Abstract
Ewing’s sarcoma is characterized by the t(11;22)(q24:q12) reciprocal translocation. To study the effects of the fusion gene EWS-FLI1 on development and tumor formation, a transgenic mouse model was created. A strategy of conditional expression was used to limit the potentially deleterious effects of EWS-FLI1 to certain tissues. In the absence of Cre recombinase, EWS-FLI1 was not expressed in the EWS-FLI1 transgenic mice, and they had a normal phenotype. When crossed to the Prx1-Cre transgenic mouse, which expresses Cre recombinase in the primitive mesenchymal cells of the embryonic limb bud, the EF mice were noted to have a number of developmental defects of the limbs. These included shortening of the limbs, muscle atrophy, cartilage dysplasia, and immature bone. By itself, EWS-FLI1 did not induce the formation of tumors in the EF transgenic mice. However, in the setting of p53 deletion, EWS-FLI1 accelerated the formation of sarcomas from a median time of 50 weeks to 21 weeks. Furthermore, EWS-FLI1 altered the type of tumor that formed. Conditional deletion of p53 in mesenchymal cells (Prx1-Cre p53lox/lox) produced osteosarcomas as the predominant tumor. The presence of EWS-FLI1 shifted the tumor phenotype to a poorly differentiated sarcoma. The results taken together suggest that EWS-FLI1 inhibits normal limb development and accelerates the formation of poorly differentiated sarcomas.
Keywords: EWS-FLI1, p53, Ewing’s sarcoma, Prx1, development
Introduction
Ewing sarcoma is the second most common sarcoma of bone in the pediatric population, after osteosarcoma. The chimeric gene EWS-FLI1 is associated with Ewing’s sarcoma.(1) A reciprocal chromosomal translocation t(11;22)(q24:q12), which produces the fusion gene, occurs in nearly all patients. In variant cases, alternative translocations bearing similar fusion genes are found. Although EWS-FLI1 is suspected to be critical to the etiology of the disease, the mechanism by which it acts is not altogether clear.
Ewing’s sarcoma is a unique malignancy, composed of small, poorly differentiated cells. The cells typically have scant, weakly eosinophilic cytoplasm that usually contains glycogen in the form of periodic acid Schiff-positive, diastase degradable granules, and round nuclei with evenly distribute chromatin and low mitotic activity. Immuno-histochemical analysis has shown that in more than 90% of cases Ewing sarcoma cells express the adhesion receptor CD 99 (2). Unlike other sarcomas, it does not exhibit any signs of differentiation that reflect a mesodermal derivation of the cells. It has been suggested that Ewing’s sarcoma may be derived from primitive neuroectodermal cells, since the cells carry markers shared by primitive cells of neural lineage.(3, 4) Depending on the degree of neuroectodermal differentiation, Ewing sarcoma cells may also express neural cell markers, including neural specific enolase (NSE), synaptophysin, and CD57(5).
The EWS-FLI-1 fusion protein behaves as an aberrant transcriptional regulator. (6) EWS-FLI-1 expression is required for EFT development, but the mechanisms whereby it induces transformation and/or controls tumor growth and progression are not altogether clear. Genes whose expression has been reported to be induced by EWS-FLI-1 include MYC (7), EAT-2 (8), MMP-3 (9), FRINGE (10), ID2 (11), and CCND1 (12); in contrast, TGFBR2 (13), CDKN1A (p21/CIP1/WAF1; ref. (14)), and p57KIP (15) are among those reported to be repressed.
Despite improvements in treatment for patients with localized disease, (16) the prognosis for patients with patients with metastatic and relapsed disease is still poor, and it has been suggested that dose intensification with current chemotherapeutic agents may be reaching a plateau in terms of efficacy and toxicity (17, 18). In a recent query of the National Cancer Data Base of the American College of Surgeons, the survival of patients overall is still only about 50% (19).
At the present time, a transgenic mouse model of Ewing’s sarcoma has not been successfully created. There may be multiple reasons for this, but one obstacle may be interference with normal development of critical organs. To circumvent the possibility of embryonic lethality, a strategy of conditional expression seems desirable to limit any harmful effects of the gene to certain tissues.
Selection of the target cell or tissue for expression of EWS-FLI1 is an important issue. Previous studies have shown that expression of EWS-FLI1 or Ews-ERG in murine hematopoietic cells result in the formation of leukemias as opposed to sarcomas (20, 21). Although neuroectodermal cells have been considered by some to be the cell of origin of Ewing’s sarcoma, primitive mesenchymal cells may be a better candidate. It is noteworthy that the vast majority of cases of Ewing’s sarcoma arise in bone, which is of mesodermal origin. Furthermore, it has recently been demonstrated that EWS-FLI1 can transform mesenchymal progenitor cells, which develop into undifferentiated tumors when injected into immunodeficient mice.(22) The tumors share many of the morphological features and immunohistochemical markers of Ewing’s sarcoma.
