of class 1 integrons and hlyD gene was higher among UPEC compared with commensal E. coli isolates. These findings may contribute for a better understanding of the factors involved in the pathogenesis of UPEC.

Keywords: Escherichia coli, urinary tract infection (UTI), phylogenetic typing groups, hlyD, intI1

Introduction

Urinary tract infections (UTIs) currently rank among the most prevalent infectious diseases worldwide, with chronic and recurrent infections being especially problematic (Blango and Mulvey, 2010; Sabate et al., 2006). The primary etiologic agents associated with UTIs are strains of uropathogenic Escherichia coli (UPEC) (Sivick and Mobley, 2010). Nonetheless, UPEC isolates express a wide spectrum of virulence and fitness factors that aid in successful colonization of the mammalian urinary tract (Manges et al., 2004). Although often categorized as extra-cellular pathogens, UPEC can in fact invade a number of host cell types, including the terminally differentiated superficial facet cells and less mature intermediate and basal epithelial cells that comprise the stratified layers of the bladder urothelium. Host cell invasion is proposed to facilitate both the establishment and persistence of UPEC within the urinary tract (Johnson et al., 2005; Mulvey et al., 2000).

Extra-intestinal pathogenic and commensal E. coli typically differ in phylogenetic group and virulence attributes. Previous studies have shown that pathogenic extraintestinal E. coli isolates primary belong to phylogenetic group B2 and, to a lesser extent, group D, whereas commensal E. coli isolates belong to groups A and B1. Moreover, pathogenic extraintestinal isolates harbour specialized virulence factors, i.e., traits that confer pathogenic potential, which are infrequent among commensal isolates (Johnson et al., 2001; Sabate et al., 2006).

Currently, about 50 different cassettes associated with resistance genes, can be found in different classes of integrons. An integron is a two component gene capture and dissemination system, first discovered due to their rapid dissemination of antibiotic resistance, which can be found in plasmids, chromosomes and transposons. The first component consists of a gene encoding a site specific recombinase along with a specific site for recombination, while the second component comprises fragments of DNA called gene cassettes which can be incorporated or shuffled. A cassette may encode genes for antibiotic resistance, although most genes in integrons are uncharacterized. Integrons act as receptors of antibiotic resistance cassettes (Kovalevskaya, 2002).

Hemolysin is a cytolytic protein toxin secreted by most hemolytic E. coli isolates. In addition of lysing erythrocytes, hemolysin is a toxin for a wide range of host cells which may result in inflammation, tissue injury, and impaired host defenses. It should be mentioned that monocytes and granulocytes are highly susceptible to hemolysin cytotoxicity, whereas lymphocytes are relatively resistant. Exposure of polymorphonuclear leukocytes (PMNLs) to hemolysin stimulates degranulation and releases of leukotrienes accompanied by ATP; causes marked morphologic alterations; and impaired chemotaxis and phagocytosis (Johnson, 1991). Hemolysin production correlates closely with the toxicity of clinical E. coli isolates for PMNLs. Hemolysin stimulates superoxide anion and hydrogen peroxide release and oxygen consumption by renal tubular cells as well as histamine release from mast cells and basophils (Johnson, 1991).

The aim of this study was to determine the phylogenetic type of uropathogenic and commensal E.coli, isolated from patients with UTI in Mofid Childrens’ Hospital, Tehran, Iran. In addition, the prevalence of hemolytic activity, and the assessment of hlyD gene (involved in hemolysin production) and of class 1 integron (a genetic element associated with antibiotic resistance) were also investigated, in order to provide additional information about E.coli virulence profiles.

Material and Methods

Specimens and patients

A total of 200 E. coli isolates were analyzed from 100 children patients of both sexes (85% female, 15% male) aged between 2–12 years with UTI (70% pyelonephritis, 30% cystitis). Of these, 100 were derived from midstream clean catch urine and 100 were from stool specimens of the patients presenting with community acquired UTI who have attended the nephrology ward of Mofid Childrens’ Hospital, Tehran, Iran, during September 2009 to September 2010. The project was approved by the local Ethics Committee for Human Researches.

