Phosphate absorption across multiple epithelia in the Pacific hagfish (Eptatretus stoutii)

Abstract

Inorganic phosphate (P_i) is an essential nutrient for all organisms, but in seawater, P_i is a limiting nutrient. This study investigated the primary mechanisms of P_i uptake in Pacific hagfish (Eptatretus stoutii) using ex vivo physiological and molecular techniques. Hagfish were observed to have the capacity to absorb P_i from the environment into at least three epithelial surfaces: the intestine, skin, and gill. P_i uptake in all tissues was concentration dependent, and saturable P_i transport was observed in the skin and gill at <2.0 mmol/l P_i. Gill and intestinal P_i uptake was sodium dependent, but P_i uptake into the skin increased under low sodium conditions. Gill P_i transport exhibited an apparent affinity constant ∼0.23–0.6 mmol/l P_i. A complete sequence of a type II sodium phosphate cotransporter (Slc34a) was obtained from the hagfish gill. Phylogenetic analysis of the hagfish Slc34a transporter indicates that it is earlier diverging than, and/or ancestral to, the other identified vertebrate Slc34a transporters (Slc34a1, Slc34a2, and Slc34a3). With the use of RT-PCR, the hagfish Slc34a transcript was detected in the intestine, skin, gill, and kidney, suggesting that this may be the transporter involved in P_i uptake into multiple epithelia in the hagfish. This is the first measurement of P_i uptake across the gill or skin of any vertebrate animal and first sodium phosphate cotransporter identified in hagfish.

inorganic phosphate (P_i) is an essential nutrient for all organisms. Functioning as a pH buffer, P_i is critical in cellular metabolism as the active part of the energy carrier ATP and is the major component of bone mineral (30, 39). To obtain P_i, specialized transport systems have evolved, allowing for efficient uptake of P_i against electrochemical gradients (46). In vertebrates, the intestine plays the primary role in the acquisition of P_i from the diet, whereas the kidney is involved in P_i reabsorption and regulation (33, 42). The most common P_i transporters present in vertebrate absorptive epithelia are in the NaPi-II family [Human Genome Organization (HUGO) nomenclature: SLC34A] (2, 22, 35, 46). These transporters preferentially import one HPO₄⁻² with three Na⁺, although some are capable of coupling P_i uptake to H⁺ import in the absence of Na⁺ (36, 46). In vertebrates, the Slc34a transporter family is subdivided into three functionally distinct members: Slc34a1 (NaPi-IIa), Slc34a2 (NaPi-IIb), and Slc34a3 (NaPi-IIc) (30, 42). All three of these Slc34a members are present in mammals, with Slc34a2 expressed in the apical membrane of the small intestine and mediating P_i absorption, whereas Slc34a1 and Slc34a3 are expressed in the kidneys and are vital for P_i reabsorption (4, 42). In contrast, only two Slc34a2 isoforms, Slc34a2a and Slc34a2b, have been identified in elasmobranchs and teleosts (35, 46), with Slc34a2a identified in the intestine and Slc34a2b in the kidney of fish (35).

Hagfish (Phylum Chordata, Class Myxini) form the most ancient group of living craniates and represent the oldest living connection to the ancestral vertebrate (3). Consequently, when studying the evolutionary development of traits in vertebrates, hagfish present an important model organism. Hagfish are also very unique from other fish species, as they have no true stomach, with both digestion and absorption suggested to occur in the intestine (17). Also, unlike other fish, the gills of Pacific hagfish are quite different structurally and occur as rows of 10–13 pairs of internal pouches that run laterally along the body (26). Hagfish draw water in through a central nostril, which distributes the water through the gill pouches via an afferent water duct, countercurrent to blood within the gill tissue (26). This efficient countercurrent exchange system provides hagfish with a favorable surface for exchange of ions, gases, and waste products between the blood and water (26). The gills are, therefore, suggested to play an important role in gas transport, ionoregulation, acid-base balance, and nitrogenous waste excretion (7, 9, 10, 40).

In nature, hagfish live on the seafloor and feed mostly on carrion, such as dead fish, sharks, and whales (38). Notably, hagfish burrow into the carrion and feast from within (27). Conditions within the decomposing carcass expose the hagfish to high concentrations of organic and inorganic nutrients, including P_i, and present an opportunity for the hagfish to absorb nutrients directly across the skin and gills. This novel mode of nutrient uptake was confirmed recently by Glover et al. (16), who demonstrated that Pacific hagfish can absorb the amino acids alanine and glycine across gill and skin epithelia. The possibility for a vertebrate animal to absorb major inorganic macronutrients, such as P_i, from the environment across the skin and/or gill has never been examined. We therefore hypothesize that hagfish may use similar uptake mechanisms for other macronutrients important for growth and development. This hypothesis was investigated using ex vivo physiological and molecular techniques to determine the primary mechanisms of P_i uptake by the Pacific hagfish and the potential transporter(s) involved.

MATERIALS AND METHODS

Animals.

Pacific hagfish (Eptatretus stoutii) were caught using baited traps from Barkley Sound (Vancouver Island, BC, Canada). Hagfish were transported by boat to Bamfield Marine Sciences Centre (BMSC) and maintained in 500-liter tarpaulin-covered outdoor tanks supplied with flow-through seawater at 9–12°C. Animals were not fed at any time following collection and were used for experimentation within 4 wk of capture. For RNA isolation, tissues were dissected, snap frozen in liquid nitrogen, and held at −80°C. The experiments were conducted during August 2011, 2012, and 2013, and all procedures were approved by the Animal Care Committees of BMSC (Animal Use Protocol Numbers RS-11-26, RS-12-10, and RS-13-24).

Solutions.