The Prx1 gene is a paired-related homeobox gene that is expressed in the primitive mesenchymal tissues of the embryonic limb bud.(23) A transgenic Prx1-Cre mouse has been created that employs a 2.4 kb 5′ genomic region to regulate Cre expression.(23) The Prx1-Cre mouse enables conditional expression of genes in the mesenchymal tissues of the extremities while sparing the central vital organs.
In the present study, we employ the Prx1-Cre mouse and a strategy of conditional expression in mesenchymal cells to create a transgenic mouse with the EWS-FLI1 gene. We find that expression of EWS-FLI1 in vivo disrupts the normal development of connective tissues in the limb. EWS-FLI1 also has potent activities that accelerate the formation of sarcomas. In both of these processes, EWS-FLI1 appears to prevent maturation and differentiation of cells.
Materials and methods
Reagents
Tris, glycine, NaCl, sodium dodecyl sulfide, and bovine serum albumin were purchased from Sigma-Aldrich (St. Louis, MO). Rabbit polyclonal antibody to EWS-FLI-1 (BL2479) was obtained from Bethyl Laboratories, Inc (Montgomery, TX). This was directed against synthetic peptide that represented the point of fusion between EWS and Fli1 as predicted in Genbank entry ACA62796.1. More specifically, the peptide contained the residues 263-QQNPS-267 of ACA62796.1 with additional residues from upstream and downstream to present the point of fusion in a context similar to that which one might expect for the protein predicted by entry ACA62796.1. Rabbit anti-c-myc, goat anti-Manic fringe, rabbit anti-TGFβRII, mouse anti-p21WAF1 and rabbit anti-NSE were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Antibody against β-actins was purchased from Sigma-Aldrich. Vectastain ABC kit was obtained from Vector Laboratories (Burlingame, CA).
Mice
The Prx1-Cre(23), CMV-Cre (24), Zp3-Cre (25), and p53lox (26) mice have been previously described. All mice were maintained in a C57Bl/6 background.
Generation of EWS-FLI1 transgenic mouse
To establish the EWS-FLI-1 mouse model, type I EWS-FLI1 (7-6) fusion gene was inserted into the Not1 and EcoRI sites of construct pCLE2, a modified form of pCX-GFP (27) that included the chick β actin promoter and cytomegalovirus enhancer (Fig. 1A). The EWS-FLI1 gene was placed downstream of the enhanced green fluorescent protein (EGFP) gene, which was flanked by loxP sites. The construct was designed to enable screening of transgenic pups by EGFP. In the absence of Cre recombinase, EWS-FLI1 should not be expressed. After excising the construct with restriction enzymes Sal I and HindIII, the DNA was purified and then injected into embryos. Viable pups were screened by EGFP fluorescence under ultraviolet light and polymerase chain reaction (PCR) of tail DNA. Three mouse lines were selected (designated EF-a, EF-b, and EF-c). Southern blot analysis was used to verify each line (data not shown). The copy numbers carried by each line was assessed by quantitative PCR (Fig. 1B), using DNA from tail preparations. The primers for EWS-FLI1 spanning the junction site were EWS-FLI1 were Forward 5′AACAGAGCAGCAGCTACGGG and Reverse 5′TGTTATTGCCCCAAGCTCCT. In the absence of Cre recombinase, no abnormal phenotype was observed. All three transgenic lines were viable and reproductively fertile. The mice were maintained in a C57Bl/6 background.
Fig. 1.
Cloning scheme and characterization of the type 1 EWS-FLI1 transgenic construct. A, Cre-lox mediated recombination was the strategy used for creating the conditional allele. The DNA construct for the EWS-FLI1 transgenic mouse is shown. The CLE2 plasmid was generated by inserting loxP sites into the EcoR1 restriction sites of pCX-GFP. The CAG promoter consists of the CMV enhancer and the chick β actin core promoter. The gene for enhanced green fluorescent protein (EGFP) is flanked by loxP sites. In the presence of Cre recombinase, the EGFP cassette is excised, thereby enabling the EWS-FLI1 gene to be expressed. B, Quantitative PCR was performed to analyze mouse tail DNAs for the copy number of EWS-FLI1 of each transgenic line. The copy number was determined by comparison against wild-type genomic DNA that had been spiked with 1, 5, or 10 copies of the EWS-FLI1 transgene per genome equivalent DNA.
PCR genotyping
DNA from tail preparations was used to determine the genotype of mice. The primers for EWS-FLI1 spanning the junction site were EF2 forward 5′GACCGCCTATGCAACTTCTTATGG and EF2 reverse 5′TGGGGCCGTTGCTCTGTATTCTTA. This produced a product of 567 bases.
Histology and immunohistochemistry
Tissues were fixed in 10% buffered formalin, embedded in paraffin, and submitted for histology. Sections were cut to 5–7 micron thickness and stained. Tumor samples were reviewed by a veterinary pathologist (CVP) to determine the tumor subtype.