Samples were derived from fresh midstream urine, cultured (0.01 mL) on MacConkey agar (Sisco Research Laboratories Pvt. Ltd., USA) as well as Sheep blood agar and incubated at 37 °C for 24 h. Urine bacteria included in this study were from cultures yielding > 10 5 CFU/mL. Cultures with < 10 5 CFU/mL were further investigated only if relevant history of fever, chills, flank pain, pyuria, antibiotic intake, structural abnormalities, diabetes mellitus or any other immunocompromised state was present.

Specimens from stool samples were cultured on Trypticase soy agar (Kanto Chemical Co., Inc., Japan) with 5% sheep blood and MacConkey agar. The predominant isolate on each plate (one colony) and all morphologically distinct colonies were identified and stored for further analysis, as described by Plos (1995) and Foxman (2002). Two-three colonies, cultured on sheep blood as well as on MacConkey agar, from each stool and urine sample, were selected for molecular examination (Moreno et al., 2006).

Antimicrobial susceptibility test

Susceptibility to nitrofurantoin (300 μg), ciprofloxacin (5 μg), nalidixic acid (30 μg), amoxicillin (10 μg), augmentin (30 μg), gentamicin (120μg), ceftazidime (30 μg), cefpodoxime (10 μg), aztreonam (30 μg), imipenem (10 μg), amikacin (30 μg), co-trimoxazole (25 μg) and cefotaxime (30 μg) were determined by disc diffusion assays (BBL Sensi-Disc, USA) modified by the Kirby-Bauer method using CLSI criteria (nonfastidious groupings M2-disk diffusion M100). For the purpose of analysis, intermediate susceptibility was considered as susceptible (Schlager et al., 2002)

DNA extraction

DNA was extracted using the protocol described previously (Sabarinath et al., 2011). The isolates were cultured on MacConkey agar plates for 24 h. One to two colonies were resuspended in 0.5 mL sterile distilled water. The cells were lysed by heating at 95 °C for 10 min and the supernatant was harvested by centrifugation at 12,000 rpm (8000 g) for 5 min. The supernatant was used as the source of the template DNA.

PCR amplification

Briefly, this consists of a 300 nM concentration of each oligonucleotide primer (BIO NEER, Takapouzist.co, AccuOligoR, web: http://www.bioneer.com); 5.5 mM MgCl2; 200 mM (each) deoxynucleoside triphosphates dATP, dCTP, dGTP, and dUTP; and 0.125 U of Taq DNA polymerase (GENET BIO, Prime Taq TM DNA polymerase, type:G-1002, URL:www.genetbio.com).

Phylogenetic typing group

Phylogenetic grouping of the E. coli isolates was determined by a simple, rapid PCR-based technique (Clermont et al., 2000) that uses a combination of three DNA markers (chuA, yjaA and DNA fragment tspE4.C2), generating 279, 211 and 152-bp fragments, respectively. A triplex PCR was performed using the six primers in a single reaction. The results of these three amplifications allowed the classification of E. coli isolates into one of the major phylogenetic groups: A, B1, B2 or D. E. coli strain RS218, which belongs to phylogenetic group B2, was used as a control (Dhakal et al., 2008).

Hemolytic activity and hlyD gene detection

E. coli isolates were inoculated on 5% sheep blood agar plates and incubated overnight at 37 °C. The plates were then examined for the presence of a partial or total hemolytic activity (alpha or beta) (Forbes et al., 2007).

PCR was performed using the hlyD gene (904 bp) primers: F CTCCGGTACGTGAAAAGGAC: (Tm = 55.4 °C), R GCCCTGATTACTGAAGCCTG: (Tm = 55.7 °C) in a single reaction (Rodriguez-Siek et al., 2005).

Class 1 integron detection

Isolates were analyzed by polymerase chain reaction (PCR) amplification techniques to determine whether a class 1 integron was present. Integrons were detected by PCR amplification of a class 1 integrase-specific fragment of the intI1 gene. The primer sequences used were intI1-(F: GGTCAAGGATCTGGATTTGG, R: ACATGCGTGTAAATCATCGTC) in a single reaction. PCR assay was performed for cycles as follows: 1 cycle of 12 min at 94 °C; 35 cycles of 1 min at 94 °C, 1 min at 57 °C, 2 min at 72 °C; 1 cycle of 10 min at 72 °C (Lim et al., 2009).

Statistical analysis

Statistical analysis was performed by using the Fisher exact and chi-square tests. The threshold for statistical significance was a p value of < 0.05.