All salines were prepared without Ca²⁺ and Mg²⁺ to minimize formation of insoluble phosphate salts. The standard Ca²⁺- and Mg²⁺-free hagfish saline (HF saline) contained NaCl, 490 mmol/l; KCl, 8.0 mmol/l; NaHCO₃, 41 mmol/l; and glucose, 5.0 mmol/l; pH = 7.8. Sodium-dependent phosphate uptake was tested in each tissue by substituting sodium chloride with choline chloride and using a Na⁺-, Ca²⁺-, and Mg²⁺-free HF saline [C₅H₁₄NOCl (choline chloride), 490 mmol/l; KCl, 8.0 mmol/l; KHCO₃, 41 mmol/l; and glucose, 5.0 mmol/l; pH = 7.8]. Choline chloride has previously been demonstrated to be a good sodium substitute in flux experiments (16, 17, 36, 48). To test for an inhibitory effect of phosphonoformic acid (PFA), PFA was added to Ca²⁺- and Mg²⁺-free HF saline at a concentration of 10.0 mmol/l. PFA is a structural analog of pyrophosphate and is a known inhibitor of the NaPi-IIb transporter (SLC34A2 in HUGO nomenclature) in mammals (25). Phosphate solutions for concentration-dependent uptake experiments were made by spiking the standard saline with a 100 mmol/l NaH₂PO₄ working stock in Ca²⁺- and Mg²⁺-free HF saline. For sodium-dependent phosphate uptake experiments, a 100 mmol/l KH₂PO₄ working stock in Na⁺-, Ca²⁺-, and Mg²⁺-free HF saline was used. The following concentrations of P_i were tested for intestine and skin: 0.25, 0.5, 1.0, 2.0, 5.0, and 10.0 mmol/l. In the gills, the following concentrations were tested: 0.05, 0.1, 0.25, 0.5, 1.0, 2.0, 5.0, and 10.0 mmol/l. Osmolarity of all saline solutions was measured and equalized with mannitol (±1.0 osM/kg) before experiments using a Vapro vapor pressure osmometer (model 5520; Wescor, Logan, UT).

Intestinal P_i flux measurements.

Hagfish were killed in 5.0 g/l tricaine methanesulfonate (AquaLife; Syndel Laboratories, Nanaimo, BC, Canada), neutral buffered with 2× w/w NaHCO₃, and the entire gastrointestinal tract was dissected from the animal and flushed with hagfish saline (see Solutions above). The portion of intestinal tract between the bile duct and cloacal region was divided into eight, 2- to 4-cm sections. A pilot study suggested slightly higher mean P_i uptake in the anterior regions of the intestine compared with the posterior region, but the variance between groups was comparable with the variance within groups, and the difference was not statistically significant. To ensure that there was no influence of regional uptake differences, intestinal segments were systematically rotated across all treatments.

Intestinal P_i flux measurements were conducted using a modified gut-sac method, described previously for hagfish (17). Briefly, each intestinal section was formed into a sac by ligating one end with suture thread and inserting into the other end an ∼5-cm length of flared cannula [polyethylene (PE)-50 Intramedic tubing, Clay Adams; Becton Dickinson, Franklin Lakes, NJ], secured in place with suture thread. Ca²⁺- and Mg²⁺-free HF saline (see Solutions above), containing [³²P]-orthophosphoric acid radionuclide (6 μCi/mol P_i; PerkinElmer, Waltham, MA), was injected into the gut sac via the cannula until the sac was turgid to the touch, and the cannula was sealed with a sewing pin or by heat sealing. The gut sac was immersed in 10 ml aerated Ca²⁺- and Mg²⁺-free HF saline containing unlabeled P_i for a 2-h flux period. In all experiments, tissues were symmetrically exposed on each side to solutions of identical composition, except that only one side contained radiotracer P_i amongst the unlabeled P_i. At the end of the period, the gut sac was drained and cut open laterally. No radiolabeled P_i was detected in the saline on the serosal side. To remove materials bound to the mucus layer, the mucosal surface was gently scraped with a glass microscope slide and rinsed three times with isotope-displacement solution (200 mmol/l Na₂HPO₄ in Ca²⁺- and Mg²⁺-free HF saline) to displace any isotope potentially adsorbed to the surface. The intestinal section was then stretched across graph paper for determination of surface area.

Skin P_i flux measurements.

Skin P_i flux measurements were conducted using a modified method described previously for hagfish by Glover et al. (16). In brief, modified flux chambers were constructed from 20 ml plastic scintillation vials with a circular hole of 2.835 cm² area cut out of the screw-top lids. Two small holes were drilled in the bottom of the chamber to serve as ports for the sample and for an air line. Eight sections of skin (∼3 cm × ∼3 cm) were dissected from the anterior half of the dead animal dorsal to the level of the branchial pores. Patches were placed over the top of the vial and secured in place by the lid with the external surface of the skin facing inside of the vial. The chamber was inverted and placed into a container, holding 20 ml of aerated Ca²⁺- and Mg²⁺-free HF saline containing unlabeled P_i. Ca²⁺- and Mg²⁺-free HF saline (10 ml) containing [³²P] orthophosphoric acid radionuclide was then injected into the skin chamber through the sample port, and an air line (PE-50 tubing) was inserted to mix and aerate the solution. Skin flux measurements were run for a 2-h period, and following this, skin was removed from the chambers, scraped with a glass microscope slide, and rinsed three times with isotope displacement solution (200 mmol/l Na₂HPO₄ in Ca²⁺- and Mg²⁺-free HF saline). No radiolabeled P_i was detected in the saline on the serosal side. Uptake by the skin was expressed per unit surface area exposed per unit time (nmol·cm⁻²·h⁻¹). Pilot experiments revealed no difference in P_i uptake between more anterior and more posterior sections of the skin, but to eliminate this possibility, the order of skin patches was systematically rotated across all treatments.