The paraffin-embedded sections were stained with either rabbit anti-EWS-FLI1 antibody or rabbit anti-NSE (Santa Cruz Biotechnology). Slides were incubated in primary antibodies (1:200 dilution) overnight in the cold room followed by incubation with respective secondary antibodies for 60 minutes using the Vectastain ABC kit (Vector Laboratories, Burlingame CA). Counterstaining was performed with nuclear fast red or haematoxylin.
Western blot analysis
To detect various proteins either tissue or cells were extracted by 0.05 mL lysis buffer containing 20 mM HEPES (pH 7.4), 2 mM EDTA, 250 mM NaCl, 0.1% NP-40, 2 μg/mL leupeptin, 2 μg/mL aprotinin, 1 mM PMSF, 0.5 μg/mL benzamidine, 1 mM dthiothreitol (DTT), and 1 mM sodium vanadate by incubation for 30 min on ice. The lysate was centrifuged and the supernatant was collected. Whole-cell protein (30 μg) was resolved on 7.5–12% SDS-PAGE, transferred onto a nitrocellulose membrane, blotted with antibodies, and then detected by chemiluminescence (ECL; Amersham).
Real time quantitative RT-PCR
Total RNA was extracted from tissues or cells with Trizol (Invitrogen) and further purified by the RNeasy kit (Qiagen). Reverse transcriptase reactions were performed with the First-Strand cDNA Synthesis Kit (Amersham Bioscience). Primers for EWS-FLI1 were Forward 5′AACAGAGCAGCAGCTACGGG and Reverse 5′TGTTATTGCCCCAAGCTCCT. The PCR reactions were performed in 96-well reaction plates using an ABI PRISM 7900 Sequence Detection System (Applied Biosystems). Each sample was measured in duplicate. The relative level of expression was determined by ΔΔCt normalized to endogenous control (GAPDH).
Statistical analysis
The SPSS 12.0 computer program was used to perform statistical calculations. Statistical significance was defined as p≤0.05. The log rank test was used to compare survival curves with Kaplan-Meier analysis. The chi-square test was used to compare the distribution of different types of tumors.
Results
Limb development
A construct of the EWS-FLI1 gene driven by the chick β actin promoter was designed to enable conditional expression. The EGFP gene was present upstream of the EWS-FLI1 gene and flanked by loxP sites.
After injection of embryos with the EWS-FLI1 DNA construct, three transgenic mouse lines (EF-a, EF-b, EF-c) were selected by fluorescence under ultraviolet light. The presence of the transgene was confirmed by PCR genotyping. In the absence of Cre recombinase, all of the mice had a normal appearance without any detectable abnormalities (Fig. 2A).
Fig. 2.

After crossing to the Prx1-Cre transgenic mice, abnormalities are observed in the limbs of double-positive offspring carrying both the Prx1-Cre and EWS-FLI1 genes. A. The newborn control pup has normal limbs (arrow). B. The EF-a newborn pup has shortened limbs but a normal crown-rump length. C. The EF-b newborn pup has curved arthrogrypotic-like limbs with six digits in all limbs. D. The EF-c embryo at E14.5 shows severe abnormality of the limbs, with no discernible formation of joints, bones, hands, or feet. The EF-c line does not produce viable pups when crossed to Prx1-Cre.
The three transgenic lines were then crossed to various transgenic mouse lines expressing Cre recombinase. An attempt at achieving global expression of EWS-FLI1 throughout the organism was not successful. Neither the CMV-Cre nor the Zp3-Cre mouse produced viable offspring that carried both the Cre and EWS-FLI1 genes.
To achieve conditional expression of EWS-FLI1 in the limbs, the three transgenic lines were crossed to the Prx1-Cre transgenic mouse. The Prx1-Cre transgenic mouse was selected for two main reasons. First, in previous experiments (unpublished data), we ascertained that Prx1 does affect most of the mesenchymally-derived cells and this is consistent with the published reports using lacZ reporter genes that show expression of Prx1 in the mesodermally derived tissues of the limb bud (23). Second, our strategy was to induce expression of EWS-FLI1 at an early stage in mesenchymal cell development since the cell of origin of Ewing’s sarcoma may be from an undifferentiated mesenchymal cell. Double-positive offspring carrying both the Prx1-Cre and EWS-FLI1 genes exhibited varying degrees of limb deformities (Fig. 2 B–D). The phenotype was reproducible for each EWS-FLI1 transgenic line, and we observed 100% penetrance of the limb phenotype in each transgenic line when crossed with Prx1-Cre mice. The EF-a mouse was characterized by severely shortened, atrophic limbs (Fig. 2B). The EF-b mouse was marked by minimally shortened, dysplastic limbs with duplication of the thumb and great toe (Fig. 2C). Both of these short-limbed mice had normal lifespan (beyond 2 years). The EF-c mouse was distinguished by severe limb deformities that lacked differentiation into digits or long bones in utero (Fig. 2D). These mice did not produce viable pups with the genotype Prx1-Cre EWS-FLI1.