Results

Pattern of antimicrobial resistance among Escherichia coli isolates

High-level resistance to azteronam (78%), co-trimoxazole (61%), cefpodoxime (48%) were found among UPEC while commensal E.coli isolates showed increased resistance to co-trimoxazole (82%), nalidixic acid (27%) and cefotaxime (27%). Resistance pattern of UPEC and commensal E. coli isolates were presented in Tables 1 and 2.

Table 1.

Antibiotic resistance pattern among phylogenetic groups in Uropathogenic E.coli isolates from children with community acquired UTI.

Antibiotic A B1 B2 D Total
Augmentin - - 12% 2% 14%
Cefotaxime 3% 2% 39% 1% 45%
Co-trimoxazole - 1% 50% 10% 61%
Imipenem - - - - 0%
Nitrofurantoin - - 2% - 2%
Amoxicillin - - 16% - 16%
Gentamicin 2% - 19% 1% 22%
Ciprofloxacin - - 7% 1% 8%
Amikacin 1% 1% 5% 1% 8%
Ceftazidime - - 12% - 12%
Cefpodoxime 2% 6% 38% 2% 48%
Nalidixic acid - - 9% - 9%
Azteronam 1% - 48% 29% 78%

Table 2.

Antibiotic resistance pattern among phylogenetic groups in commensal E.coli isolates from children with community acquired UTI.

Antibiotic A B1 B2 D Total
Augmentin - - 7% 2% 9%
Cefotaxime 2% - 16% 9% 27%
Co-trimoxazole 29% 14% 16% 23% 82%
Imipenem - - - - 0%
Nitrofurantoin - - 6% 2% 8%
Amoxicillin 9% 1% 8% 2% 20%
Gentamicin - - 1% 11% 12%
Ciprofloxacin 1% - 1% 3% 5%
Amikacin - - 3% - 3%
Ceftazidime - - 3% 4% 7%
Cefpodoxime 2% 1% 15% 1% 19%
Nalidixic acid - 2% 16% 9% 27%
Azteronam 1% 1% 11% 6% 19%

Multi-drug resistance which was defined as resistance to 3 or more classes or sub-classes of antibiotics (Canton and Ruiz-Garbajosa, 2011), was most commonly observed in UPEC (38%) compared with commensal E. coli isolates (22%).

Phylogenetic typing groups

Phylogenetic groups A and D were commonly found among commensal E. coli isolates. However, UPEC isolates belonged to phylogenetic groups B2 and D, predominantly (Table 3). The results presented on Table 3 highlight a preliminary connection between pyelonephritis and phylogenetic group B2 (p < 0.001).

Table 3.

Phylogenetic groups distribution of UPEC and fecal E.coli strains in patients with UTI.

Phylogenetic groups Number of isolates Cystitis Pyelonephritis
A
Commensal 44% 20% 24%
UPEC 8% 6% 2%
B1
Commensal 14% 4% 10%
UPEC 4% 4% 0%
B2
Commensal 16% 0% 16%
UPEC 54% 4% 50%
D
Commensal 26% 6% 20%
UPEC 34% 16% 18%

Distribution of hemolytic activity and hlyD in UPEC and commensal E. coli isolate

hlyD was detected in 26% of UPEC and 2% of commensal E. coli isolates, however, hemolytic activity was observed for 42% of UPEC and 6% of commensal E. coli isolates (p < 0. 05).

Distribution of intI1 in UPEC and commensal E. coli isolates

intI1 gene, which was significantly associated with pyelonephritis (22%) rather than cystitis (14%) (p < 0.05), was more frequently expressed in UPEC (24%) in comparison with commensal E. coli isolates (12%).

Discussion

UTI is usually treated empirically without culture but it contributes for about 10–15% prolongation of hospitalization due to the emergence of antimicrobial resistance among the causative bacteria, particularly UPEC isolates (Walter and Stamm, 2001). This may result in the spread of antibiotic resistant bacteria in the hospital and therefore, it has been suggested that more powerful antibiotics might better eliminate UPEC reservoirs and consequently reduce the incidence of chronic and recurrent UTIs among hospitalized and outpatients (Kaper et al., 2004; Rodriguez-Siek et al., 2005)

High incidence of co-trimoxazole resistance (61% for UPECs and 82% for commensal E. coli isolates) and of susceptibility to imipenem(100% for both UPEC and commensal E. coli isolates) were detected. These data are in agreement with the results of Farshad et al. (2008) for E. coli isolates obtained from children with community-acquired UTI. Thus, co-trimoxazole, which is a widely used for UTI treatment, has become nearly ineffective to treat UTI in this country.