Gill perifusion.

Phosphate uptake across the gills of hagfish was investigated using a modified ex vivo gill perifusion method, described previously by Glover et al. (16). Gill pouches were dissected from dead hagfish, and the afferent and efferent water ducts of each pouch were cannulated with flared PE-50 tubing that was secured in place with surgical silk. Initial trials were conducted using food coloring, dissolved in hagfish saline to test the efficacy of the preparation and validate perifusion of the branchial water channels. Ca²⁺- and Mg²⁺-free HF saline (2–3 ml) was injected through the afferent water duct into the gill pouch to exchange water and expel any trapped air. The pouch was immersed in 10 ml aerated Ca²⁺- and Mg²⁺-free HF saline containing unlabeled P_i. The afferent cannula of each gill pouch was connected to a Gilson peristaltic pump, and the gill was perifused with Ca²⁺- and Mg²⁺-free HF saline containing [³²P]orthophosphoric acid radionuclide (6 μCi/mol P_i) at a rate of 6.0 ml/h for 3 h. Perifusates were collected over 30-min intervals. Glover and colleagues (16) stated previously that a flow rate of 5.9 ± 1.1 ml/h was ideal for perifusing hagfish gill pouches and prevented pouch swelling, cannula clogging, and development of artifact transport pathways. At the completion of the experiment, gill pouches were disassembled, blotted dry, and weighed. To calculate P_i uptake, the initial 30-min perifusate fraction was discarded, and then the disappearance of isotope from each 30-min fraction after that (representing the final 2.5 h of perifusion) was determined based on the difference in radioactivity between the afferent and efferent solutions. The uptake of P_i in each of the five final periods was averaged, divided by gill wet weight, and converted to an hourly rate.

Tissue digestion and radioisotope analysis.

Intestine and skin samples were digested in 1 N HNO₃ for 48 h at 60°C. Scintillation fluid (aqueous counting scintillant; Amersham Biosciences, Baie d'Urfe, Quebec, Canada) was added to digests, and samples were then held in the dark for 12 h before counting on a scintillation counter (LS6500; Beckman Coulter, Fullerton, CA). Manual quench correction was used for intestine and skin digests by generating quench curves over a range of tissue masses following the manufacturer's protocols (Beckman Coulter).

Identification of a slc34a-like transcript in a hagfish transcriptome.

A translated hagfish gill/slime gland transcriptome (constructed for G. G. Goss by BGI, Beijing, China) was searched using HMMER3 (v3.0; Janelia Farm, Ashburn, VA; hmmer.janelia.org) for suspected slc34a2-like homologs, as described previously in Herr et al. (20). Briefly, standard BLASTp algorithms were used to obtain 14 protein homologues of SLC34A2 [Homo sapiens sodium-dependent phosphate transport protein 2B isoform a (NP_006415.2)] from a variety of species (1). These homologues were used to build an alignment with MUSCLE (www.ebi.ac.uk/Tools/msa/muscle/), and with the use of HMMER3 (v3.0; Janelia Farm), a hidden Markov model (HMM) profile was calculated from the resulting alignment. This HMM profile for slc34a-like sequences was used as a query file to search against the hagfish transcriptome using standard HMMER algorithms. The sequences that were returned by the HMMER search were compared with the National Center for Biotechnology Information (NCBI) nonredundant protein database using BLAST to verify that they belonged to the slc34 family of genes. The outcome from this search resulted in a partial-length protein fragment (184 peptide residues), which when BLASTp analyzed, confirmed an slc34a-like identity. We then used the corresponding nucleotide sequence to this protein fragment for further discovery of true molecular identification using Rapid Amplification of cDNA Ends (RACE) protocols (see below).

RNA isolation, cDNA synthesis, and PCR identification of a slc34a-like transcript.

Total RNA was obtained from the hagfish gill, skin, kidney, and intestine (∼100 mg) using a TRIzol extraction. The RNA samples were then cleaned of genomic contents using DNAse I (Ambion/Life Technologies, Carlsbad, CA), and first-strand gill cDNA was synthesized using RevertAid H Minus Moloney murine leukemia virus RT (Fermentas/Thermo Scientific, Pittsburgh, PA) or the supplied RT for RACE-ready cDNA (see below).

The partial slc34a-like sequence identified in the transcriptome search was used to identify gene-specific primers for 3′RACE and 5′RACE PCR. 3′RACE was conducted using the Takara 3′RACE kit (Takara Bio, Otsu, Shiga, Japan), and 5′RACE was conducted using both the Takara 5′RACE kit (Takara Bio) and the Clontech SMARTer RACE cDNA kit (Takara Bio), according to the manufacturer's specifications, with the gene-specific primers listed in Table 1. DNA products were sequenced using BigDye Terminator 3.1, according to the manufacturer's specifications.

Table 1.