Histological examination of various tissues of the limbs showed abnormalities of the musculoskeletal system in the Prx1-Cre EWS-FLI1 mice (Fig. 3). The effects were more pronounced for the EF-a line. In addition to marked shortening of the bones, there was muscular atrophy, endomysial fibrosis, cartilaginous dysplasia, and osteodystrophy. Both the articular cartilage and the bone had features of immature, incompletely organized tissue. There was an abundance of immature, woven bone present in the cortical bone of the midshaft of the femur, which normally is composed of highly organized trabecular bone. The EF-b line had histological findings similar to the EF-b, but to a lesser extent. Bone, muscle, and cartilage were all affected. The severity of limb deformity in the EF-c line precluded further analysis.
Fig. 3.
The EF transgenic mice exhibit multiple abnormalities of the limbs when crossed to Prx1-Cre. The effects are generally more severe for the EF-a mouse line. A (i–iii), Faxitron X-rays of adult mice at 6 weeks show marked shortening of the long bones of the EF-a mice (panel ii) and duplication of digits in the EF-b mice (white arrows, panel iii) when compared to normal mice (panel i). Histologically, a number of aberrations were found. B (i–iii), Skeletal muscles of the quadriceps were stained with trichrome and shown at low-power magnification (black bar = 1000 microns). The muscles of the EF-a mice (panel ii) and EF-b mice (panel iii) showed attenuation of the muscle fiber diameter and decrease in overall muscle mass compared to normal control (panel i). Degeneration of individual fibers and central location of nuclei can be observed. An increase in endomysial fibrosis is observed in the EF mice compared to normal mice. C(i–iii), Toluidine blue stain of the articular cartilage of the knee showed dysplastic and degenerative features (articular chondromatosis) in the EF-a mice (panel ii) and EF-b mice (panel iii) compared to normal mice (panel i). There is clustering of cells in multiple lacunae and loss of columnar arrangement of chondrocytes. D(i–iii), Hematoxylin and eosin staining of cortical femoral bone under polarized light demonstrates well-organized trabecular bone in the normal mouse (panel i) but an abundance of poorly organized, immature, woven bone (blue arrow) in the EF-a mouse (panel ii). A scant amount of mature lamellar bone (black arrow) is seen. The EF-b mouse (panel iii) also shows woven bone and impaired maturation but to a lesser extent than the EF-a mouse.
Tumor growth
The Prx1-Cre EWS-FLI1 short-limbed mice did not produce spontaneous tumors with observation up to 24 months. Neither the EF-a (n=10) nor the EF-b (n=10) transgenic lines produced tumors when crossed to Prx1-Cre transgenic mouse. Since the EF-c line did not generate viable pups after crossing to Prx1-Cre, no cohort could be established for the EF-c line.
Although the EWS-FLI1 gene did not generate tumors in the mice by itself, the possibility existed that it might cooperate with other mutations to affect tumor formation. Therefore, the EWS-FLI1 gene was introduced into mice with deletion of p53.
Using the Prx1-Cre transgenic mouse, conditional deletion of p53 in the mesenchymal cells of the limbs was achieved. Mice with a homozygous deletion of p53 (Prx1-Cre p53lox/lox) developed sarcomas at a median time of 50 weeks from birth (Fig. 4). The majority of these tumors were osteosarcomas (70%), followed by pleomorphic soft tissue sarcomas (17%).
Fig. 4.
In a model of sarcoma formation based upon conditional deletion of p53 (Prx1-Cre p53lox/lox), the presence of EWS-FLI1 altered the phenotype of the sarcoma and accelerated the time to onset of sarcomas. A, X-ray of the tibia shows exuberant periosteal bone formation in a mouse with EWS-FLI1. B, In most tumors arising in mice carrying EWS-FLI1, a poorly differentiated sarcoma was found with large, pleomorphic nuclei, scant cytoplasm, and compact cells (hematoxylin and esosin). C, In two cases, a small amount of osteoid was observed (arrow), and these cases the tumors were classified as osteosarcoma. The amount of osteoid was markedly less than typical cases of osteosarcoma, which were the predominant tumor type in mice without EWS-FLI1. D, Survival curves of mice bearing the genotypes EWS-FLI1 Prx1-Cre p53lox/lox (p53-del + EF) and Prx1-Cre p53lox/lox (p53-del) showed significantly worse survival when EWS-FLI1 was present (p<0.0001). The median survival was 21 weeks with EWS-FLI1 compared to 50 weeks without EWS-FLI1.
Conditional deletion of p53 and expression of EWS-FLI1 was achieved simultaneously by generating mice with the genotype Prx1-Cre p53lox/lox EWS-FLI1 (using the EF-a transgenic line). The presence of EWS-FLI1 resulted in two effects. The time to formation of tumors was accelerated from a median time of 50 weeks to 21 weeks (Fig. 4). Furthermore, the predominant histological subtype of sarcoma changed from osteosarcoma to a poorly differentiated sarcoma (Table 1).