In our study, different antibiotic resistance patterns were observed in UPEC compared with commensal isolates. Contrarily to the results of Alhaj et al. (2007), lower resistance percentages to nalidixic acid (9%), amoxicillin (16%) and gentamicin (22%) was found among UPEC compared with commensal E.coli isolates. Nevertheless, resistance rates to ceftazidime (12%) and augmentin (14%) among UPEC isolates were in agreement with the studies of Lim et al. (2009) with 47 nonrepeat E. coli isolates, collected from intensive care unit patients presented with UTI, in 5 public hospitals located in different areas of Malaysi. Consistent with Adegoke et al. (2011), our findings revealed that cefpodoxime and cefotaxime were less effective in UTI treatment than imipenem, nalidixic acid, ciprofloxacin, nitrofurantoin, augmentin and amikacin for all UPEC phylogenetic groups.

In a research by Moreno et al. (2006), E. coli isolates obtained from 150 patients presenting with acute uncomplicated cystitis, acute pyelonephritis and urinary-source bacteraemia, revealed 21% and 18% resistance to quinolones and fluoroquinolones, respectively. Recently, Shigemura et al. (2008) has reported the emergence of fluoroquinolone resistant E. coli responsible for UTI among patients attended at Kobe University Hospital, Japan. In those studies a higher resistance to quinolones (27%) than to fluoroquinolones (5%) was observed among commensal E. coli isolates. However, they found that resistance to the two mentioned antibiotic classes was nearly the same among UPEC (9% and 8% respectively).

It should be considered that, in our study, resistance to amikacin in UPEC (8%) and commensal E. coli isolates (3%) was relatively lower, considering the 27% reported in a research conducted in Colombia by Villegas et al. (2004) on E. coli isolates obtained from hospitalized patients, in a study covering 62.3% of all general hospital beds in that country.

As previously noted, class 1 integrons were more prevalent than those of class 2 (Johnson et al., 1998; Muhammad et al., 2011; Patti et al., 2008). Similar to a research by Colgan et al. (2011), in our study intI1 gene was more frequently detected among UPEC than commensal E. coli isolates, which may contribute for the occurrence and transmission of MDR among UPEC isolates. Our results also showed that group B2 is the most frequent E. coli phylogroup in UTI, as previously found (Johnson and Russo, 2002; Kovalevskaya, 2002; Mokady et al., 2005). The UPEC isolates found in this study primarily belonged to one of two virulence groups (group B2 or D). Although a higher percentage of commensal isolates clustered into group A, a considerable proportion belonged to group D and this is why a large proportion of commensal isolates were found to represent a potential human health threat, as well as the UPEC isolates (Burman et al., 2003; Moulin-Schouleur et al., 2006).

Thus, our data indicate that group B2 E. coli isolates are uncommon among commensal intestinal flora (16%); however, when present, they are highly virulent (Burman et al., 2003; Moulin-Schouleur et al., 2006). In this study, only 42% of UPEC isolates had hemolytic activity, 26% of which carried hlyD gene. The relatively low percentage of hlyD gene carriage rate, in the 100 UPEC isolates analyzed here, may be partially due to the relatively low percentage of B2 isolates (54%) detected in this study. Because B2 commensal E. coli isolates seem to have a privileged role in eliciting urinary tract infection, the intestinal normal flora would potentially act as a reservoir for developing UTI (Branger et al., 2005). However, our findings challenge the “fecal urethral” pathway for the pathogenesis of UTI in children and instead support alternative routes of infection in this population (Johnson et al., 2001a; Johnson et al., 2001b).

Many studies have shown that urine isolates collectively differed dramatically from normal flora isolates with respect to phylogenetic background and virulence gene content profiles, suggesting an increased virulence potential for the urine isolates (Clermont et al., 2000; Terai et al., 2000; Vishalakshi, 2011). In fact, in our work, a considerable difference between UPEC and commensal E. coli isolates was observed regarding their phylogenetic groups, presence of class 1 integron, carriage of hly D gene, hemolysin activity and resistance pattern.