List of primers used for PCR amplification

Application	Sequences
PCR
sense:	5′-GGAGATCTGCCACCATGAAGTCATCA-3′
PCR
antisense:	5′-GTCATGAACGGTGGCACCCGCAAA-3′
PCR
sense:	5′-TTCCCATTTCCGTTTGGTTGGC-3′
PCR set 1
sense:	5′-GTCATCAACACAGACTTCCC-3′
antisense:	5′-GTAAAGGACGGCAAACCAAC-3′
PCR set 2
sense:	5′-ATGCAATCACCAACCACTGAG-3′
antisense:	5′-TCTGTTGAGAGCAGTGAGCC-3′
PCR set 3
sense:	5′-TCCCATTTCCGTTTGGTTGGCT-3′
antisense:	5′-GCGACGGCTTTGAAGGATGTTGAT-3′
PCR set 4
sense:	5′-ATCAGTATCGAGCGAGCATACCCA-3′
antisense:	5′-TAAAGGACGGCAAACCAACGGT-3′
5′RACE
antisense:	5′-CGACCTCCTCGGGAAGCCAATTCT-3′
5′RACE
antisense:	5′-TGCCAATGACAACACCCGCTACA-3′
Takara 5′RACE
sense 1:	5′-GCATCCCTGGCAAGTTCAGGCGA-3′
sense 2:	5′-ATGCAGTCTCTCCAGATTGCTC-3′
antisense 1:	5′-AGCACGGCGGTTGTGGTTGTCC-3′
antisense 2:	5′-CTACTATAGCCAAGTAGCCCGA-3′
RT primer:	5′-/5Phos/TGATGCCACTGATGT-3′
Takara 3′RACE
sense:	5′-CGTCCTTTACCTAATCGCA-3′

RACE, Rapid Amplification of cDNA Ends; Takara, Takara Bio (Otsu, Shiga, Japan).

Upon obtaining the full-length sequence, primers were developed to confirm the whole-length transcript (Table 1; Primer Set 2). A BLASTp search of the NCBI nonredundant protein database (1) revealed high sequence identity for our translated sequence to other slc34a2 sequences. The amino acid sequence of the hagfish Slc34a-like transporter was aligned with Slc34a2 protein sequences from other fish and mammalian species obtained from NCBI and Ensembl using the ClustalW2 analysis program (http://www.ebi.ac.uk/Tools/msa/clustalw2/). Membrane-spanning domains and re-entrant domains were determined using HMMTOP (41) and by comparisons with topological data from other Slc34a2 sequences (6, 14, 19, 42).

A phylogenetic tree was constructed by aligning the identified hagfish Slc34a sequence against other protein sequences from the Slc34a family (Slc34a1, Slc34a2, and Slc34a3) using MUSCLE (13) in SeaView (15, 18) for Mac OS X. Gaps and residues of low/noisy homology were then subtracted using gBlocks (8) with parameters selected to allow for more relaxed stringency (37). With the use of the CIPRES Science Gateway servers (28), phylogenetic analysis was conducted using RAxML version 8.0.0 (34), using the Jones-Taylor-Thornton evolutionary model (21). Branch support was estimated by bootstrap analysis with 1,000 iterations. For phylogenetic analysis, base frequencies were model determined, and the proportion of invariable sites was determined using the Gamma model, which was software optimized. Twenty protein sequences from the slc34a gene family were collected from different species to conduct the analysis with slc34a from Vibrio vulnificus (NP_759505.1) selected as an outgroup.

For RT-PCR, the following PCR primers were constructed: 5′ to 3′, GTCATCAACACAGACTTCCC and GTAAAGGACGGCAAACCAAC. Standard RT-PCR was performed using the following cycling parameters: 95°C for 2 min, followed by 40 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s. Aliquots of each PCR reaction were subjected to electrophoresis on a 2% agarose gel in 1× sodium boric acid buffer at 5 V/cm for 50 min, stained with ethidium bromide.

Data presentation and statistical analysis.

All data are presented as means ± SE. Differences between groups were evaluated using two-way ANOVA followed by the Holm-Sidak post hoc test. When comparing the effects of PFA and low sodium conditions in the gill experiments, paired parallel controls were not always possible; because of unequal variance between groups, values were first subjected to natural logarithm transformation to equalize variance, and then differences were evaluated using a one-way ANOVA followed by the Holm-Sidak post hoc test. Regression models were created from mean values using SigmaPlot v11.0 and tested for significance using the extra sum of squares F-test. Differences were considered statistically significant at P < 0.05.

RESULTS

Initial experiments using [¹⁴C]inulin showed that no radioactivity adhered to the surface or diffused into the tissue and that the scraping technique was effective at removing surface-bound mucus. Therefore, we considered all ³²P activity in tissue digests as corresponding to P_i uptake. Furthermore, no ³²P radioactivity above background levels was detected in serosal salines, indicating minimal transepithelial transfer of ³²P during the time of the experiment.

The rate of P_i uptake by the hagfish intestine and skin was dependent on the external concentration of P_i from 0.25 to 10.0 mmol/l (Fig. 1). P_i uptake rates in the intestine were linear with increasing P_i concentration, indicating predominance of a nonsaturable uptake pathway. P_i uptake rates in the skin were linear at high P_i concentration, but at P_i concentrations ≤2.0 mmol/l, there appeared to be a second, saturable uptake pathway that could be described by classical Michaelis-Menten kinetics (Fig. 1B). The improved fit of the Michaelis-Menten kinetic model was not a significant improvement over a linear model, as determined by the extra sum of squares F-test (P > 0.1; Table 2). Similarly, a three-parameter (sigmoidal) Hill equation did not improve the fit compared with the two-parameter Michaelis-Menten model (P > 0.9). The estimated apparent affinity constant (K_m) for the saturable P_i uptake in the skin was 0.93 ± 0.5 mmol/l.

Fig. 1.

Concentration-dependent inorganic phosphate (P_i) uptake in the (A) intestine and (B) skin of hagfish. Uptake rates in the intestinal gut sacs were linear with increasing P_i, indicating the predominance of a passive uptake pathway. Uptake rates in the skin, using modified Ussing chambers, were linear at high P_i, with a 2nd transport pathway that conformed to Michaelis-Menten kinetics at low P_i (B, inset). Values represent means ± SE, and sample sizes are indicated in parentheses. The curve inset was fitted using SigmaPlot v11.0. K_m, apparent affinity constant (mmol/l).

Table 2.