Table 1.
Tumor spectrum of mouse cohorts
| Tumor | Prx1cre P53lox/lox | Prx1cre P53lox/lox EWS-FLI1 |
|---|---|---|
| Osteosarcoma | 16 | 2 |
| Poorly differentiated sarcoma | 4 | 18 |
| Lymphoma (thymic) | 2 | 0 |
| Lymphosarcoma of bone | 1 | 0 |
| Carcinoma | 0 | 1 |
P<0.0001
Expression of EWS-FLI1 and markers associated with Ewing’s sarcoma
The expression of EWS-FLI1 was assessed in tumor tissues of mice with the Prx1-Cre EWS-FLI1 genotype (using the EF-a transgenic mouse). Western blot analysis showed that the expression of EWS-FLI1 was consistently high in tumor samples carrying the EWS-FLI1 transgene (Fig. 5A). Immunohistochemical analysis showed expression of EWS-FLI1 in tumor tissues carrying the genotype Prx1-Cre EWS-FLI1 p53 lox/lox (Fig. 5B), while its expression was minimal in the internal organs. The level of expression of EWS-FLI1 was found to be elevated in tumor tissue by quantitative real-time RT-PCR. The mRNA expression of EWS-FLI1 was markedly increased in tumor samples over bone and muscle (Fig. 5D).
Fig. 5.
A, Western blot analysis showed expression of EWS-FLI1 and several of its functional targets, including manic fringe, c-myc, p21WAF1and TGF-β RII in bone (“Tg bone”) compared to the Ewing’s sarcoma cell line TC-71 and expression in three separate tumor specimens (genotype Prx1-Cre p53lox/lox EWS-FLI1). All of the tumors were from the EF-a transgenic mouse line. B, Immunohistochemistry with EWS-FLI-1 antibody demonstrated diffuse staining of cells from a tumor (Prx1-Cre p53lox/lox EWS-FLI1), but little staining in muscle or spleen from the same mouse. C, Immunohistochemistry demonstrated staining of cells for neuron-specific enolase (NSE) from a tumor expressing EWS-FLI1 (right hand panels, genotype Prx1-Cre p53lox/lox EWS-FLI1 [EF-a]). The staining for NSE, can be observed in patchy areas and sporadic cells. In comparison, there is no staining for NSE in sarcomas obtained by conditional knock-out of p53 without the presence of EWS-FLI1 (left-hand panels, genotype Prx1-Cre p53lox/lox). D, The expression of mRNA is shown for various specimens. qRT–PCR analyses showed a greater level of mRNA expression of EWS-FLI-1 in the tumor specimen compared to normal bone, muscle, and spleen from the same animal. Each sample was normalized against levels of GAPDH and each symbol denotes the mean value of a sample analyzed in triplicate.
The expression of NSE (neuron specific enolase) was assessed in tumor samples from mice carrying the Prx1-Cre EWS-FLI1 p53lox/lox genotype. Elevated levels of NSE could be seen when compared to the control tumors that did not express EWS-FLI1 (genotype Prx1-Cre p53 lox/lox, Fig. 5C).
The expression of a number of genes has been reported to be affected by EWS-FLI-1. These include manic fringe (10), c-myc (7), p21WAF1 (14) and transforming growth factor beta (TGF-β) type II receptor (TGF-β RII) (13). In tumors derived from mice bearing the genotype Prx1-Cre EWS-FLI1 [EF-a] p53lox/lox, there is up-regulation of the level of expression of c-myc and manic fringe. Concomitantly, there is down-regulation of the level of expression of p21WAF1 and TGF-β RII (Fig. 5A).
Discussion
EWS-FLI1 has important effects on development of the mouse limb. Transgenic mice demonstrate short limb phenotypes with muscle atrophy. The findings correlate nicely with the observations of Eliazer et al, (28) who found that EWS-FLI1 had a profound inhibitory effect on the ability of cells in culture to differentiate into muscles. EWS-FLI1 has also been reported to have inhibitory effects on osteoblastic differentiation (29) and neural differentiation in cell culture.(30) Our in vivo results are consistent with these findings. The bones of the EF transgenic mice showed abundant woven bone and impairment of bone maturation. Although it was difficult to examine the nerves histologically, we did notice aberrations in cartilaginous development.
The results of this study suggest that the EWS-FLI1 oncoprotein is lethal to the developing mouse embryo. No pups were recovered with constitutive global expression of EWS-FLI1. The finding is important for future work with the gene in vivo. It is likely that strategies for studying the gene must limit its expression to specific tissues or certain temporal sequences.
The level of expression of EWS-FLI1 was found to be low in adult tissues of the EF transgenic mice. The reason for this is not altogether clear, but it may be related to the deleterious effects on normal development. It is likely that cells expressing EWS-FLI1 do not divide and differentiate in a normal manner. In untransformed cells, the EWS-FLI1-expressing cell may be arrested in its differentiation in a primitive state. Previous work has shown that EWS-FLI1 arrests growth of human fibroblasts(31) and induces apoptosis in mouse embryonic fibroblasts.(32) The fact that Ewing’s sarcoma is composed of undifferentiated, primitive cells is consistent with the notion that EWS-FLI1 arrests cells at an early stage of differentiation.