Thus, we can conclude that some UPEC with different phylogenetic characteristics and virulence profiles are multiple drug resistant (MDR) isolates which make them a serious, challenging health problem. However it is reasonable to suppose that UPEC and commensal E. coli isolates might have similar fitness properties for adapting to an extraintestinal lifestyle, which, in turns, enable commensal E. coli to cause extraintestinal disease in humans as well as UPEC. As previously mentioned, commensal E. coli may potentially serves as a source or reservoir of virulence genes for human pathogenesis. Further research will be necessary to determine if commensal E. coli isolates can actually overcome the hurdles necessary for human transmission through the urethral route.

Acknowledgments

This work was supported by grants from Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran

Footnotes

Conflict of interest

Authors have no conflict of interest.

References

  1. Adegoke Anthony A, Okoh Anthony I. Prevalence, antibiotic susceptibility profile and extended spectrum β-lactamase production among Escherichia coli from high vaginal swab (HVS) Afr J Pharm Pharacol. 2011;5:1287–1291. [Google Scholar]
  2. Alhaj N, Mariana NS, Raha A, Ishak Z. Prevalence of antibiotic resistance among Escherichia coli from different sources in Malaysia. Res J Pharmacolo. 2007;1:44–49. [Google Scholar]
  3. Blango MG, Mulvey MA. Persistence of uropathogenic Escherichia coli in the face of multiple antibiotics. Antimicrob Age Chemother. 2010;54:1855–1863. doi: 10.1128/AAC.00014-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Branger C, Zamfir O, Geoffroy S, Laurans G, Arlet G, Thien HV, Gouriou S, Picard B, Denamur E. Genetic background of Escherichia coli and extended-spectrum beta-lactamase type. Emerg Infect Dis. 2005;11:54–61. doi: 10.3201/eid1101.040257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Burman WJ, Breese PE, Murray BE, Singh KY, Batal HA, Mackenzie TD, Ogle JW, Wilson ML, Reves RR, Mehler PS. Conventional and molecular epidemiology of trimethoprim-sulfamethoxazole resistance among urinary Escherichia coli isolates. Am J Med. 2003;115:358–364. doi: 10.1016/s0002-9343(03)00372-3. [DOI] [PubMed] [Google Scholar]
  6. Cantón R, Ruiz-Garbajosa P. Co-resistance: an opportunity for the bacteria and resistance genes. Curr Opin Pharmacol. 2011;11:477–485. doi: 10.1016/j.coph.2011.07.007. [DOI] [PubMed] [Google Scholar]
  7. Clermont O, Bonacorsi S, Bingen E. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl Environ Microbiol. 2000;66:4555–4558. doi: 10.1128/aem.66.10.4555-4558.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Colgan R, Williams M, Johnson JR. Diagnosis and treatment of acute pyelonephritis in women. Am Fam Physician. 2011;84:519–526. [PubMed] [Google Scholar]
  9. Dhakal BK, Kulesus RR, Mulvey MA. Mechanisms and consequences of bladder cell invasion by uropathogenic Escherichia coli. Eur J Clin Invest. 2008;38:2–11. doi: 10.1111/j.1365-2362.2008.01986.x. [DOI] [PubMed] [Google Scholar]
  10. Farshad SH, Japoni A, Hosseini M. Low distribution of integrons among multidrug resistant E.coli strains isolated from children with community -acquired urinary tract infections in Shiraz, Iran. Pol j microbiol. 2008;57:193–198. [PubMed] [Google Scholar]
  11. Forbes BA, Sahm DF, Weissfeld AS. Bailey & Scott’s Diagnostic Microbiology. Mosby Press; 2007. [Google Scholar]
  12. Foxman B, Manning SD, Tallman P, Bauer R, Zhang L, Koopman JS, Gillespie B, Sobel JD, Marrs KF. Uropathogenic Escherichia coli Are More Likely than commensal E. coli to be shared between heterosexual sex partners. Am J Epidemiol. 2002;156:1133–1140. doi: 10.1093/aje/kwf159. [DOI] [PubMed] [Google Scholar]