Regression models of gill P_i uptake kinetics

Model	Km	Vmax	HC	Adj R2	SSR	Sig.
Linear				0.673	543,721
2-Parameter	0.56 ± 0.4	1,347 ± 544		0.8665	54,433
3-Parameter	0.23 ± 0.01	801 ± 24	3.5 ± 0.6	0.9955	1,232	P < 0.01

P_i, inorganic phosphate; K_m, apparent affinity constant (mmol/l); V_max, estimated maximal transport velocity (nmol · g⁻¹ · h⁻¹); HC, Hill coefficient; Adj R², adjusted coefficient of determination; SSR, sum of squared residuals; Sig., significance of additional parameter above the simpler model.

The 3-parameter model provides a significantly better fit of the data (P < 0.01) by the extra sum of squares F-test. Parameters shown are best estimate ± SE.

The rate of P_i uptake by the hagfish gill also depended on the external concentration of P_i (Fig. 2). As in the skin, P_i uptake rates in the gill were also consistent with two parallel transport pathways, so further experiments were conducted at lower P_i concentrations (0.10 and 0.05 mmol/l). At concentrations <2.0 mmol/l, P_i uptake included a component that exhibited saturable kinetics (Fig. 2B). The data can be fit to either a two-parameter simple Michaelis-Menten model or a three-parameter Hill equation. The three-parameter Hill equation provides a significantly better fit (P < 0.01). The estimated K_m, estimated maximal transport velocity, and Hill coefficients for the two kinetic models are given in Table 2. Discounting the lowest two P_i concentrations does not significantly alter the fit of either model.

Fig. 2.

Concentration-dependent P_i uptake in isolated, perifused hagfish gill pouches. A: P_i uptake rates at P_i ranging from 0.05 to 10.0 mmol/l. B: focused view of P_i uptake rates at low P_i from 0.05 to 1.0 mmol/l. Uptake rates in the gill were linear at high P_i, whereas a saturable transport pathway was clearly visible at low P_i. Values represent means ± SE, and sample sizes are indicated in parentheses. B, inset: the sigmoidal curve was fitted using SigmaPlot v11.0 and revealed a K_m of 0.23 ± 0.01 mmol/l. Alternative fitting of data to simple Michaelis-Menten kinetics; the Hill equation provided a significantly better model for the observed values (see Table 2). V_max, estimated maximal transport velocity.

P_i uptake by the intestine, skin, and gill at 2.0 mmol/l P_i was not dependent on external sodium and was not inhibited significantly by 10.0 mmol/l PFA (Fig. 3, A–C). However, at a lower concentration (0.25 mmol/l P_i), uptake was dependent on external sodium (Fig. 3, D–F). Although 10.0 mmol/l PFA tended to reduce P_i uptake in the intestine and gill, the effect was not statistically significant. A two-way ANOVA, using treatment and replicate number as factors, revealed a strong and significant effect (P < 0.001) of replicate number on measured values of skin P_i uptake at 0.25 mmol/l P_i, so those values are compared relative to paired controls. Effects of replicate number were not significant in other experiments (P > 0.3), so all other results are reported as absolute rates. In the Na⁺-limiting treatments, P_i uptake was reduced significantly by an average of 56% in the intestine and by an average of 86% in the gill. In the skin, the Na⁺-limiting treatment significantly increased P_i uptake by an average of 58% compared with control rates. Whereas the Na⁺-limiting treatments were nominally free of Na⁺, measured values of Na⁺ in the mucosal saline at the end of the experiments averaged 10.4 ± 1.3 mmol/l in the intestine, 4.7 ± 0.6 mmol/l in the skin, and 0.6 ± 0.1 mmol/l in the gill preparations.

Fig. 3.

Potential effect of phosphonoformic acid (PFA; 10.0 mmol/l) and Na⁺ (Na)-limiting solutions on P_i uptake in the (A and D) intestine, (B and E) skin, and (C and F) gill of hagfish at 2.0 mmol/l P_i (A–C) and at 0.25 mmol/l P_i (D–F). Bars indicate means ± SE, and sample sizes are indicated in parentheses. P_i uptake in the intestine and gill (*) at 0.25 mmol/l P_i was significantly inhibited in Na⁺-limiting solutions, whereas uptake in the skin (*) was significantly stimulated (P < 0.05, ANOVA).

A full coding sequence of a Slc34a-like transporter was identified and sequenced from hagfish gill cDNA. A BLAST search of the NCBI nonredundant protein database matched the full-deduced amino acid sequence most closely to the Slc34a2 proteins from Xenopus tropicalis, Xenopus laevis, and Danio rerio (67%, 66%, and 66% sequence identity, respectively). The full-length sequence of the hagfish Slc34a transporter is available in GenBank under accession number KJ701415.

Alignment of Slc34a amino acid sequences from fish and mammalian species with the hagfish Slc34a revealed strong conservation in several regions of the sequence (Fig. 4). Hydrophobicity analysis of the hagfish Slc34a revealed that the protein would also share a similar structure to Slc34a2 transporters of other species and contains 12 predicted transmembrane domains. Phylogenetic analysis confirmed that the full-length sequence obtained from hagfish encodes a Slc34a transporter and also revealed that the hagfish Slc34a diverged earlier than, and/or is ancestral to, the vertebrate Slc34a transporters (Fig. 5).

Fig. 4.