In tumors there is an apparent upregulation of EWS-FLI1. There are several possible explanations for this finding. An increase in the level of expression of each individual cell is certainly possible. However, it may be more likely that there is an enrichment of the proportion of cells expressing EWS-FLI1. In non-neoplastic tissues of transgenic EF mice, the expression of EWS-FLI1 may be restricted to primitive, undifferentiated cells that form a small proportion of the total number of cells. Cells that successfully differentiate may possess mechanisms for dampening or abrogating the expression of EWS-FLI1.
By itself, EWS-FLI1 does not appear to be a strong initiator of sarcoma formation in murine mesenchymal cells. Tumors were observed only in the background of p53 deletion. These results strongly point to the existence of additional cooperative mutations that are essential for the transformation process with EWS-FLI1. The fact that p53 was found to have synergistic effects with EWS-FLI1 is consistent with clinical observations. Ewing’s sarcoma is associated with mutations of tumor suppressor genes such as p53 and p16 in a significant percentage of cases.(33) Other mutations may also be involved, and future work is needed to identify these genes.
The relationship between EWS-FLI1 and p53 is intriguing. It has been reported that EWS-FLI1 induces a p53-dependent growth arrest in primary human fibroblasts.(31) The absence of p53 may create a more permissive environment for the cell to continue to divide. Disruption of the p53 pathway may therefore be crucial to the process by which EWS-FLI1 transforms the cell. This disruption may not necessarily involve actual mutation of p53. Mutation of other genes in the pathway may achieve the same effect.
The lack of tumors in animals expressing only EWS-FLI1 without other mutations could be the result of a number of factors. Species differences in the molecules interacting with EWS-FLI1 could alter the effects of the gene. The mouse may have slightly different mechanisms governing cell growth and differentiation of mesenchymal cells.
Another potential explanation for why EWS-FLI1 alone did not induce tumors is that the cell of origin may not be a mesenchymal cell. The cells of Ewing’s sarcoma carry certain differentiation markers that suggest a relationship to primitive neuroectodermal cells.(3, 4) However, it is possible that these markers are induced by the presence of EWS-FLI1. Recent work has shown that a rhabdomyosarcoma cell line upregulates neuron-associated genes when EWS-FLI1 expression is induced.(34) In another study, human mesenchymal progenitor cells transformed by EWS-FLI1 acquired the cell surface marker neural-specific enolase (NSE). (22) This marker is also present on Ewing’s sarcoma cells.(35) We observed some expression of NSE in the tumor samples carrying EWS-FLI1 transgene. Although further work is necessary to elucidate the cell of origin, it appears reasonable at this time to continue investigating the effects of EWS-FLI1 on primitive mesenchymal cells.
In summary, the EWS-FLI1 oncoprotein has profound effects on limb development in the mouse. Transgenic mice that express EWS-FLI1 in the embryonic limb bud develop severe limb shortening and developmental defects. The phenotype of the mice suggests that EWS-FLI1 impairs differentiation of mesenchymal cells. EWS-FLI1 is not a strong initiator of sarcoma formation in the mouse. However, it accelerates the formation of sarcomas and strongly favors the generation of poorly differentiated sarcomas when expressed in cells with a p53 null mutation.
Acknowledgments
We thank Anton Berns for the P53lox mouse, Jim Martin for the Prx1-Cre mouse. Histology of mouse tissues was performed by Carolyn Van Pelt. The EWS-FLI1 antibody was a gift from Eric McIntush (Bethyl Laboratories), who developed the antibody. The work was supported by grants from the Onstead Foundation, the Orthopaedic Research and Education Foundation, and the Texas ARP/ATP Program.