  13. Johnson DE, Lockatell CV, Russell RG, Hebel JR, Island MD, Stapleton A, Stamm WE, Warren JW. Comparison of Escherichia coli strains recovered from human cystitis and pyelonephritis infections in transurethrally challenged mice. Infect Immun. 1998;66:3059–3065. doi: 10.1128/iai.66.7.3059-3065.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Johnson JR. Virulence Factors in Escherichia coli Urinary Tract Infection. Clin Microbiol Rev. 1991;4:80–128. doi: 10.1128/cmr.4.1.80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Johnson JR, Delavari P, Kuskowski M, Stell AL. Phylogenetic distribution of extraintestinal virulence-associated traits in Escherichia coli. J Infect Dis. 2001;183:78–88. doi: 10.1086/317656. [DOI] [PubMed] [Google Scholar]
  16. Johnson JR, Stell A, Delavari P. Canine feces as a reservoir of extraintestinal pathogenic Escherichia coli. Infect Immune. 2001;69:1306–14. doi: 10.1128/IAI.69.3.1306-1314.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Johnson JR, Stell AL, Delavari P, Murray AC, Kuskowski M, Gaastra W. Phylogenetic and pathotypic similarities between Escherichia coli isolates from urinary tract infections in dogs and extraintestinal infections in humans. J Infect Dis. 2001;183:897–906. doi: 10.1086/319263. [DOI] [PubMed] [Google Scholar]
  18. Johnson JR, O’Bryan TT, Sandberg T. Phylogenetic and pathotypic comparison of concurrent urine and rectal Escherichia coli isolates from men with febrile urinary tract infection. J Clin Microbiol. 2005;43:3895–3900. doi: 10.1128/JCM.43.8.3895-3900.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Johnson JR, Russo TA. Uropathogenic Escherichia coli as agents of diverse non-urinary tract extraintestinal infections. J Infect Dis. 2002;186:859–864. doi: 10.1086/342490. [DOI] [PubMed] [Google Scholar]
  20. Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004;2:123–140. doi: 10.1038/nrmicro818. [DOI] [PubMed] [Google Scholar]
  21. Kovalevskaya NP. Mobile Gene Cassettes and Integrons. Mol Biolo. 2002;36:196–201. [Google Scholar]
  22. Lim KT, Yasin R, Yeo CC, Puthucheary S, Thong KL. Characterization of Multidrug Resistant ESBL-Producing Escherichia coli Isolates from Hospitals in Malaysia. J Biomed Biotechno. 2009;2009:165637. doi: 10.1155/2009/165637. 2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Manges AR, Dietrich PS, Riley LW. Multidrug-resistant Escherichia coli clonal groups causing community-acquired pyelonephritis. Clin Infec Dis. 2004;38:329–334. doi: 10.1086/380640. [DOI] [PubMed] [Google Scholar]
  24. Mokady D, Gophna U, Ron EZ. Extensive gene diversity in septicemic Escherichia coli strains. J Clin Microbiol. 2005;43:66–73. doi: 10.1128/JCM.43.1.66-73.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Moreno E, Prats G, Sabate M, Perez T, Johnson JR, Andreu A. Quinolone, fluoroquinolone and trimethoprim sulfamethoxazole resistance in relation to virulence determinants and phylogenetic background among uropathogenic Escherichia coli. J Antimicrob Chemother. 2006;57:204–211. doi: 10.1093/jac/dki468. [DOI] [PubMed] [Google Scholar]
  26. Moreno E, Andreu A, Perez T, Sabatem M, Johnson JR, Prats G. Relationship between Escherichia coli strains causing urinary tract infection in women and the dominant faecal flora of the same hosts. Epidemiol Infec. 2006;134:1015–1023. doi: 10.1017/S0950268806005917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Moulin-Schouleur M, Schouler C, Tailliez P, Kao MR, Bree A, Germon P, Oswald E, Mainil J, Blanco M, Blanco J. Common virulence factors and genetic relationships between O18: K1: H7 Escherichia coli isolates of human and avian origin. J Clin Microbiol. 2006;44:3484–3492. doi: 10.1128/JCM.00548-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Muhammad I, Uzma M, Yasmin B, Mehmood Q, Habib B. Prevalence of antimicrobial resistance and integrons in Escherichia Coli from Punjab, Pakistan. Braz J Microbiol. 