Alignment of the hagfish (Eptatretus stoutii) sodium phosphate cotransporter Slc34a (NaPi-II) amino acid sequence with Slc34a2 sequences from Latimeria chalumnae (Slc34a2: ENSPMAG00000003021), Danio rerio (Slc34a2a: NP_571699; Slc34a2b: NP_878297), Rattus norvegicus (Slc34a2: NP_445832), and Mus musculus (Slc34a2: NP_035532) using ClustalW2 (24). Identical amino acid residues are indicated by asterisks (*). Shaded bars on the top of the alignment indicate predicted transmembrane domains (numbered). Membrane-spanning domains (blue) and re-entrant domains (orange) were fitted using the amino acid sequence analysis program HMMTOP (41) and by comparisons with topological data from other Slc34a2 sequences (6, 14, 19). A motif reported to be responsible for pH-dependent transport (red overscore) is also highlighted (19).

Fig. 5.

Phylogenetic analysis of the Slc34 family of phosphate transporters. Amino acid sequences were aligned with MUSCLE (13), and the tree was generated using the maximum likelihood method based on the Jones-Taylor-Thornton model (21) using RaXML (v8.0.0) (34). The numbers (bootstrap values) represent the percentage of trees in which associated taxa clustered together (1,000 replicates). The scale bar represents genetic distance as number of amino acid substitutions per site. Accession numbers are as follows: Vibrio vulnificus Slc34a, NP_759505; Nematostella vectensis Slc34a2, XP_001641536; Xenopus tropicalis Slc34a2a, ENSXETT00000002069; X. tropicalis Slc34a2b, ENSXETT00000062583; L. chalumnae Slc34a2, ENSLACP00000014496; D. rerio Slc34a2a, NP_571699; D. rerio Slc34a2b, NP_878297; Cyprinus carpio Slc34a2, AAG35803; Tachysurus fulvidraco Slc34a2, ADM18964; Oreochromis niloticus Slc34a2, ENSONIG00000017992; Petromyzon marinus Slc34a2b, ENSPMAG00000003021; Takifugu rubripes Slc34a2a, ENSTRUP00000034707; T. rubripes Slc34a2b, ENSTRUP00000034708; Homo sapiens SLC34A2, AAF31328; R. norvegicus Slc34a2, NP_445832; M. musculus Slc34a2, NP_035532; H. sapiens SLC34A1, AAA36354; R. norvegicus Slc34a1, NP_037162; M. musculus Slc34a1, NP_035522; X. tropicalis Slc34a3, ENSXETT00000050672; L. chalumnae Slc34a3, ENSLACP00000002539; H. sapiens SLC34A3, NP_543153; R. norvegicus Slc34a3, NP_647554; and M. musculus Slc34a3, NP_543130.

DISCUSSION

To our knowledge, the present report is the first conclusive demonstration of P_i uptake by non-intestinal tissues of any animal of the chordate lineage. Remarkably, several epithelial tissues of the hagfish can absorb P_i directly from the aquatic environment. Thus the hagfish may be able to obtain this major inorganic nutrient in large amounts during rare encounters with high P_i concentrations, such as when feeding within seafloor carrion. We have also demonstrated that there appears to be both saturating and non-saturating (at the tested concentrations) components of the P_i-uptake pathways present in these tissues. Finally, we have obtained a full sequence of a Slc34a (NaPi-II) transporter for hagfish and demonstrated that it is present in each of these tissues. The lack of calcified tissues in the hagfish anatomy as a potential storehouse for P_i, coupled with the sporadic and opportunistic feeding strategy, may make the described extraintestinal P_i-uptake mechanisms critically important in overall P_i homeostasis in the hagfish.

Intestinal absorption.

In the hagfish intestine, the rate of P_i uptake increased linearly with increasing P_i concentrations. This linear relationship strongly suggests that the nonsaturable transport component of P_i uptake predominates in the hagfish intestine across the range of P_i concentrations tested. Similar nonsaturable P_i uptake has been reported in the intestine (2) and pyloric caeca (36) of rainbow trout, the only fish studied in this regard. However, in both of these studies, carrier-mediated, active P_i uptake was also observed. Similar nonsaturable (postulated to be diffusive and/or passive in previous studies) and saturable P_i uptake processes have been reported in the intestine of rats (5) and rabbits (12). We suggest that active transport of P_i in the hagfish intestine may be occurring, but its contribution is masked by the high rate of transport through the nonsaturable pathway.

The hagfish has been examined previously with respect to the intestinal absorption of amino acids (17) and the transport of glucose by erythrocytes (47). Both of these studies suggested that hagfish nutrient transport systems are more similar to those of mammals than to those of teleost fish. With regard to intestinal P_i uptake, hagfish appear to be similar to both trout and mammals (11), primarily due to the high P_i concentrations presumably present in the intestine after feeding. However, further physiological and molecular characterization is required to confirm this.

In the intestine, as well the skin and gill, transepithelial transport of Pi was not detected, suggesting that the absorbed P_i is predominantly incorporated into the intracellular pool in these tissues. Cellular components, such as DNA, RNA, ATP, ADP, creatine phosphate, proteins, and other phosphate-containing materials, might together serve as a sink for incoming P_i. Only over longer time scales or under much higher absolute rates of P_i uptake would transepithelial transport of radiolabeled P_i be expected to be apparent.

Absorption by skin and gill.

We have demonstrated for the first time in any chordate or vertebrate that the skin and gill of the hagfish are able to absorb significant amounts of P_i directly from the aqueous medium. Absorption of major inorganic macronutrients, such as P_i, across extraintestinal epithelia is rare in animals, with quantitative measurements of P_i uptake from the environment limited, thus far, to only two species of bivalve mollusk: the American oyster [Crassostrea virginica (31)] and mussel [Mytilus edulis (32)]. In both of these studies, P_i accumulation was detected in the gills of the mollusk; however, these studies did not investigate the uptake mechanism. P_i uptake has also been suggested to occur across the integument of amphibians, with Mobjerg and colleagues (29) identifying a strong, positive correlation between the P_i concentration in the aquatic medium and P_i concentrations in urine and lymph of the toad, Bufo bufo. However, the present study is the first to measure quantitatively unidirectional P_i uptake by extraintestinal epithelia.