References
- 1.Delattre O, Zucman J, Plougastel B, et al. Gene fusion with an ETS DNA-binding domain caused by chromosome translocation in human tumours. Nature. 1992;359:162–5. doi: 10.1038/359162a0. [DOI] [PubMed] [Google Scholar]
- 2.Dejana E. Endothelial cell-cell junctions: happy together. Nat Rev Mol Cell Biol. 2004;5:261–70. doi: 10.1038/nrm1357. [DOI] [PubMed] [Google Scholar]
- 3.Cavazzana AO, Miser JS, Jefferson J, Triche TJ. Experimental evidence for a neural origin of Ewing’s sarcoma of bone. Am J Pathol. 1987;127:507–18. [PMC free article] [PubMed] [Google Scholar]
- 4.Rettig WJ, Garin-Chesa P, Huvos AG. Ewing’s sarcoma: new approaches to histogenesis and molecular plasticity. Lab Invest. 1992;66:133–7. [PubMed] [Google Scholar]
- 5.Ushigome S, Machinami R, Sorensen PH. Ewingsarcoma/primitive neuroectodermal tumor. In: Fletcher CDM, Unni KK, Mertens F, editors. WHO Classification ofTumors, Pathology and Genetics, Tumors of Soft Tissue and Bone. 2003. [Google Scholar]
- 6.May WA, Lessnick SL, Braun BS, et al. The Ewing’s sarcoma EWS/FLI-1 fusion gene encodes a more potent transcriptional activator and is a more powerful transforming gene than FLI-1. Mol Cell Biol. 1993;13:7393–8. doi: 10.1128/mcb.13.12.7393-7398.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Bailly RA, Bosselut R, Zucman J, et al. DNA-binding and transcriptional activation properties of the EWS-FLI-1 fusion protein resulting from the t(11;22) translocation in Ewing sarcoma. Mol Cell Biol. 1994;14:3230–41. doi: 10.1128/mcb.14.5.3230-3241.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Thompson AD, Braun BS, Arvand A, et al. EAT-2 is a novel SH2 domain containing protein that is up regulated by Ewing’s sarcoma EWS/FLI1 fusion gene. Oncogene. 1996;13:2649–58. [PubMed] [Google Scholar]
- 9.Braun BS, Frieden R, Lessnick SL, May WA, Denny CT. Identification of target genes for the Ewing’s sarcoma EWS/FLI fusion protein by representational difference analysis. Mol Cell Biol. 1995;15:4623–30. doi: 10.1128/mcb.15.8.4623. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.May WA, Arvand A, Thompson AD, Braun BS, Wright M, Denny CT. EWS/FLI1-induced manic fringe renders NIH 3T3 cells tumorigenic. Nat Genet. 1997;17:495–7. doi: 10.1038/ng1297-495. [DOI] [PubMed] [Google Scholar]
- 11.Fukuma M, Okita H, Hata J, Umezawa A. Upregulation of Id2, an oncogenic helix-loop-helix protein, is mediated by the chimeric EWS/ets protein in Ewing sarcoma. Oncogene. 2003;22:1–9. doi: 10.1038/sj.onc.1206055. [DOI] [PubMed] [Google Scholar]
- 12.Wai DH, Schaefer KL, Schramm A, et al. Expression analysis of pediatric solid tumor cell lines using oligonucleotide microarrays. Int J Oncol. 2002;20:441–51. [PubMed] [Google Scholar]
- 13.Hahm KB, Cho K, Lee C, et al. Repression of the gene encoding the TGF-beta type II receptor is a major target of the EWS-FLI1 oncoprotein. Nat Genet. 1999;23:222–7. doi: 10.1038/13854. [DOI] [PubMed] [Google Scholar]
- 14.Nakatani F, Tanaka K, Sakimura R, et al. Identification of p21WAF1/CIP1 as a direct target of EWS-Fli1 oncogenic fusion protein. J Biol Chem. 2003;278:15105–15. doi: 10.1074/jbc.M211470200. [DOI] [PubMed] [Google Scholar]
- 15.Dauphinot L, De Oliveira C, Melot T, et al. Analysis of the expression of cell cycle regulators in Ewing cell lines: EWS-FLI-1 modulates p57KIP2and c-Myc expression. Oncogene. 2001;20:3258–65. doi: 10.1038/sj.onc.1204437. [DOI] [PubMed] [Google Scholar]
- 16.Grier HE, Krailo MD, Tarbell NJ, et al. Addition of ifosfamide and etoposide to standard chemotherapy for Ewing’s sarcoma and primitive neuroectodermal tumor of bone. N Engl J Med. 2003;348:694–701. doi: 10.1056/NEJMoa020890. [DOI] [PubMed] [Google Scholar]
- 17.Kushner BH, Cheung NK, Kramer K, Dunkel IJ, Calleja E, Boulad F. Topotecan combined with myeloablative doses of thiotepa and carboplatin for neuroblastoma, brain tumors, and other poor-risk solid tumors in children and young adults. Bone Marrow Transplant. 2001;28:551–6. doi: 10.1038/sj.bmt.1703213. [DOI] [PubMed] [Google Scholar]
- 18.Rodriguez-Galindo C, Daw NC, Kaste SC, et al. Treatment of refractory osteosarcoma with fractionated cyclophosphamide and etoposide. J Pediatr Hematol Oncol. 2002;24:250–5. doi: 10.1097/00043426-200205000-00006. [DOI] [PubMed] [Google Scholar]