2011;42:462–466. doi: 10.1590/S1517-83822011000200008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Mulvey MA, Schilling JD, Martinez JJ, Hultgren SJ. Bad bugs and beleaguered bladders: interplay between uropathogenic Escherichia coli and innate host defenses. Proc Nat Acad Sci USA. 2000;97:8829–8835. doi: 10.1073/pnas.97.16.8829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Patti G, Mannini A, Balistreri M, Schito AM. Virulence factors in urinary Escherichia coli strains: phylogenetic background and quinolone and fluoroquinolone resistance. J Clin Microbiol. 2008;46:480–487. doi: 10.1128/JCM.01488-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Plos K, Connel H, Jodal U. Intestinal carriage of P fimbriated Escherichia coli and the susceptibility to urinary tract infection in young children. J Infect Dis. 1995;171:625–631. doi: 10.1093/infdis/171.3.625. [DOI] [PubMed] [Google Scholar]
  32. Rodriguez-Siek KE, Giddings CW, Doetkott C, Johnson TJ, Fakhr MK, Nolan LK. Comparison of Escherichia coli isolates implicated in human urinary tract infection and avian colibacillosis. Microbiol. 2005;151:2097–2110. doi: 10.1099/mic.0.27499-0. [DOI] [PubMed] [Google Scholar]
  33. Rodriguez-Siek KE, Giddings CW, Doetkott C, Johnson TJ, Nolan LK. Characterizing the APEC pathotype. Vet Res. 2005;36:241–256. doi: 10.1051/vetres:2004057. [DOI] [PubMed] [Google Scholar]
  34. Sabarinath A, Tiwari KP, Deallie C, Belot G, Vanpee G, Matthew V, Sharma R, Hariharan H. Antimicrobial Resistance and Phylogenetic Groups of Commensal Escherichia Coli Isolates from Healthy Pigs in Grenada. Web Med Central. 2011;42:1–10. [Google Scholar]
  35. Sabate M, Moreno E, Perez T, Andreu A, Prats G. Pathogenicity island markers in commensal and uropathogenic Escherichia coli isolates. Clin Microbiol Infect. 2006;12:880–886. doi: 10.1111/j.1469-0691.2006.01461.x. [DOI] [PubMed] [Google Scholar]
  36. Schlager TA, Hendley JO, Bell AL, Whittam TS. Clonal Diversity of Escherichia coli Colonizing Stools and Urinary Tracts of Young Girls. Infect Immun. 2002;70:1225–9. doi: 10.1128/IAI.70.3.1225-1229.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Shigemura K, Arakawa S, Miura T, Nakano Y, Tanaka K, Fujisawa M. Significance of fluoroquinolone resistant Escherichia coli in urinary tract infections. Jpn J Infect Dis. 2008;61:226–228. [PubMed] [Google Scholar]
  38. Sivick KE, Mobley HLT. Waging war against uropathogenic Escherichia coli: winning back the urinary tract. Infect Immun. 2010;78:568–585. doi: 10.1128/IAI.01000-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Terai A, Ishitoya S, Mitsumori K, Ogawa O. Molecular epidemiological evidence for ascending urethral infection in acute bacterial prostatitis. J Urol. 2000;164:1945–1947. [PubMed] [Google Scholar]
  40. Villegas MV, Correa A, Perez F, Miranda MC, Zuluaga T, Quinn JP. Prevalence and characterization of extended-spectrumβ-lactamases in Klebsiella pneumoniae and Escherichia coli isolates from Colombian hospitals. Diag Microbiol Infect Dis. 2004;49:217–222. doi: 10.1016/j.diagmicrobio.2004.03.001. [DOI] [PubMed] [Google Scholar]
  41. Vishalakshi B. Detection of Virulence Markers of Uropathogenic Escherichia coli from Urinary Tract Infection. Karnataka, Banglore: Department of Microbiology Mysore Medical College and Research Institute; 2011. p. 125. [Google Scholar]
  42. Walter E, Stamm MD. An epidemic of urinary tract infections. N Eng J Med. 2001;345:1055–1057. doi: 10.1056/NEJM200110043451409. [DOI] [PubMed] [Google Scholar]

Articles from Brazilian Journal of Microbiology are provided here courtesy of Brazilian Society of Microbiology

RESOURCES