P_i uptake across both skin and gills of hagfish increased linearly with increasing external P_i concentrations >1.0 mmol/l. This suggests a nonsaturable uptake pathway at P_i concentrations >1.0 mmol/l, similar to that observed in the intestine. Hagfish, therefore, appear to have the remarkable capacity to obtain large amounts of P_i across extraintestinal epithelia when they opportunistically encounter high environmental P_i concentrations, such as those present within a decomposing animal. This could provide immediate access to this important nutrient even before digestion and absorption proceed within the gut.

Interestingly, the skin and gill also both exhibited saturable P_i transport at P_i concentrations <1.0 mmol/l. The simple Michaelis-Menten two-parameter models showed similar K_m values for P_i uptake in the skin and gill (0.93 ± 0.5 and 0.56 ± 0.4 mmol/l, respectively), suggesting that similar or identical transport pathways operate in both tissues. In addition, the saturable kinetics observed in the skin and gill were similar to those reported for mammalian and trout intestine active P_i transport systems that generally have a K_m from 0.6 to 1.3 mmol/l P_i (2, 5, 12, 36). It is also notable that a sigmoidal, three-parameter model best described the P_i uptake kinetics in the hagfish gill. Such observations are more difficult to interpret for intact tissues than for individual isolated transporters, as there may be various processes at work. Sigmoidal uptake kinetics have also been observed for hagfish skin and gill absorption of amino acids (16). Those authors attributed such kinetics to multiple transport pathways operating in concert. For that study and the present, the sigmoidal kinetics could also be attributed to one or more instances of positive cooperativity. Sigmoidal kinetics are commonly assumed to indicate cooperative binding of substrate through modulation of the individual enzyme of interest (45). When working with intact tissues, the possibility arises that cells may adjust their transport mechanisms based on the environment to which they are exposed. In the case of the hagfish gill, it is conceivable that the usual capacity for active P_i uptake is low but becomes stimulated upon exposure to a nutrient-rich environment. Such ability would be adaptive in an animal that usually encounters minuscule levels of external P_i but encounters high levels during occasional feeding events.

The contributions of the skin and gill epithelia to total P_i uptake are considerable. For a hagfish of average size exposed to 2.0 mmol/l P_i, a rough approximation from the data suggests that the total P_i uptake across all gills would be ∼2,600 nmol/h, whereas that across the entire skin surface would be ∼3,500 nmol/h. The magnitude of intestinal uptake is certainly underestimated in the present study, because the procedure for measurement removes some of the mucosal layer; however, the observed rate can be taken as a minimum and would supply at least 200 nmol/h across the entire gut.

Possible active transport mechanisms.

Sodium phosphate cotransporters (Slc34a2) in mammals and Slc34a2a in fish have been demonstrated to play a significant role in P_i uptake in the intestine (12, 21, 30). We therefore investigated the role of the hagfish Slc34a2-like transporter in P_i uptake using a pyrophosphate structural analog and putative Slc34a competitive inhibitor, PFA (25). We also investigated Na⁺-dependent P_i uptake in a Na⁺-limiting environment, as Slc34a has been demonstrated previously to be a Na⁺-dependent transporter in trout (2) and other higher vertebrates (11, 42).

Initially, we tested PFA and Na⁺-limiting experiments in hagfish tissues at 2.0 mmol/l P_i, because this is within the saturable uptake range for trout (2). However, in the hagfish intestine, skin, and gill, P_i uptake at 2.0 mmol/l P_i was not inhibited by 10.0 mmol/l PFA and was not affected by a Na⁺-limiting medium. This result was likely due to the 2.0-mmol/l P_i being above the saturable range in the hagfish gill and skin. Therefore, we investigated further the effects of PFA and a Na⁺-limiting environment on P_i transport at 0.25 mmol/l P_i, which is within the saturable range observed for both the gill and the skin.

At 0.25 mmol/l P_i, uptake in the hagfish intestine and gill was decreased significantly by 56% and 86%, respectively, in the Na⁺-limiting environment, suggesting the involvement of a Slc34a2 transport system in both of these tissues, which is supported further by the presence of this transporter in both tissues by RT-PCR (Fig. 6). The decrease in P_i uptake in hagfish gill and intestine is also consistent with the results of Avila et al. (2), who reported a 90% reduction in trout intestinal P_i uptake in a Na⁺-free environment. Analysis of the Na⁺ concentrations in the mucosal samples of the intestine after our experiments revealed the presence of Na⁺ at 10.4 ± 1.3 mmol/l in our Na⁺-limiting exposure. Given that the K_m for Na⁺ in the flounder Slc34a2 transporter is near 45 mmol/l (22), it is likely that the Na⁺-linked component of transport was only inhibited partially in our experiments on the hagfish intestine. In previous studies, Na⁺ concentrations in mucosal samples have not been measured in nominally Na⁺-free or -limiting experiments; this should be considered when re-interpreting past studies and designing future studies.

Fig. 6.

Expression of hagfish slc34a mRNA in different tissues determined by RT-PCR experiments. Reactions were performed using hagfish slc34a-specific primers, and amplification of a 393-bp partial sequence was detected using reverse-transcribed RNA from intestine, skin, gill, and kidney. Lane 1: size markers, lane 2: no template control, lane 3: intestine, lane 4: gill, lane 5: skin, lane 6: kidney. Size markers are indicated at left.