- 19.Damron TA, Ward WG, Stewart A. Osteosarcoma, chondrosarcoma, and Ewing’s sarcoma: National Cancer Data Base Report. Clin Orthop Relat Res. 2007;459:40–7. doi: 10.1097/BLO.0b013e318059b8c9. [DOI] [PubMed] [Google Scholar]
- 20.Torchia EC, Boyd K, Rehg JE, Qu C, Baker SJ. EWS/FLI-1 induces rapid onset of myeloid/erythroid leukemia in mice. Mol Cell Biol. 2007;27:7918–34. doi: 10.1128/MCB.00099-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Codrington R, Pannell R, Forster A, et al. The Ews-ERG fusion protein can initiate neoplasia from lineage-committed haematopoietic cells. PLoS Biol. 2005;3:e242. doi: 10.1371/journal.pbio.0030242. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Riggi N, Cironi L, Provero P, et al. Development of Ewing’s sarcoma from primary bone marrow-derived mesenchymal progenitor cells. Cancer Res. 2005;65:11459–68. doi: 10.1158/0008-5472.CAN-05-1696. [DOI] [PubMed] [Google Scholar]
- 23.Logan M, Martin JF, Nagy A, Lobe C, Olson EN, Tabin CJ. Expression of Cre Recombinase in the developing mouse limb bud driven by a Prxl enhancer. Genesis. 2002;33:77–80. doi: 10.1002/gene.10092. [DOI] [PubMed] [Google Scholar]
- 24.Schwenk F, Baron U, Rajewsky K. A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene segments including deletion in germ cells. Nucleic Acids Res. 1995;23:5080–1. doi: 10.1093/nar/23.24.5080. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Lewandoski M, Wassarman KM, Martin GR. Zp3-cre, a transgenic mouse line for the activation or inactivation of loxP-flanked target genes specifically in the female germ line. Curr Biol. 1997;7:148–51. doi: 10.1016/s0960-9822(06)00059-5. [DOI] [PubMed] [Google Scholar]
- 26.Marino S, Vooijs M, van Der Gulden H, Jonkers J, Berns A. Induction of medulloblastomas in p53-null mutant mice by somatic inactivation of Rb in the external granular layer cells of the cerebellum. Genes Dev. 2000;14:994–1004. [PMC free article] [PubMed] [Google Scholar]
- 27.Ikawa M, Kominami K, Yoshimura Y, Tanaka K, Nishimune Y, Okabe M. A rapid and non-invasive selection of transgenic embryos before implantation using green fluorescent protein (GFP) FEBS Lett. 1995;375:125–8. doi: 10.1016/0014-5793(95)01162-8. [DOI] [PubMed] [Google Scholar]
- 28.Eliazer S, Spencer J, Ye D, Olson E, Ilaria RL., Jr Alteration of mesodermal cell differentiation by EWS/FLI-1, the oncogene implicated in Ewing’s sarcoma. Mol Cell Biol. 2003;23:482–92. doi: 10.1128/MCB.23.2.482-492.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Torchia EC, Jaishankar S, Baker SJ. Ewing tumor fusion proteins block the differentiation of pluripotent marrow stromal cells. Cancer Res. 2003;63:3464–8. [PubMed] [Google Scholar]
- 30.Rorie CJ, Thomas VD, Chen P, Pierce HH, O’Bryan JP, Weissman BE. The Ews/Fli-1 fusion gene switches the differentiation program of neuroblastomas to Ewing sarcoma/peripheral primitive neuroectodermal tumors. Cancer Res. 2004;64:1266–77. doi: 10.1158/0008-5472.can-03-3274. [DOI] [PubMed] [Google Scholar]
- 31.Lessnick SL, Dacwag CS, Golub TR. The Ewing’s sarcoma oncoprotein EWS/FLI induces a p53-dependent growth arrest in primary human fibroblasts. Cancer Cell. 2002;1:393–401. doi: 10.1016/s1535-6108(02)00056-9. [DOI] [PubMed] [Google Scholar]
- 32.Deneen B, Denny CT. Loss of p16 pathways stabilizes EWS/FLI1 expression and complements EWS/FLI1 mediated transformation. Oncogene. 2001;20:6731–41. doi: 10.1038/sj.onc.1204875. [DOI] [PubMed] [Google Scholar]
- 33.Huang HY, Illei PB, Zhao Z, et al. Ewing sarcomas with p53 mutation or p16/p14ARF homozygous deletion: a highly lethal subset associated with poor chemoresponse. J Clin Oncol. 2005;23:548–58. doi: 10.1200/JCO.2005.02.081. [DOI] [PubMed] [Google Scholar]
- 34.Hu-Lieskovan S, Zhang J, Wu L, Shimada H, Schofield DE, Triche TJ. EWS-FLI1 fusion protein up-regulates critical genes in neural crest development and is responsible for the observed phenotype of Ewing’s family of tumors. Cancer Res. 2005;65:4633–44. doi: 10.1158/0008-5472.CAN-04-2857. [DOI] [PubMed] [Google Scholar]
- 35.Amann G, Zoubek A, Salzer-Kuntschik M, Windhager R, Kovar H. Relation of neurological marker expression and EWS gene fusion types in MIC2/CD99-positive tumors of the Ewing family. Hum Pathol. 1999;30:1058–64. doi: 10.1016/s0046-8177(99)90223-x. [DOI] [PubMed] [Google Scholar]