The lack of response of the skin to PFA and to Na⁺-limiting treatments at 0.25 mmol/l P_i suggests that a different transport system is present in the skin compared with the gill and intestine. The complete lack of effect of PFA and the significant stimulation of P_i uptake in the sodium-limiting treatment are not consistent with the action of a classical NaPi-II-like system or any other sodium-phosphate cotransport system. It is possible that the observed stimulation in the Na⁺-limiting treatment is a result of the increase in K⁺ concentration caused by substituting KHCO₃ and KH₂PO₄ for their Na⁺ salts. The higher levels of potassium might depolarize the cell-membrane potential. In such a case, the uptake of negatively charged P_i through electroneutral or electrogenic (negative-charge importing) mechanisms would be facilitated. At this point, it remains unclear which mechanisms of P_i uptake predominate in the hagfish skin. This warrants further investigation.

In our experiments, we found that 10.0 mmol/l PFA did not significantly inhibit P_i transport in any of the tissues tested. Because PFA acts as a classical competitive inhibitor at the P_i binding site of Slc34a (25), it is possible that 10.0 mmol/l PFA was insufficient to produce considerable inhibition at the P_i concentrations tested. Unfortunately, the limited solubility of PFA in our salines precluded the use of higher concentrations. Also, this is the first report of PFA use in a seawater-like solution, and it is, therefore, unclear whether the effectiveness of PFA is reduced in seawater compared with the usual physiological salines or whether PFA has a lower affinity for hagfish P_i transport systems.

Hagfish Slc34a is an ancestral transporter.

With the use of RT-PCR, we detected the presence of a 393-bp slc34a-like fragment in hagfish intestine, skin, gill, and kidney that shared an 84% amino acid identity with X. tropicalis Slc34a2 (Fig. 6). After determining the full coding sequence of this transcript from the hagfish gill, we found that the predicted amino acid sequence shares 67% amino acid identity with X. tropicalis Slc34a2. In the few amino acid residues that are known to be functionally important for Slc34a transporters, we found no striking differences between the hagfish Slc34a and vertebrate Slc34a transporters. One residue critical for transport activity—N182 in the hagfish Slc34a—is conserved across all examined Slc34a transporters (23). Phylogenetic analysis indicates that the hagfish Slc34a is ancestral to the vertebrate Slc34a transporters, because its apparent divergence predates the divergence of the vertebrate Slc34a1 and Slc34a2 forms. Therefore, it appears likely that the Slc34a2-type transporter arose before the Slc34a1 type. This is the first P_i transporter cloned from the hagfish, although the existence of multiple hagfish Slc34a transporters remains a possibility and will be investigated as more genetic information becomes available.

It has been suggested previously that because Caenorhabditis elegans has apparently only one slc34a homolog, it was probably duplication in the original slc34a-related gene early in the development of vertebrates that led to what was to become the modern slc34a2 and slc34a1 (46). In the absence of genomic information on the hagfish, we cannot determine whether multiple slc34a genes are present, but the results of our phylogenetic analysis (Fig. 5) are consistent with the hagfish slc34a gene as a remnant of an slc34a-like precursor to all vertebrate slc34a isoforms.

In the hagfish intestine and gill, results from the Na⁺-dependent, RT-PCR, and kinetic studies strongly suggest the involvement of the Slc34a-like transporter in P_i uptake. In the gill, the K_m, in the three-parameter model was 230 μmol/l P_i, which is close to the range observed for other Slc34a2 transporters expressed in Xenopus oocytes (46). However, the Slc34a-like transport system may not be the only P_i uptake system in the hagfish intestine and gill, although it appears to contribute significantly to the saturable P_i uptake observed in the gill. Other conceivable routes of P_i uptake could be via the Pit (Slc20) family of sodium-phosphate cotransporters, via H⁺-coupled cotransport through the Slc34a or Pit transporters, or possibly via exchange for bicarbonate or organic anions through an anion exchanger-type protein (44). Functional expression of the hagfish Slc34a transporter in Xenopus oocytes and the generation of a hagfish Slc34a-specific antibody in future experiments will provide further insight into the specific role of this transporter in P_i uptake by the gill, skin, and intestine.

Conclusion.

In summary, we have demonstrated that the hagfish has the remarkable ability to absorb the major inorganic nutrient P_i using the gills and skin, in addition to intestinal uptake. This is the first quantitative measurement of P_i uptake by the gill or skin of any chordate/vertebrate species and provides further insight into the adaptations of hagfish to maximize absorption of nutrients across multiple surfaces during opportunistic encounters with high nutrient concentrations. Finally, P_i absorption in hagfish gill and intestine likely occurs, in part, via an Slc34a-like transport system, and the cloning of the responsible transporter(s) from this early-diverging chordate/vertebrate will be of interest to comparative and evolutionary biologists alike.

GRANTS

Support for this research project was provided by a Natural Sciences and Engineering Research Council of Canada Discovery grant to G. G. Goss. S. C. Guffey was supported by an Alberta Innovates Technology Futures Graduate Scholarship and the Sigurd Tveit Memorial Scholarship. A. M. Clifford was supported by an Alberta Innovates Technology Futures Graduate Scholarship (doctoral) and Natural Sciences and Engineering Research Council of Canada Postgraduate Scholarship-Doctoral (NSERC PGS-D) Graduate Scholarship.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

Author contributions: A.G.S. and G.G.G. conception and design of research; A.G.S., S.C.G., and A.M.C. performed experiments; A.G.S., S.C.G., and A.M.C. analyzed data; A.G.S., S.C.G., A.M.C., and G.G.G. interpreted results of experiments; A.G.S., S.C.G., and A.M.C. prepared figures; A.G.S., S.C.G., and G.G.G. drafted manuscript; A.G.S., S.C.G., A.M.C., and G.G.G. edited and revised manuscript; A.G.S., S.C.G., A.M.C., and G.G.G. approved final version of manuscript.